Next Article in Journal
Biocontrol Activity of Bacillus altitudinis CH05 and Bacillus tropicus CH13 Isolated from Capsicum annuum L. Seeds against Fungal Strains
Previous Article in Journal
Challenges in Diagnosis of COVID-19 Pneumonia under Ocrelizumab and De-Risking Strategies in Multiple Sclerosis—The Elephant Is (Still) in the Room
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 12
Issue 10
10.3390/microorganisms12101942
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization of Carbapenem and Colistin Resistance in Klebsiella pneumoniae Isolates Obtained from Clinical Samples at a University Hospital Center in Algeria

by
Riyane Rihane
1,*,
Abla Hecini-Hannachi
2,*,
Chafia Bentchouala
2,3,
Kaddour Benlabed
2,3 and
Seydina M. Diene
4
1
Molecular and Cellular Biology Laboratory, University of Mentouri Brothers Constantine 1, Constantine 25000, Algeria
2
Department of Medicine, Faculty of Medicine, University of Salah Boubnider Constantine 3, Constantine 25000, Algeria
3
Bacteriology Laboratory, Benbadis University Hospital, Constantine 25000, Algeria
4
Microbes Evolution Phylogeny and Infections (MEPHI), Institut de Recherche pour le Développement (IRD), Assistance Publique-Hopitaux de Marseille (AP-HM), IHU-Méditerranée Infection, Faculté de Pharmacie, Aix-Marseille University, 13385 Marseille, France
*
Authors to whom correspondence should be addressed.
Microorganisms 2024, 12(10), 1942; https://doi.org/10.3390/microorganisms12101942
Submission received: 16 August 2024 / Revised: 11 September 2024 / Accepted: 13 September 2024 / Published: 25 September 2024
(This article belongs to the Special Issue Bacterial Infections in Clinical Settings)
Browse Figures
Versions Notes

Abstract

:
The current study aimed to determine the molecular mechanisms of carbapenem and colistin resistance among the clinical isolates of Klebsiella pneumoniae from hospitalized patients admitted to a university hospital in Eastern Algeria. In total, 124 non-duplicate isolates of K. pneumoniae were collected from September 2018 to April 2019. Bacterial identification was performed using MALDI-TOF MS. The presence of extended spectrum β-lactamase (ESBL) genes, carbapenemase genes, chromosomal mutation and mcr genes in colistin-resistant K. pneumoniae were evaluated by PCR. ESBLs represented a rate of 49.1% and harbored blaCTX-M, blaTEM and blaSHV genes. Concerning carbapenems, 12 strains (9.6%) were resistant to ertapenem (MIC: 1–32 μg/mL), of which one strain (0.8%) was also resistant to imipenem (MIC: 32 μg/mL). Among these strains, nine (75%) harbored blaOXA-48 gene. Seven strains (5.6%) expressed resistance to colistin (MIC: 2–32 μg/mL), of which two harbored mcr-8 and mgrB genes simultaneously. The existence of a double resistance to colistin in the same strain is new in Algeria, and this could raise concerns about the increase in levels of resistance to this antibiotic (MIC: 32 μg/mL). The mgrB gene alone was observed in five isolates (71.4%), including two strains harboring blaOXA-48. This is the first report revealing the presence of K. pneumoniae strains carrying the blaOXA-48 gene as well as a mutation in the mgrB gene. Large-scale surveillance and effective infection control measures are also urgently needed to prevent the outbreak of various carbapenem- and colistin-resistant isolates.

