Genetic Insights into Biofilm Formation by a Pathogenic Strain of Vibrio harveyi
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains and Culture Medium
2.2. Planktonic Growth
2.3. Biofilm Culture
2.4. Confocal Laser Scanning Microscopy (CLSM)
2.5. RNA Extraction
2.6. RNA-Sequencing and Data Analysis
2.7. mRNA Quantification by Reverse Transcription Followed by Quantitative PCR (RT-qPCR)
3. Results and Discussion
3.1. Biofilm Formation by V. harveyi
3.1.1. V. harveyi ORM4-GFP Biofilm Presents a Non-Uniform Structure
3.1.2. Matrix Component Distribution
3.2. Transcriptomic Comparison between Planktonic and Biofilm Cells
3.3. Differential Expression Analysis of Biofilm- and Virulence-Related Genes
3.3.1. DEGs Involved in Motility and Attachment
3.3.2. DEGs Involved in Polysaccharide Production
3.3.3. Genes Involved in Quorum Sensing
3.3.4. Type III Secretion System (T3SS)-Associated Genes
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Thompson, F.L.; Iida, T.; Swings, J. Biodiversity of Vibrios. Microbiol. Mol. Biol. Rev. 2004, 68, 403–431. [Google Scholar] [CrossRef]
- Li, L.; Mendis, N.; Trigui, H.; Oliver, J.D.; Faucher, S.P. The Importance of the Viable but Non-Culturable State in Human Bacterial Pathogens. Front. Microbiol. 2014, 5, 258. [Google Scholar] [CrossRef]
- Hung, D.T.; Zhu, J.; Sturtevant, D.; Mekalanos, J.J. Bile Acids Stimulate Biofilm Formation in Vibrio cholerae. Mol. Microbiol. 2006, 59, 193–201. [Google Scholar] [CrossRef]
- He, H.; Cooper, J.N.; Mishra, A.; Raskin, D.M. Stringent Response Regulation of Biofilm Formation in Vibrio cholerae. J. Bacteriol. 2012, 194, 2962–2972. [Google Scholar] [CrossRef]
- Beloin, C.; Ghigo, J.-M. Finding Gene-Expression Patterns in Bacterial Biofilms. Trends Microbiol. 2005, 13, 16–19. [Google Scholar] [CrossRef]
- Rodrigues, S.; Paillard, C.; Van Dillen, S.; Tahrioui, A.; Berjeaud, J.-M.; Dufour, A.; Bazire, A. Relation between Biofilm and Virulence in Vibrio tapetis: A Transcriptomic Study. Pathogens 2018, 7, 92. [Google Scholar] [CrossRef]
- Wang, Q.; Wang, P.; Liu, P.; Ou, J. Comparative Transcriptome Analysis Reveals Regulatory Factors Involved in Vibrio parahaemolyticus Biofilm Formation. Front. Cell. Infect. Microbiol. 2022, 12, 917131. [Google Scholar] [CrossRef]
- Frischkorn, K.R.; Stojanovski, A.; Paranjpye, R. Vibrio Parahaemolyticus Type IV Pili Mediate Interactions with Diatom-Derived Chitin and Point to an Unexplored Mechanism of Environmental Persistence: V. parahaemolyticus and Chitin. Environ. Microbiol. 2013, 15, 1416–1427. [Google Scholar] [CrossRef]
- Luo, G.; Huang, L.; Su, Y.; Qin, Y.; Xu, X.; Zhao, L.; Yan, Q. flrA, flrB and flrC Regulate Adhesion by Controlling the Expression of Critical Virulence Genes in Vibrio alginolyticus. Emerg. Microbes Infect. 2016, 5, e85. [Google Scholar] [CrossRef]
- Aagesen, A.M.; Phuvasate, S.; Su, Y.-C.; Häse, C.C. Persistence of Vibrio parahaemolyticus in the Pacific Oyster, Crassostrea gigas, Is a Multifactorial Process Involving Pili and Flagella but Not Type III Secretion Systems or Phase Variation. Appl. Environ. Microbiol. 2013, 79, 3303–3305. [Google Scholar] [CrossRef]
- Yildiz, F.H.; Schoolnik, G.K. Vibrio cholerae O1 El Tor: Identification of a Gene Cluster Required for the Rugose Colony Type, Exopolysaccharide Production, Chlorine Resistance, and Biofilm Formation. Proc. Natl. Acad. Sci. USA 1999, 96, 4028–4033. [Google Scholar] [CrossRef] [PubMed]