1. Introduction

Gram-negative bacterial (GNB) resistance to antimicrobials is increasing worldwide. Klebsiella pneumoniae is one of the major causes of nosocomial infections that can carry many antibiotic resistance genes such as extended-spectrum β-lactamases (ESBLs), and because of the production of these enzymes, the use of third and fourth generation cephalosporins is restricted [1]. Carbapenem antibiotics are recommended as one of the last lines of therapy for multidrug-resistant (MDR) strains of K. pneumoniae. However, increasing the rate of resistance to carbapenems has complicated the treatment process and led to untreatable hospital infections [2].
The mortality rate associated with carbapenem-resistant K pneumoniae (CR-Kp) infections is alarmingly high, with risk factors including ICU stays and comorbid conditions [3]. CR-Kp poses a significant threat due to its complex resistance mechanisms and widespread dissemination. CR-Kp exhibits resistance through several mechanisms, with a key one being the production of carbapenemases, which are classified into Ambler classes A (e.g., K pneumoniae carbapenemase, KPC), B (e.g., New Delhi metallo-β-lactamases, NDM), and D (e.g., OXA-48-like carbapenemases). These enzymes hydrolyze carbapenems and are typically encoded on mobile genetic elements (MGEs), facilitating their horizontal transfer [4,5,6,7]. KPC-producing strains exhibit high clonal expansion and mobile gene transfer, which complicates control efforts as these strains can persist in human reservoirs and form biofilms that resist hospital disinfection protocols [4,5,6]. The spread of carbapenem resistance has been linked to IncC plasmids, which have a broad host range and often carry carbapenemase genes. These plasmids contribute to the regional and global spread of resistance [8]. In recent studies, IncC plasmids have been increasingly reported in carbapenem-resistant bacterial isolates across Asia, highlighting the need for ongoing surveillance [8]. Resistance mechanisms also involve efflux pumps and porin loss, in addition to enzymatic activity [9].
The rising incidence of carbapenem resistance in the K. pneumoniae complex, coupled with the absence of new antibiotic classes effective against GNB, has significantly restricted treatment options for carbapenem-resistant strains of this complex. As a result, there has been a renewed reliance on colistin for managing infections caused by these resistant K. pneumoniae strains [10]. Colistin is now recommended as the last choice for the treatment of MDR GNB, especially carbapenem-resistant Enterobacteriaceae (CRE) infections [11]. The recent increase in the use of colistin in clinical practice, accompanied by its unbridled use in agriculture, has contributed to the rapid dissemination of resistance [12]. Polymyxin resistance was thought to occur only through chromosomal mutations between the genes regulating pmrA/B and phoP/Q binary systems or mutations in the mgrB gene [13,14], leading to amino acid changes, insertions, and deletions in the proteins produced by these genes [10]. In K. pneumoniae, a common mechanism of colistin resistance involves the inactivation of mgrB, which encodes a negative regulator of the PhoPQ two-component regulatory system. This inactivation often occurs due to the insertion of an insertion sequence (IS) element or mutations that create premature stop codons [10,15], but the recent discovery of the plasmid-dependent mcr-1 revealed another form of resistance to colistin. This gene is based on moving genetic elements and due to horizontal gene transfer; it has caused resistance and has therefore spread throughout the world. The acquisition of mobile genetic elements containing genes from the mcr family can also result in modifications to lipids [16,17]. Following the discovery of mcr-1, other genes such as mcr-2 and mcr-9 have been reported [16], as well as the recently identified mcr-10 [18]. However, there have been few reports of the presence of mcr-1, mcr-3, mcr-7, and mcr-8 in K. pneumoniae, with these variants occurring at relatively low prevalence [19]. All MCR proteins function as phosphoethanolamine (PEtN) transferases, which facilitate the addition of PEtN to lipid A. This modification decreases the negative charge of lipopolysaccharides (LPSs) by altering lipid A’s structure, thereby reducing colistin binding and leading to colistin resistance [20]. The spread of this plasmid-mediated resistance from animals—where colistin has been used for years as a therapeutic agent or food additive—to humans via horizontal gene transfer has been suggested. Mcr gene-carrying Enterobacteriaceae are found more frequently on hospital surfaces than in clinical isolates, indicating the plasmid’s ability to spread not only in vitro but also among key human pathogens. The persistent contamination of hospital surfaces may thus facilitate the spread of colistin resistance among GNB, potentially exacerbated by selective pressures from some antiseptics (e.g., chlorhexidine) [16].
Other mechanisms contributing to colistin resistance in K. pneumoniae include the increased expression of efflux pumps, alterations in lipopolysaccharide (LPS) production, the excessive production of capsular polysaccharides, and the production of colistinase [21,22]. Due to the lack of information about the resistance of clinical K. pneumoniae to carbapenem and colistin in Algeria, the main purpose of this study was to evaluate the antimicrobial resistance patterns and molecular mechanisms of carbapenem and colistin resistance among the clinical isolates of K. pneumoniae from hospitalized patients admitted to a university hospital in Eastern Algeria.

2. Materials and Methods

2.1. Study Design and Clinical Sample Collection

In this prospective and monocentric study conducted at the Benbadis University Hospital Centre in Constantine, Algeria, over seven months (September 2018–April 2019), 124 non-redundant K pneumoniae strains were isolated from hospitalized patients of all ages and both sexes. Strains were selected based on clinical relevance, with one strain per patient included to avoid redundancy. Isolates were obtained from various clinical samples, such as blood, urine, and respiratory secretions, and identified using standard microbiological methods. Our work has been approved by the ethics committee of Constantine Hospital to carry out this research. Our strains were identified after being cultivated and incubated for 24 h at 37 ± 1 °C on MacConkey agar (BioMerieux, Marcy l’Etoile, France), and the identification of each strain was performed by using the MALDI TOF MS (Microflex LT) spectrometer (Bruker Daltonics, Bremen, Germany) by testing a colony from a pure culture two times in order to confirm our identification.

2.2. Antimicrobial Susceptibility Testing

The antibiotic susceptibility testing of clinical specimens was performed using the disk diffusion method on Mueller–Hinton (MH) agar II (Becton Dickinson Bioscience, east Rutherford, new jersey) according to recommendations of the European Committee on Antimicrobial Susceptibility Testing (EUCAST) 2021. The following antibiotics disks were used to assess the susceptibility of Enterobacteriaceae isolates: amoxicillin (AMX20), amoxicillin + clavulanic acid (AMC30), cefepime (FEP 30), piperacillin + tazobactam (TZP 36), mecillinam (MEC 10), ceftriaxone (CRO30), ertapenem (ETP10), imipenem (IPM10), fosfomycin (FF200), nitrofurantoin (F100), trimethoprim + sulfamethoxazole (SXT25), amikacin (AK30), ciprofloxacin (CIP5), tetracycline (TET30), colistin (CS50) and gentamicin (GN10) (Sirscan, Montpellier, France) All isolates were screened for ESBL via the synergy test between a third-generation cephalosporin and clavulanate (CRO, AMC, FEP). For strains resistant to imipenem (IPM) and ertapenem (ETP), the minimum inhibitory concentrations (MICs) were determined using the Etest method (Biomerieux, Craponne, France). Additionally, a qualitative colorimetric test (the β CARBA test) was performed to detect the production of carbapenemase 16. Colistin MIC was performed using the microdilution method (the UMIC test). Susceptibility patterns were interpreted according to the EUCAST 2021 guidelines (www.eucast.org accessed on 14 March 2023) using the Interscience scan 4000 France.