- Yildiz, F.H.; Visick, K.L. Vibrio Biofilms: So Much the Same yet so Different. Trends Microbiol. 2009, 17, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Limoli, D.H.; Jones, C.J.; Wozniak, D.J. Bacterial Extracellular Polysaccharides in Biofilm Formation and Function. Microbiol. Spectr. 2017, 3, 223–247. [Google Scholar]
- Ruhal, R.; Kataria, R. Biofilm Patterns in Gram-Positive and Gram-Negative Bacteria. Microbiol. Res. 2021, 251, 126829. [Google Scholar] [CrossRef]
- Güvener, Z.T.; McCarter, L.L. Multiple Regulators Control Capsular Polysaccharide Production in Vibrio parahaemolyticus. J. Bacteriol. 2003, 185, 5431–5441. [Google Scholar] [CrossRef]
- Enos-Berlage, J.L.; McCarter, L.L. Relation of Capsular Polysaccharide Production and Colonial Cell Organization to Colony Morphology in Vibrio parahaemolyticus. J. Bacteriol. 2000, 182, 5513–5520. [Google Scholar] [CrossRef]
- Enos-Berlage, J.L.; Guvener, Z.T.; Keenan, C.E.; McCarter, L.L. Genetic Determinants of Biofilm Development of Opaque and Translucent Vibrio parahaemolyticus: V. parahaemolyticus Biofilm Development. Mol. Microbiol. 2004, 55, 1160–1182. [Google Scholar] [CrossRef]
- Yip, E.S.; Grublesky, B.T.; Hussa, E.A.; Visick, K.L. A Novel, Conserved Cluster of Genes Promotes Symbiotic Colonization and σ54-Dependent Biofilm Formation by Vibrio fischeri: Syp, a Novel Symbiosis Locus in Vibrio fischeri. Mol. Microbiol. 2005, 57, 1485–1498. [Google Scholar] [CrossRef] [PubMed]
- Yip, E.S.; Geszvain, K.; DeLoney-Marino, C.R.; Visick, K.L. The Symbiosis Regulator RscS Controls the Syp Gene Locus, Biofilm Formation and Symbiotic Aggregation by Vibrio fischeri. Mol. Microbiol. 2006, 62, 1586–1600. [Google Scholar] [CrossRef]
- Shibata, S.; Yip, E.S.; Quirke, K.P.; Ondrey, J.M.; Visick, K.L. Roles of the Structural Symbiosis Polysaccharide (syp) Genes in Host Colonization, Biofilm Formation, and Polysaccharide Biosynthesis in Vibrio fischeri. J. Bacteriol. 2012, 194, 6736–6747. [Google Scholar] [CrossRef]
- Millet, Y.A.; Alvarez, D.; Ringgaard, S.; Von Andrian, U.H.; Davis, B.M.; Waldor, M.K. Insights into Vibrio cholerae Intestinal Colonization from Monitoring Fluorescently Labeled Bacteria. PLoS Pathog. 2014, 10, e1004405. [Google Scholar] [CrossRef]
- Faruque, S.M.; Biswas, K.; Udden, S.M.N.; Ahmad, Q.S.; Sack, D.A.; Nair, G.B.; Mekalanos, J.J. Transmissibility of Cholera: In vivo-Formed Biofilms and Their Relationship to Infectivity and Persistence in the Environment. Proc. Natl. Acad. Sci. USA 2006, 103, 6350–6355. [Google Scholar] [CrossRef] [PubMed]
- Tamayo, R.; Patimalla, B.; Camilli, A. Growth in a Biofilm Induces a Hyperinfectious Phenotype in Vibrio cholerae. Infect. Immun. 2010, 78, 3560–3569. [Google Scholar] [CrossRef]
- Gallego-Hernandez, A.L.; DePas, W.H.; Park, J.H.; Teschler, J.K.; Hartmann, R.; Jeckel, H.; Drescher, K.; Beyhan, S.; Newman, D.K.; Yildiz, F.H. Upregulation of Virulence Genes Promotes Vibrio cholerae Biofilm Hyperinfectivity. Proc. Natl. Acad. Sci. USA 2020, 117, 11010–11017. [Google Scholar] [CrossRef] [PubMed]
- Vidakovic, L.; Mikhaleva, S.; Jeckel, H.; Nisnevich, V.; Strenger, K.; Neuhaus, K.; Raveendran, K.; Ben-Moshe, N.B.; Aznaourova, M.; Nosho, K.; et al. Biofilm Formation on Human Immune Cells Is a Multicellular Predation Strategy of Vibrio cholerae. Cell 2023, 186, 2690–2704. [Google Scholar] [CrossRef] [PubMed]
- Austin, B.; Zhang, X.-H. Vibrio harveyi: A Significant Pathogen of Marine Vertebrates and Invertebrates. Lett. Appl. Microbiol. 2006, 43, 119–124. [Google Scholar] [CrossRef]
- Darshanee Ruwandeepika, H.A.; Sanjeewa Prasad Jayaweera, T.; Paban Bhowmick, P.; Karunasagar, I.; Bossier, P.; Defoirdt, T. Pathogenesis, Virulence Factors and Virulence Regulation of Vibrios Belonging to the Harveyi Clade: Virulence and Pathogenesis of Vibrios. Rev. Aquac. 2012, 4, 59–74. [Google Scholar] [CrossRef]
- Nicolas, J.; Basuyaux, O.; Mazurié, J.; Thébault, A. Vibrio carchariae, a Pathogen of the Abalone Haliotis tuberculata. Dis. Aquat. Org. 2002, 50, 35–43. [Google Scholar] [CrossRef]
- Cardinaud, M.; Barbou, A.; Capitaine, C.; Bidault, A.; Dujon, A.M.; Moraga, D.; Paillard, C. Vibrio harveyi Adheres to and Penetrates Tissues of the European Abalone Haliotis tuberculata within the First Hours of Contact. Appl. Environ. Microbiol. 2014, 80, 6328–6333. [Google Scholar] [CrossRef]
- Travers, M.-A.; Le Goïc, N.; Huchette, S.; Koken, M.; Paillard, C. Summer Immune Depression Associated with Increased Susceptibility of the European Abalone, Haliotis tuberculata to Vibrio harveyi Infection. Fish Shellfish. Immunol. 2008, 25, 800–808. [Google Scholar] [CrossRef]
- Cardinaud, M.; Dheilly, N.M.; Huchette, S.; Moraga, D.; Paillard, C. The Early Stages of the Immune Response of the European Abalone Haliotis tuberculata to a Vibrio harveyi Infection. Dev. Comp. Immunol. 2015, 51, 287–297. [Google Scholar] [CrossRef]
- Morot, A.; El Fekih, S.; Bidault, A.; Le Ferrand, A.; Jouault, A.; Kavousi, J.; Bazire, A.; Pichereau, V.; Dufour, A.; Paillard, C.; et al. Virulence of Vibrio harveyi ORM4 towards the European Abalone Haliotis tuberculata Involves Both Quorum Sensing and a Type III Secretion System. Environ. Microbiol. 2021, 23, 5273–5288. [Google Scholar] [CrossRef] [PubMed]
- Azeredo, J.; Azevedo, N.F.; Briandet, R.; Cerca, N.; Coenye, T.; Costa, A.R.; Desvaux, M.; Di Bonaventura, G.; Hébraud, M.; Jaglic, Z.; et al. Critical Review on Biofilm Methods. Crit. Rev. Microbiol. 2017, 43, 313–351. [Google Scholar] [CrossRef] [PubMed]
- Tolker-Nielsen, T.; Sternberg, C. Methods for Studying Biofilm Formation: Flow Cells and Confocal Laser Scanning Microscopy. In Pseudomonas Methods and Protocols; Filloux, A., Ramos, J.-L., Eds.; Methods in Molecular Biology; Springer: New York, NY, USA, 2014; Volume 1149, pp. 615–629. ISBN 978-1-4939-0472-3. [Google Scholar]
- Weiss Nielsen, M.; Sternberg, C.; Molin, S.; Regenberg, B. Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells. J. Vis. Exp. 2011, 15, 2383. [Google Scholar]
- Chen, M.-Y.; Lee, D.-J.; Tay, J.-H.; Show, K.-Y. Staining of Extracellular Polymeric Substances and Cells in Bioaggregates. Appl. Microbiol. Biotechnol. 2007, 75, 467–474. [Google Scholar] [CrossRef]
- Allesen-Holm, M.; Barken, K.B.; Yang, L.; Klausen, M.; Webb, J.S.; Kjelleberg, S.; Molin, S.; Givskov, M.; Tolker-Nielsen, T. A Characterization of DNA Release in Pseudomonas aeruginosa Cultures and Biofilms. Mol. Microbiol. 2006, 59, 1114–1128. [Google Scholar] [CrossRef] [PubMed]
- Heydorn, A.; Nielsen, A.T.; Hentzer, M.; Sternberg, C.; Givskov, M.; Ersbøll, B.K.; Molin, S. Quantification of Biofilm Structures by the Novel Computer Program Comstat. Microbiology 2000, 146, 2395–2407. [Google Scholar] [CrossRef]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on September 2022).