2.3. Molecular Investigation of Antibiotic Resistance Genes

The presence of ESBL and carbapenemase resistance genes was determined by real-time PCR (RT-PCR) reactions. For this purpose, a colony of each culture of our bacterial isolates was taken and was resuspended in 200 µL in distilled sterile water (Biorad, Marnes-la-Coquette, France) and heated to 70 °C for 10 min and then agitated for about 1 min in order to extract the strains DNA. Our ready DNA fractions were directly used for RT-PCR and standard PCR reactions, using CFX OPUS 96 REAL TIME PCR SYSTEM (Biorad, Marnes-la-Coquette, France) and PCR SYSTEM (Bio-Rad). Our extracted DNA was stored at −20 °C for further experiments.

2.4. Primer and TaqMan Probes

The references and information about the already characterized primers and probes were obtained from the Jean-Marc Rolain laboratory [23], and the protocol followed for the RT-PCR was provided by the Jean-Marc Rolain laboratory and it was as follows: 10 µL of Master Mix Kit (Qiagen, Germantown, MD, USA), 1 µL of the Forward (F), 1 µL of the Reverse (R), and 1 µL of the Probe (P), 2 µL H2O (Qiagen, Germantown, MD, USA) added to 5 µL of our extracted DNA.

2.5. Multiplex Real-Time PCR

The following β-lactamases genes were targeted, blaTEM, blaSHV and blaCTX-M A B, and carbapenemase blaKPC, blaVIM, blaNDM and blaOXA-23 24 48 58, as well as colistin resistance genes mcr-1, mcr-2, mcr-3, mcr-5, and mcr-8. Our strains were firstly divided into 14 pools, and each one contained between 18 and 21 bacteria to determine the maximum number of positive individuals [23]; only positive pools were treated after separately in order to detect the presence of the resistance genes in each bacterium. The detection of the resistance genes was performed for all isolates using the Jean-Marc Rolain RT-PCR protocol.

2.6. Standard PCR

A standard PCR followed by migration on agarose gel was performed on mgrB in order to detect the presence of chromosomal resistance among our colistin-resistant strains, then BigDye PCR and sequencing were performed according to the instructions provided by the manufacturer (Macherey-Nagel, Düren, Germany); the standard PCR for the mgrB gene was purified using a Millipore NucleoFast 96 PCR kit followed by gel electrophoresis. Sanger sequencing was then carried out using the BigDye Terminator Cycle sequencer kit from Applied Biosystems on an ABI 3130 automatic sequencer. ChromasPro 1.7 software (Technelysium Pty Ltd., Tewantin, Australia) was then used to construct and evaluate the resultant sequences.

2.7. Primers and Probes for PCR and qPCR

The primers and probes used for real-time PCR (Table 1) and standard PCR (Table 2) in this study are listed in the following tables. These were designed to target specific resistance genes and were validated using positive controls as referenced.

2.8. Statistical Analysis

The comparison of resistance in carbapenemase-producing K. pneumoniae isolates with sensitive isolates was analyzed by performing the Pearson chi-square test with Yates’ correction using R statistical software version Rx64-4.0.2 for Windows. The significance level was set at a p-value < 0.05.

3. Results

3.1. Distribution of Strains by Sample Source, Hospital Department, and Patient Demographics

Moreover, 124 strains of K. pneumoniae were isolated in our study. Depending on the collection site, the clinical samples were divided into pus (43.5%, 54/124), blood (25.8%, 32/124), urine (17.7%, 22/124), respiratory samples and biological fluids (6.4%, 8/124 each). The surgical department and intensive care unit represented the highest isolate rates, with 21.7% of cases (27/124) each. Other services such as neonatology, pediatrics, internal medicine, infectious diseases and outpatients had lower rates, respectively (12%, 9.6%, 9.6%, 5.6% and 3.2%). Other services were identified in our study in very small proportions and grouped into miscellaneous (16%) (Figure 1). Most of our patients were men (64.5%, 80/124), with a sex ratio of 1.88. Depending on age, almost equal rates were found in the age groups, one going from 0 to 20 years (30.6%, 38/124) and the other whose age was between 21 and 40 years (29.8%, 37/124) (Figure 1); this rate was the highest among the rest of the age range, with a mean of 33 years and a median of 31 years (Figure 1).