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Langmead, B.; Salzberg, S.L. Fast Gapped-Read Alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python Framework to Work with High-Throughput Sequencing Data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Varet, H.; Brillet-Guéguen, L.; Coppée, J.-Y.; Dillies, M.-A. SARTools: A DESeq2- and EdgeR-Based R Pipeline for Comprehensive Differential Analysis of RNA-Seq Data. PLoS ONE 2016, 11, e0157022. [Google Scholar] [CrossRef] [PubMed]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. B Stat. Methodol. 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Wickham, H. Ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016; ISBN 978-3-319-24275-0. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Morot, A. Elucidation des Mécanismes Moléculaires de Colonisation D’organismes Marins par le Pathogène Vibrio harveyi. Ph.D. Thesis, Université Bretagne Sud, Lorient, France, 2023. [Google Scholar]
- Bilecen, K.; Yildiz, F.H. Identification of a Calcium-Controlled Negative Regulatory System Affecting Vibrio cholerae Biofilm Formation. Environl. Microbiol. 2009, 11, 2015–2029. [Google Scholar] [CrossRef]
- Rodrigues, S.; Paillard, C.; Le Pennec, G.; Dufour, A.; Bazire, A. Vibrio tapetis, the Causative Agent of Brown Ring Disease, Forms Biofilms with Spherical Components. Front. Microbiol. 2015, 6, 1384. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Wang, J.J.; Qian, H.; Tan, L.; Zhang, Z.; Liu, H.; Pan, Y.; Zhao, Y. Insights into the Role of Extracellular DNA and Extracellular Proteins in Biofilm Formation of Vibrio parahaemolyticus. Front. Microbiol. 2020, 11, 813. [Google Scholar] [CrossRef] [PubMed]
- Fong, J.C.N.; Karplus, K.; Schoolnik, G.K.; Yildiz, F.H. Identification and Characterization of RbmA, a Novel Protein Required for the Development of Rugose Colony Morphology and Biofilm Structure in Vibrio cholerae. J. Bacteriol. 2006, 188, 1049–1059. [Google Scholar] [CrossRef]
- Donlan, R.M. Biofilms: Microbial Life on Surfaces. Emerg. Infect. Dis. 2002, 8, 881–890. [Google Scholar] [CrossRef]
- Henares, B.; Xu, Y.; Boon, E. A Nitric Oxide-Responsive Quorum Sensing Circuit in Vibrio harveyi Regulates Flagella Production and Biofilm Formation. Int. J. Mol. Sci. 2013, 14, 16473–16484. [Google Scholar] [CrossRef]
- Flemming, H.-C.; Wingender, J.; Szewzyk, U.; Steinberg, P.; Rice, S.A.; Kjelleberg, S. Biofilms: An Emergent Form of Bacterial Life. Nat. Rev. Microbiol. 2016, 14, 563–575. [Google Scholar] [CrossRef]
- Duong-Nu, T.-M.; Jeong, K.; Hong, S.H.; Puth, S.; Kim, S.Y.; Tan, W.; Lee, K.H.; Lee, S.E.; Rhee, J.H. A Stealth Adhesion Factor Contributes to Vibrio vulnificus Pathogenicity: Flp Pili Play Roles in Host Invasion, Survival in the Blood Stream and Resistance to Complement Activation. PLoS Pathog. 2019, 15, e1007767. [Google Scholar] [CrossRef] [PubMed]
- Papenfort, K.; Bassler, B.L. Quorum Sensing Signal–Response Systems in Gram-Negative Bacteria. Nat. Rev. Microbiol. 2016, 14, 576–588. [Google Scholar] [CrossRef]
- Kaur, D.; Mukhopadhaya, A. Outer Membrane Protein OmpV Mediates Salmonella enterica Serovar Typhimurium Adhesion to Intestinal Epithelial Cells via Fibronectin and α1β1 Integrin. Cell. Microbiol. 2020, 22, e13172. [Google Scholar] [CrossRef]
- Izoré, T.; Job, V.; Dessen, A. Biogenesis, Regulation, and Targeting of the Type III Secretion System. Structure 2011, 19, 603–612. [Google Scholar] [CrossRef]
- Broberg, C.A.; Zhang, L.; Gonzalez, H.; Laskowski-Arce, M.A.; Orth, K. A Vibrio Effector Protein Is an Inositol Phosphatase and Disrupts Host Cell Membrane Integrity. Science 2010, 329, 1660–1662. [Google Scholar] [CrossRef]
- Whiteley, M.; Bangera, M.G.; Bumgarner, R.E.; Parsek, M.R.; Teitzel, G.M.; Lory, S.; Greenberg, E.P. Gene Expression in Pseudomonas aeruginosa Biofilms. Nature 2001, 413, 860–864. [Google Scholar] [CrossRef]
- Guttenplan, S.B.; Kearns, D.B. Regulation of Flagellar Motility during Biofilm Formation. FEMS Microbiol. Rev. 2013, 37, 849–871. [Google Scholar] [CrossRef]
- Marsh, J.W.; Taylor, R.K. Genetic and Transcriptional Analyses of the Vibrio cholerae Mannose-Sensitive Hemagglutinin Type 4 Pilus Gene Locus. J. Bacteriol. 1999, 181, 1110–1117. [Google Scholar] [CrossRef] [PubMed]
- Meibom, K.L.; Li, X.B.; Nielsen, A.T.; Wu, C.-Y.; Roseman, S.; Schoolnik, G.K. The Vibrio cholerae Chitin Utilization Program. Proc. Natl. Acad. Sci. USA 2004, 101, 2524–2529. [Google Scholar] [CrossRef] [PubMed]
- Watnick, P.I.; Fullner, K.J.; Kolter, R. A Role for the Mannose-Sensitive Hemagglutinin in Biofilm Formation by Vibrio cholerae El Tor. J. Bacteriol. 1999, 181, 3606–3609. [Google Scholar] [CrossRef]
- Hospenthal, M.K.; Costa, T.R.D.; Waksman, G. A Comprehensive Guide to Pilus Biogenesis in Gram-Negative Bacteria. Nat. Rev. Microbiol. 2017, 15, 365–379. [Google Scholar] [CrossRef]
- Watnick, P.I.; Lauriano, C.M.; Klose, K.E.; Croal, L.; Kolter, R. The Absence of a Flagellum Leads to Altered Colony Morphology, Biofilm Development and Virulence in Vibrio cholerae O139. Mol. Microbiol. 2001, 39, 223–235. [Google Scholar] [CrossRef] [PubMed]
- Paranjpye, R.N.; Strom, M.S. A Vibrio vulnificus Type IV Pilin Contributes to Biofilm Formation, Adherence to Epithelial Cells, and Virulence. Infect. Immun. 2005, 73, 1411–1422. [Google Scholar] [CrossRef]
- Vallenet, D.; Calteau, A.; Dubois, M.; Amours, P.; Bazin, A.; Beuvin, M.; Burlot, L.; Bussell, X.; Fouteau, S.; Gautreau, G.; et al. MicroScope: An Integrated Platform for the Annotation and Exploration of Microbial Gene Functions through Genomic, Pangenomic and Metabolic Comparative Analysis. Nucleic Acids Res. 2020, 48, 579–589. [Google Scholar] [CrossRef] [PubMed]
- Tomich, M.; Planet, P.J.; Figurski, D.H. The Tad Locus: Postcards from the Widespread Colonization Island. Nat. Rev. Microbiol. 2007, 5, 363–375. [Google Scholar] [CrossRef]