3.2. Antimicrobial Susceptibility

The study of resistance to different antibiotics of the K. pneumoniae strains isolated in our study is shown in Figure 2. The resistance profile displayed the following resistance rates: amoxicillin (100%, 124/124), amoxicillin/clavulanic acid (80.6%, 100/124), mecillinam (13.7%, 17/124), piperacillin–tazobactam (51.6%, 64/124), ceftriaxone (62%, 77/124), cefepime (66.1%, 82/124), fosfomycin (59.6%, 74/124), nitrofurantoin (26.6%, 33/124), cotrimoxazole (54.8%, 68/124), ciprofloxacin (47.5%, 59/124), tetracycline (45.1%, 56/124), and aminoglycosides [amikacin (24.1%, 30/124) and gentamycin (49.1%, 61/124)]. Regarding resistance to carbapenems, 12 strains of K. pneumoniae were resistant to ertapenem (9.6%, 12/124), with MICs varying between 0.75 and 32 mg/L, and only one strain was resistant to imipenem (0.8%, 1/124) with an MIC equal to 32 mg/L (this strain was also resistant to ertapenem (MIC = 32 mg/L) (Table 3). We also note that most of the strains resistant to carbapenems were found in services at risk, such as ICU (41.6%), often isolated from blood (50%). All strains expressed resistance to other β-lactams (100%, 12/12), and most were resistant to other antibiotics such as gentamycin (83.3%, 10/12) and ciprofloxacin (75%, 9/12).
For colistin, seven strains of K. pneumoniae were resistant to this molecule (5.6%, 7/124), with MICs between 4 and 32 mg/L. These strains are isolated from pus (two cases), urine (one case), blood (one case), sputum (one case), pleural fluid (one case) and cerebrospinal fluid (one case). We also note that among the strains resistant to colistin, two strains (28.5%, 2/7) were resistant to carbapenems (KP46 and KP86) (Table 4). A comparison of resistance to colistin in carbapenemase-producing K. pneumoniae isolates with sensitive isolates did not show a significant difference (χ2 = 0.0312, p-value = 0.859842).

3.3. Molecular Characterization of β-Lactamases, Carbapenemases, mcr Genes and mgrB Modifications

The synergy test was positive for 59 strains, the rate of ESBL-producing isolates was 47.5% (59/124). The confirmation of phenotypic resistance to ESBL, aligning with molecular findings, indicated that PCR and subsequent sequencing analysis demonstrated the presence of the blaCTX-M gene alone in one case (1.6%) and the blaSHV gene alone in three cases (5%). The combination of the blaCTX-M gene with the blaTEM gene is found in eight strains (13.5%), and the combination of the two blaCTX-M and blaSHV genes is noted in nine strains (15.2%). The blaCTX-M, blaTEM and blaSHV association is noted in 38 strains (64.4%) (Figure 3). In sum, the three genes blaCTX, blaTEM and blaSHV were found in the following proportions: 94.90%, 77.90% and 84.70%, respectively. Furthermore, the Carba NP test was positive for 12 K. pneumoniae strains; however, the PCR and sequencing results confirmed the presence of the blaOXA-48 gene in only nine of these strains. The genes of the remaining positive strains were not demonstrated despite the positive phenotypic resistance, which may be explained by the presence of other genes not investigated in our study. The other carbapenemase types blaNDM, blaIMP and blaVIM were not found in our study. Among the strains resistant to carbapenems, six strains (50%, 6/12) are ESBL producers (KP13, KP34, KP46, KP86, KP87 and KP122). Concerning resistance to colistin, the confirmation of phenotypic resistance to colistin, assessed using MIC testing, aligns with the molecular findings, showing that PCR and subsequent sequencing analyses verified the presence of resistance genes. This approach enhances our understanding of how phenotypic resistance correlates with the presence of specific resistance genes. As a result, among the seven strains resistant to colistin, two strains (KP23 and KP33) harbored simultaneously the mcr-8 gene and a mutation of the mgr B gene, as well as the blaCTX M, blaTEM and blaSHV genes, one isolated in a 48-year-old woman from sputum, the other in a little girl aged 11 months from CSF. Two other strains (KP46 and KP86) harbored a mutation in the mgrB gene, the blaOXA-48 gene and the blaCTX M, blaTEM and blaSHV genes, one in a 25-day-old child isolated from pus, the other in a 2-year-old boy isolated from urine. Three strains presented a mutation in the mgrB gene, as well as the coexistence of the blaCTX M, blaTEM and blaSHV genes (Table 2). All colistin-resistant strains carried an ESBL gene in our study.