- Pu, M.; Rowe-Magnus, D.A. A Tad Pilus Promotes the Establishment and Resistance of Vibrio vulnificus Biofilms to Mechanical Clearance. NPJ Biofilms Microbiomes 2018, 4, 10. [Google Scholar] [CrossRef]
- Van Schaik, E.J.; Giltner, C.L.; Audette, G.F.; Keizer, D.W.; Bautista, D.L.; Slupsky, C.M.; Sykes, B.D.; Irvin, R.T. DNA Binding: A Novel Function of Pseudomonas aeruginosa Type IV Pili. J. Bacteriol. 2005, 187, 1455–1464. [Google Scholar] [CrossRef]
- Zogaj, X.; Nimtz, M.; Rohde, M.; Bokranz, W.; Romling, U. The Multicellular Morphotypes of Salmonella Typhimurium and Escherichia coli Produce Cellulose as the Second Component of the Extracellular Matrix. Mol. Microbiol. 2001, 39, 1452–1463. [Google Scholar] [CrossRef] [PubMed]
- Morris, A.R.; Visick, K.L. Control of Biofilm Formation and Colonization in Vibrio fischeri: A Role for Partner Switching?: Partner Switching in Vibrio fischeri. Environ. Microbiol. 2010, 12, 2051–2059. [Google Scholar] [CrossRef]
- Morris, A.R.; Visick, K.L. Inhibition of SypG-Induced Biofilms and Host Colonization by the Negative Regulator SypE in Vibrio fischeri. PLoS ONE 2013, 8, e60076. [Google Scholar] [CrossRef]
- Ludvik, D.A.; Bultman, K.M.; Mandel, M.J. Hybrid Histidine Kinase BinK Represses Vibrio Fischeri Biofilm Signaling at Multiple Developmental Stages. J. Bacteriol. 2021, 203, e0015521. [Google Scholar] [CrossRef]
- Tsuneda, S.; Aikawa, H.; Hayashi, H.; Yuasa, A.; Hirata, A. Extracellular Polymeric Substances Responsible for Bacterial Adhesion onto Solid Surface. FEMS Microbiol. Lett. 2003, 223, 287–292. [Google Scholar] [CrossRef] [PubMed]
- Das, T.; Sharma, P.K.; Busscher, H.J.; Van Der Mei, H.C.; Krom, B.P. Role of Extracellular DNA in Initial Bacterial Adhesion and Surface Aggregation. Appl. Environ. Microbiol. 2010, 76, 3405–3408. [Google Scholar] [CrossRef]
- Nealson, K.H.; Platt, T.; Hastings, J.W. Cellular Control of the Synthesis and Activity of the Bacterial Luminescent System. J. Bacteriol. 1970, 104, 313–322. [Google Scholar] [CrossRef] [PubMed]
- Miller, M.B. Quorum sensing in bacteria. Annu. Rev. Microbiol. 2001, 55, 165–199. [Google Scholar] [CrossRef]
- Zhou, X.; Konkel, M.E.; Call, D.R. Regulation of Type III Secretion System 1 Gene Expression in Vibrio parahaemolyticus Is Dependent on Interactions between ExsA, ExsC, and ExsD. Virulence 2010, 1, 260–272. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Deng, Y.; Feng, J.; Guo, Z.; Chen, H.; Wang, B.; Hu, J.; Lin, Z.; Su, Y. Functional Characterization of VscCD, an Important Component of the Type III Secretion System of Vibrio harveyi. Microb. Pathog. 2021, 157, 104965. [Google Scholar] [CrossRef]
- Casselli, T.; Lynch, T.; Southward, C.M.; Jones, B.W.; DeVinney, R. Vibrio parahaemolyticus Inhibition of Rho Family GTPase Activation Requires a Functional Chromosome I Type III Secretion System. Infect. Immun. 2008, 76, 2202–2211. [Google Scholar] [CrossRef] [PubMed]
- Ono, T.; Park, K.-S.; Ueta, M.; Iida, T.; Honda, T. Identification of Proteins Secreted via Vibrio parahaemolyticus Type III Secretion System 1. Infect. Immun. 2006, 74, 1032–1042. [Google Scholar] [CrossRef] [PubMed]
- Green, E.R.; Mecsas, J. Bacterial Secretion Systems: An Overview. Virul. Mech. Bact. Pathog. 2016, 4, 213–239. [Google Scholar]
- Chen, L.; Zou, Y.; Kronfl, A.A.; Wu, Y. Type VI Secretion System of Pseudomonas aeruginosa Is Associated with Biofilm Formation but Not Environmental Adaptation. MicrobiologyOpen 2020, 9, e991. [Google Scholar] [CrossRef] [PubMed]
- Gallique, M.; Decoin, V.; Barbey, C.; Rosay, T.; Feuilloley, M.G.J.; Orange, N.; Merieau, A. Contribution of the Pseudomonas fluorescens MFE01 Type VI Secretion System to Biofilm Formation. PLoS ONE 2017, 12, e0170770. [Google Scholar] [CrossRef]
- Salomon, D.; Guo, Y.; Kinch, L.N.; Grishin, N.V.; Gardner, K.H.; Orth, K. Effectors of Animal and Plant Pathogens Use a Common Domain to Bind Host Phosphoinositides. Nat. Commun. 2013, 4, 2973. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Krachler, A.M.; Broberg, C.A.; Li, Y.; Mirzaei, H.; Gilpin, C.J.; Orth, K. Type III Effector VopC Mediates Invasion for Vibrio Species. Cell Rep. 2012, 1, 453–460. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Liu, J.; Deng, Y.; Huang, W.; Ren, C.; Call, D.R.; Hu, C. The Vibrio alginolyticus T3SS Effectors, Val1686 and Val1680, Induce Cell Rounding, Apoptosis and Lysis of Fish Epithelial Cells. Virulence 2018, 9, 318–330. [Google Scholar] [CrossRef]
Primer Name | 5′-3′ Sequence | Amplified Gene (ID) |
---|---|---|
ARNr16S-F | TGCGCTTTACGCCCAGTAAT | rRNA 16S |
ARNr16S-R | GGTAATACGGAGGGTGCGAG | |
flp-F | CGAGGTGTAACCGCTGTTGAA | flp (HORM4_610121) |
flp-R | TGATGACATTGCAACAGCGA | |
Vscn-F | CCTCGTCGTGTTGGTGGTTC | vscN (HORM4_240127) |
Vscn-R | AGCTCAGCGTGAGATTGGCT | |
VPA0450-F | TCGCTGAGGTCACATCATCAA | vpa0450 (HORM4_520123) |
VPA0450-R | AGCCTGATACTGATCCGGCA | |
luxR-F | TGTTTTGCACCAGCAGTTGG | luxR (HORM4_420032) |
luxR-R | GGCCGCTATTCGTAACGACA | |
ompV-F | CATCGTTGTCACCTAGGAAACG | ompV (HORM4_1070102) |
ompV-R | TCAACGCTGATTTAGGCGGT | |
sypH-F | CGTCAAGGATGAGCCTTACGA | sypH (HORM4_640016) |
sypH-R | GCCTCACGTCCCGTTTCTAC | |
920008-F | GACCTTCGTCAGACCCAACG | HORM4_920008 |
920008-R | TATCGGCTGGTGCAGTTGC | |
1130010-F | TCAAATAGAAGAGTTGGCTGCG | HORM4_1130010 |
1130010-R | GGACCAAAAATCCCTTTCACG |
Gene ID | Gene Name | COG | FC | Log2FC | Product |
---|---|---|---|---|---|
HORM4_640012 | sypB | M | 0.1 | −3 | Outer membrane protein |
HORM4_640013 | sypC | M | 0.2 | −2.7 | Polysaccharide export periplasmic protein |
HORM4_640014 | sypD | M | 0.2 | −2 | Chromosome partitioning ATPase |
HORM4_640016 | sypG | T | 0.2 | −2.7 | Sigma-54 dependent transcriptional regulator |
HORM4_640017 | sypH | M | 0.3 | −2 | Glycosyl transferases group 1 |
Gene ID | Gene Name | COG | FC | Log2FC | Product |
---|---|---|---|---|---|
HORM4_830068 | cqsA | E | Not DEG | CAI-1 autoinducer synthase | |
HORM4_830069 | cqsS | T | 0.6 | −0.7 | CAI-1 autoinducer sensor kinase/phosphatase CqsS |
HORM4_530027 | luxM | T | Not DEG | Acyl-homoserine-lactone synthase LuxM | |