4. Discussion

Enterobacteriaceae are the most common causes of community or nosocomial infections. They are generally treated with Beta-lactams, including penicillins, broad-spectrum cephalosporins and carbapenems, or even fluoroquinolones. Over the past two decades, there has been a significant increase in the resistance of Enterobacteriaceae to these antibiotics. Among Enterobacteriaceae, K. pneumoniae is also the most common MDR pathogen in healthcare settings [30]. The behavior of the strains towards antibiotics in our study showed high resistance rates towards penicillins and cephalosporins. Significant resistance rates are also observed for cotrimoxazole, aminoglycosides, tetracycline, ciprofloxacin and fosfomycin. Lower resistance rates were obtained for mecillinam (13.7%) and nitrofurantoin (26.6%). ESBL production was detected at a high rate of 47.5%. These results are in part due to the excessive and inappropriate use of antibiotics in Algeria over the last few decades.
Since the early 2000s, the overall incidence of Enterobacteriaceae-producing extended-spectrum β-lactamases has increased in many countries to the point where it could now constitute an ESBL pandemic [31]. ESBLs are most commonly detected in K. pneumoniae, which is an opportunistic pathogen associated with severe infections in hospitalized patients, including immunocompromised hosts with severe underlying diseases [32]. ESBL-producing K. pneumoniae was first reported in 1983 in Germany, with a steady worldwide increase in K. pneumoniae-mediated resistance against cephalosporins in the subsequent decades [33]. The prevalence of ESBL-producing K. pneumoniae varied widely and increased over time globally [34]. In Africa, for example, recent studies have reported different rates varying between 29% in South Africa and 84% in cote d’Ivoire [35,36]. In neighboring countries like Morocco, the rate of ESBL-producing K. pneumoniae was 35.13% [37]. In Algeria, according to a study carried out in Tizi-Ouzou, the rate of ESBL-producing K. pneumoniae even reached 98.8% [38]. This situation constitutes a public health problem because these bacteria, not only resistant to most β-lactams, often present resistance associated with other classes of antibiotics used in human therapy, in particular fluoroquinolones, aminoglycosides and sulfamethoxazole–trimethoprim combinations [1]. The isolates of K. pneumoniae obtained during this study showed a high percentage of resistance to fosfomycin and tetracycline. The results of percentage resistance in our study were significantly higher than those reported by several authors around the world concerning fosfomycin [39,40]. Almost the same rate of resistance to tetracycline was observed [41]. The acquisition of resistance to fosfomycin and tetracycline by clinical isolates of K. pneumoniae-sharing ESBL and/or carbapenemases represents a serious problem for the treatment of infections because these antibiotics have been utilized as a last resort for treatment.
The results of the PCR amplification of the genes blaCTX-M, blaTEM and blaSHV showed that almost all the strains harbored a blaCTX-M gene (94.9%). This may explain the high level of resistance to third- and fourth-generation cephalosporins. The simultaneous presence of the three genes was found in 68.4% in our study. In the last decade, the most common ESBL gene types have been blaSHV, blaTEM and blaCTX-M. blaTEM and blaSHV were the most common b-lactamase gene types, but recently, the blaCTX-M type spread all over the world [30,42]. This type is currently most widespread in Algeria and Morocco [37,43]. The genetic variability in clinical strains, resulting from different combinations of enzyme expression, can influence the severity of infection, the response to antibiotic treatments and the transmission capacity of these resistance genes within the bacterial population. This highlights the importance of a strategic and targeted approach to control the dissemination of these enzymes and improve the available therapeutic options. Over the past decade, strains of carbapenemase-producing Enterobacteriaceae have emerged and become endemic in certain regions of the globe [2,44]. Carbapenems are among the rare molecules still active in cases of ESBL infections. A carbapenem resistance rate of 9.6% was observed in our study.
The prevalence of carbapenem-resistant Enterobacteriaceae, particularly K. pneumoniae, is increasing worldwide [45,46]. Higher rates between 15% and 26% have been observed in the United States and India [47,48]. The resistance rate of K. pneumoniae to carbapenems reached 66.3% in 2020 in Greece [49]. In contrast, Japan recorded the lowest prevalence, with only 0.13% [50]. In Africa, the prevalence of carbapenemase-producing isolates in hospital settings ranged from 2.3% to 67.7% in North Africa and from 9% to 60% in sub-Saharan Africa [4]. In Algeria, a recent study carried out in Setif presented a rate of resistance to carbapenems in K. pneumoniae of 7.6% [5]. The continued emergence of carbapenem-resistant Enterobacteriaceae constitutes a major public health threat [51]. Moreover, 75% of the strains isolated in our study harbored the OXA-48 gene. The resistance to carbapenems of three strains might not be related to an enzymatic mechanism such as carbapenemases, as suggested by the negative results of the amplification of the blaVIM, blaIMP, blaKPC, blaNDM and blaOXA48 genes. It has been reported that the production of certain β-lactamases such as cephalosporinases or ESBL associated with a mechanism of impermeability by the loss of porins can lead to the carbapenem resistance of some strains of K. pneumoniae [52]. The production of carbapenemase constitutes the most powerful mechanism of resistance of enterobacteria to carbapenems [53]. Health authorities around the world are proposing to particularly identify carriers of enterobacteria expressing carbapenemases, which are, in a way, markers of multi-resistance to antibiotics [54,55]. Most carbapenemases confer resistance to a large number of β-lactams and their genes are usually associated with resistance genes to aminoglycosides and fluoroquinolones [56]. In our study, all carbapenemase-producing strains were resistant to amoxicillin, amoxicillin–clavulanic acid, piperacillin–tazobactam, ceftriaxone and cefepime, 88.9% were resistant to ciprofloxacin and gentamycin and 44.4% expressed ESBL. Strains resistant to carbapenems have significant epidemic power: the genes coding for carbapenemases are often located on plasmids that can be transferred from one strain to another. Currently, blaKPC, blaNDM and blaOXA-48 are the most common carbapenemases worldwide [57]. KPCs are most commonly identified in K. pneumoniae in the United States, China, Colombia, Israel, Greece, and Italy, while NDMs are primarily found in K. pneumoniae, E. coli, and Enterobacter spp. from the Indian subcontinent and the blaOXA-48 type carbapenemases in K. pneumoniae and E. coli from North Africa and Turkey [44]. According to several studies, the blaOXA-48 gene, described as a class D carbapenemase, is considered an endemic gene in Algeria, first in Constantine, then in Batna, and later, in Annaba city [58,59,60]. In this study, seven strains of K. pneumoniae were resistant to colistin (5.6%). The global increase in MDR K. pneumoniae strains has increased the use of colistin to treat these infections, resulting in the emergence of colistin resistance worldwide [61]. Varying rates of resistance to colistin have been observed worldwide: 0% in Egypt [62], 0.3% in Bangladesh [63], 16% in Spain [64], 28.5% in Australia [65], and 34.5% in Saudi Arabia [6]. Another study conducted in Iran reported 98.8% colistin resistance in K. pneumoniae isolates [66]. Although colistin currently maintains a high activity level against most K. pneumoniae isolates, the decrease in activity against carbapenem-resistant isolates is worrisome. A correlation between the use of colistin to treat infections caused by carbapenem resistant and the subsequent emergence of colistin-resistant strains has also been reported. Mansour et al. in Tunisia and Narimisa et al. in Iran found a significant association between carbapenemase-producing K. pneumoniae isolates with colistin-resistant isolates [21,67]. Our study did not show an association between carbapenem-producing K. pneumoniae and increased resistance to colistin. Despite this, it will be necessary to monitor the use of colistin continually.
All of our colistin-resistant strains harbored the mutated mgrB gene, of which two strains simultaneously expressed the mcr-8 gene. Moreover, since the mcr-1 description, eight other mobile colistin resistance genes, including mcr-2, mcr-3, mcr-4, mcr-5, mcr-6, mcr-7, and latterly, mcr-8 and mcr-9, have been reported from different countries around the world in both humans and animals [68,69,70]. In Algeria, mcr-1, pmrAB and mgrB mutations are the main reported colistin resistance mechanisms [71,72]. The first description of a clinical K. pneumoniae isolate harboring the mcr-8 gene was observed in Algeria in 2020 [11]. During our study, two strains resistant to colistin harbored the mcr-8 gene (KP23 and KP33), thus representing the second report in Algeria and the first in Constantine after its first description in Setif (Figure 4). In both strains, the mcr-8 gene was associated with a mutation in the mgrB gene and with blaCTX-M, blaTEM and blaSHV (both strains harbored ESBL). This dual resistance to plasmid and chromosomal colistin, expressing high levels of resistance (MIC = 32 µg/mL) was observed for the first time, highlighting the complexity of managing resistance to this antibiotic and the need for adapted approaches to prevent and control this threat to public health. Furthermore, two strains (KP46 and KP86) were found to be positive for the blaOXA-48, blaCTX-M, and blaTEM genes. Additionally, these strains presented an inactivating insertion in the mgrB gene. This represents the first report in Algeria of an association of the blaOXA-48 gene and inactivation of the mgrB gene. In Algeria, two reports recently revealed the presence of bacterial strains resistant to carbapenems and colistin. These strains carried blaOXA-48, blaCTX-M and blaTEM genes as well as a mutation in the pmrA/B gene [69,71]. The high prevalence of carbapenem and colistin-resistant strains underscores the need for revised treatment protocols and enhanced surveillance to curb the spread of these resistant pathogens.