HORM4_530026 | luxN | T | Not DEG | Autoinducer 1 sensor kinase/phosphatase LuxN | |
HORM4_420009 | luxS | T | Not DEG | S-ribosylhomocysteinase | |
HORM4_930034 | luxP | G | Not DEG | Autoinducer 2-binding periplasmic protein LuxP | |
HORM4_930033 | luxQ | T | Not DEG | Autoinducer 2 sensor kinase/phosphatase LuxQ | |
HORM4_520007 | luxU | T | Not DEG | Phosphorelay protein LuxU | |
HORM4_520006 | luxO | T | 0.6 | −0.8 | Transcriptional regulator LuxO |
HORM4_420032 | luxR | K | 0.6 | −0.8 | Transcriptional regulator LuxR |
Gene ID | Gene Name | COG | FC | Log2FC | Product |
---|---|---|---|---|---|
HORM4_240099 | vscB | O | 3.3 | 1.7 | T3SS chaperone, YscB family |
HORM4_240100 | vscC | U | 2.7 | 1.4 | T3SS secretin (VscC) |
HORM4_240101 | vscD | S | 2.2 | 1.1 | T3SS inner membrane ring protein (VscD) |
HORM4_240103 | vscF | U | 2.8 | 1.5 | Needle major subunit (VscF) |
HORM4_240104 | vscG | S | 3.1 | 1.6 | T3SS chaperone (VscG) |
HORM4_240105 | vscH | S | 3.8 | 1.9 | T3SS effector, YopR family |
HORM4_240106 | vscI | S | 3.1 | 1.6 | T3SS inner rod protein (VscI) |
HORM4_240107 | vscJ | U | 2.1 | 1.1 | T3SS bridge between inner and outer membrane lipoprotein (VscJ) |
HORM4_240109 | vscL | N | 2.7 | 1.4 | Yop proteins translocation protein L (VscL) |
HORM4_240121 | vscT | U | 1.9 | 0.9 | T3SS inner membrane protein (VscT) |
HORM4_240123 | vscR | U | 2 | 1 | T3SS inner membrane protein (VscR) |
HORM4_240124 | vscQ | N | 2.6 | 1.4 | T3SS inner membrane protein (VscQ) |
HORM4_240126 | vscO | U | 2.3 | 1.2 | Putative T3SS chaperone (VscO) |
HORM4_240127 | vscN | N | 3.5 | 1.8 | ATPase (VscN) |
HORM4_240128 | yopN | S | 2.1 | 1.1 | T3SS secretion regulator (YopN) |
HORM4_240130 | sycN | S | 2 | 1 | T3SS chaperone (SycN) |
HORM4_240131 | vscX | U | 2.6 | 1.4 | Putative type III secretion protein (VscX) |
HORM4_240133 | vcrD | U | 2.8 | 1.5 | Low calcium response protein (VcrD) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morot, A.; Delavat, F.; Bazire, A.; Paillard, C.; Dufour, A.; Rodrigues, S. Genetic Insights into Biofilm Formation by a Pathogenic Strain of Vibrio harveyi. Microorganisms 2024, 12, 186. https://doi.org/10.3390/microorganisms12010186
Morot A, Delavat F, Bazire A, Paillard C, Dufour A, Rodrigues S. Genetic Insights into Biofilm Formation by a Pathogenic Strain of Vibrio harveyi. Microorganisms. 2024; 12(1):186. https://doi.org/10.3390/microorganisms12010186
Chicago/Turabian StyleMorot, Amandine, François Delavat, Alexis Bazire, Christine Paillard, Alain Dufour, and Sophie Rodrigues. 2024. "Genetic Insights into Biofilm Formation by a Pathogenic Strain of Vibrio harveyi" Microorganisms 12, no. 1: 186. https://doi.org/10.3390/microorganisms12010186
APA StyleMorot, A., Delavat, F., Bazire, A., Paillard, C., Dufour, A., & Rodrigues, S. (2024). Genetic Insights into Biofilm Formation by a Pathogenic Strain of Vibrio harveyi. Microorganisms, 12(1), 186. https://doi.org/10.3390/microorganisms12010186