5. Conclusions

Our results indicated that colistin resistance in K. pneumoniae isolates could be associated with a mutation in the mgrB gene alone or associated with the mcr8 gene, which could increase the levels of resistance to this antibiotic. These data also provided an additional insight into the mechanism of colistin resistance. The results of our study showed a 5.6% prevalence of colistin. The prevalence of resistance to carbapenems and colistin in Algeria should be studied, and new therapeutic strategies should be evaluated. Future research should focus on multicenter studies to validate these findings and explore the development of novel therapeutic strategies. The implementation of robust infection control measures is recommended to address the growing resistance.

Author Contributions

R.R. designed the study, collected and analyzed the data, and wrote the manuscript. A.H.-H. supervised the study, contributed to the study design, reviewed the manuscript and conducted the validation of the final revision of the manuscript. C.B. supplied collection data and assisted with materials. K.B. provided access to strains, supplied collection data, and assisted with materials. S.M.D. provided guidance on the data analysis and contributed to the final revision of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Fondation Méditerranée Infection (Reference: 10-IAHU-03). The APC was funded by Rihane Riyane.

Data Availability Statement

The original data generated in this study are included in this article. Further enquiries can be directed to the corresponding author.

Acknowledgments

The authors express their sincere gratitude to the dedicated members of the JM Rolain team for their invaluable help and support throughout this research project. The authors are extremely grateful to the staff of the Department of the Benbadis University Hospital of Constantine for their material assistance and for providing us with the bacterial strains.

Conflicts of Interest

The authors declare no conflicts of interest.

Ethics Committee Approval

In the context of this study, it is imperative to emphasize that approval from the ethics committee of the Centre Hospitalo Universitaire Benbadis-Constantine was obtained in accordance with the standards set forth by the Helsinki Declaration. The validation of this study was granted by the ethics committee chaired by Noureddine Abadi. This approval signifies that all research procedures adhere to fundamental ethical principles, thereby ensuring the protection of participants and the integrity of the research.

References

  1. Coque, T.M.; Baquero, F.; Canton, R. Increasing Prevalence of ESBL-Producing Enterobacteriaceae in Europe. Eurosurveillance 2008, 13, 1–11. [Google Scholar] [CrossRef]
  2. Nordmann, P.; Naas, T.; Poirel, L. Global Spread of Carbapenemase Producing Enterobacteriaceae. Emerg. Infect. Dis. 2011, 17, 1791–1798. [Google Scholar] [CrossRef]
  3. Xu, T.; Feng, W.; Sun, F.; Qian, Y. Clinical and Resistance Characterization of Carbapenem-Resistant Klebsiella pneumoniae Isolated from Intensive Care Units in China. Ann. Transl. Med. 2022, 10, 1109. [Google Scholar] [CrossRef] [PubMed]
  4. Manenzhe, R.I.; Zar, H.J.; Nicol, M.P.; Kaba, M. The Spread of Carbapenemase-Producing Bacteria in Africa: A Systematic Review. J. Antimicrob. Chemother. 2015, 70, 23–40. [Google Scholar] [CrossRef] [PubMed]
  5. Nabti, L.Z.; Sahli, F.; Olowo-Okere, A.; Benslama, A.; Harrar, A.; Lupande-Mwenebitu, D.; Diene, S.M.; Rolain, J.-M. Molecular Characterization of Clinical Carbapenem-Resistant Enterobacteriaceae Isolates from Sétif, Algeria. Microb. Drug Resist. 2022, 28, 274–279. [Google Scholar] [CrossRef]
  6. Al Bshabshe, A.; Al-Hakami, A.; Alshehri, B.; Al-Shahrani, K.A.; Alshehri, A.A.; Al Shahrani, M.B.; Assiry, I.; Joseph, M.R.; Alkahtani, A.M.; Hamid, M.E. Rising Klebsiella pneumoniae Infections and Its Expanding Drug Resistance in the Intensive Care Unit of a Tertiary Healthcare Hospital, Saudi Arabia. Cureus 2020, 12, e10060. [Google Scholar] [CrossRef]
  7. Reyes, J.; Aguilar, A.C.; Caicedo, A. Carbapenem-Resistant Klebsiella pneumoniae: Microbiology Key Points for Clinical Practice. Int. J. Gen. Med. 2019, 12, 437–446. [Google Scholar] [CrossRef]
  8. Tseng, C.-H.; Huang, Y.-T.; Mao, Y.-C.; Lai, C.-H.; Yeh, T.-K.; Ho, C.-M.; Liu, P.-Y. Insight into the Mechanisms of Carbapenem Resistance in Klebsiella pneumoniae: A Study on IS26 Integrons, Beta-Lactamases, Porin Modifications, and Plasmidome Analysis. Antibiotics 2023, 12, 749. [Google Scholar] [CrossRef]
  9. Armin, S.; Fallah, F.; Karimi, A.; Azimi, T.; Kafil, H.S.; Zahedani, S.S.; Ghanaiee, R.M.; Azimi, L. Multicentre Study of the Main Carbapenem Resistance Mechanisms in Important Members of the Enterobacteriaceae Family in Iran. New Microbes New Infect. 2021, 41, 100860. [Google Scholar] [CrossRef]
  10. Janssen, A.B.; Doorduijn, D.J.; Mills, G.; Rogers, M.R.C.; Bonten, M.J.M.; Rooijakkers, S.H.M.; Willems, R.J.L.; Bengoechea, J.A.; van Schaik, W. Evolution of Colistin Resistance in the Klebsiella pneumoniae Complex Follows Multiple Evolutionary Trajectories with Variable Effects on Fitness and Virulence Characteristics. Antimicrob. Agents Chemother. 2020, 65, 10–1128. [Google Scholar] [CrossRef]
  11. Higashino, H.R.; Marchi, A.P.; Martins, R.C.R.; Batista, M.V.; Perdigão Neto, L.V.; Lima, V.A.C.d.C.; Rossi, F.; Guimarães, T.; Levin, A.S.; Rocha, V.; et al. Colistin-Resistant Klebsiella pneumoniae Co-Harboring KPC and MCR-1 in a Hematopoietic Stem Cell Transplantation Unit. Bone Marrow Transpl. 2019, 54, 1118–1120. [Google Scholar] [CrossRef]
  12. Nation, R.L.; Li, J. Colistin in the 21st Century. Curr. Opin. Infect. Dis. 2009, 22, 535–543. [Google Scholar] [CrossRef] [PubMed]
  13. Giani, T.; Arena, F.; Vaggelli, G.; Conte, V.; Chiarelli, A.; De Angelis, L.H.; Fornaini, R.; Grazzini, M.; Niccolini, F.; Pecile, P.; et al. Large Nosocomial Outbreak of Colistin-Resistant, Carbapenemase-Producing Klebsiella pneumoniae Traced to Clonal Expansion of an Mgrb Deletion Mutant. J. Clin. Microbiol. 2015, 53, 3341–3344. [Google Scholar] [CrossRef] [PubMed]
  14. Cannatelli, A.; D’Andrea, M.M.; Giani, T.; Di Pilato, V.; Arena, F.; Ambretti, S.; Gaibani, P.; Rossolini, G.M. In Vivo Emergence of Colistin Resistance in Klebsiella pneumoniae Producing KPC-Type Carbapenemases Mediated by Insertional Inactivation of the PhoQ/PhoP MgrB Regulator. Antimicrob. Agents Chemother. 2013, 57, 5521–5526. [Google Scholar] [CrossRef] [PubMed]
  15. Cannatelli, A.; Giani, T.; D’Andrea, M.M.; Di Pilato, V.; Arena, F.; Conte, V.; Tryfinopoulou, K.; Vatopoulos, A.; Rossolini, G.M. MgrB Inactivation Is a Common Mechanism of Colistin Resistance in KPC-Producing Klebsiella pneumoniae of Clinical Origin. Antimicrob. Agents Chemother. 2014, 58, 5696–5703. [Google Scholar] [CrossRef]
  16. Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of Plasmid-Mediated Colistin Resistance Mechanism MCR-1 in Animals and Human Beings in China: A Microbiological and Molecular Biological Study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
  17. Moffatt, J.H.; Harper, M.; Boyce, J.D. Mechanisms of Polymyxin Resistance. In Polymyxin Antibiotics: From Laboratory Bench to Bedside; Springer: Cham, Switzerland, 2019; pp. 55–71. [Google Scholar]
  18. Wang, C.; Feng, Y.; Liu, L.; Wei, L.; Kang, M.; Zong, Z. Identification of Novel Mobile Colistin Resistance Gene Mcr-10. Emerg. Microbes Infect. 2020, 9, 508–516. [Google Scholar] [CrossRef]
  19. Liu, Y.; Lin, Y.; Wang, Z.; Hu, N.; Liu, Q.; Zhou, W.; Li, X.; Hu, L.; Guo, J.; Huang, X.; et al. Molecular Mechanisms of Colistin Resistance in Klebsiella pneumoniae in a Tertiary Care Teaching Hospital. Front. Cell Infect. Microbiol. 2021, 11, 673503. [Google Scholar] [CrossRef]
  20. Sun, J.; Zhang, H.; Liu, Y.-H.; Feng, Y. Towards Understanding MCR-like Colistin Resistance. Trends Microbiol. 2018, 26, 794–808. [Google Scholar] [CrossRef]
  21. Narimisa, N.; Goodarzi, F.; Bavari, S. Prevalence of Colistin Resistance of Klebsiella pneumoniae Isolates in Iran: A Systematic Review and Meta-Analysis. Ann. Clin. Microbiol. Antimicrob. 2022, 21, 29. [Google Scholar] [CrossRef]
  22. Llobet, E.; Tomás, J.M.; Bengoechea, J.A. Capsule Polysaccharide Is a Bacterial Decoy for Antimicrobial Peptides. Microbiology 2008, 154, 3877–3886. [Google Scholar] [CrossRef] [PubMed]
  23. Berrazeg, M.; Hadjadj, L.; Ayad, A.; Drissi, M.; Rolain, J.M. First Detected Human Case in Algeria of Mcr-1 Plasmid-Mediated Colistin Resistance in a 2011 Escherichia Coli Isolate. Antimicrob. Agents Chemother. 2016, 60, 6996–6997. [Google Scholar] [CrossRef] [PubMed]
  24. Diene, S.M.; Bruder, N.; Raoult, D.; Rolain, J.-M. Real-Time PCR Assay Allows Detection of the New Delhi Metallo-β-Lactamase (NDM-1)-Encoding Gene in France. Int. J. Antimicrob. Agents 2011, 37, 544–546. [Google Scholar] [CrossRef] [PubMed]
  25. Rolain, J.M.; Canton, R.; Cornaglia, G. Emergence of Antibiotic Resistance: Need for a New Paradigm. Clin. Microbiol. Infect. 2012, 18, 615–616. [Google Scholar] [CrossRef] [PubMed]
  26. Roschanski, N.; Fischer, J.; Guerra, B.; Roesler, U. Development of a Multiplex Real-Time PCR for the Rapid Detection of the Predominant Beta-Lactamase Genes CTX-M, SHV, TEM and CIT-Type AmpCs in Enterobacteriaceae. PLoS ONE 2014, 9, e100956. [Google Scholar] [CrossRef]
  27. Kruger, T.; Szabo, D.; Keddy, K.H.; Deeley, K.; Marsh, J.W.; Hujer, A.M.; Bonomo, R.A.; Paterson, D.L. Infections with Nontyphoidal Salmonella Species Producing TEM-63 or a Novel TEM Enzyme, TEM-131, in South Africa. Antimicrob. Agents Chemother. 2004, 48, 4263–4270. [Google Scholar] [CrossRef]
  28. Oka, K.; Tetsuka, N.; Morioka, H.; Iguchi, M.; Kawamura, K.; Hayashi, K.; Yanagiya, T.; Morokuma, Y.; Watari, T.; Kiyosuke, M.; et al. Genetic and Epidemiological Analysis of ESBL-Producing Klebsiella pneumoniae in Three Japanese University Hospitals. J. Infect. Chemother. 2022, 28, 1286–1294. [Google Scholar] [CrossRef]
  29. Poirel, L.; Naas, T.; Nordmann, P. Diversity, Epidemiology, and Genetics of Class D β-Lactamases. Antimicrob. Agents Chemother. 2010, 54, 24–38. [Google Scholar] [CrossRef]
  30. Jena, J.; Sahoo, R.K.; Debata, N.K.; Subudhi, E. Prevalence of TEM, SHV, and CTX-M Genes of Extended-Spectrum β-Lactamase-Producing Escherichia Coli Strains Isolated from Urinary Tract Infections in Adults. 3 Biotech 2017, 7, 244. [Google Scholar] [CrossRef]
  31. Cantón, R.; Coque, T.M. The CTX-M β-Lactamase Pandemic. Curr. Opin. Microbiol. 2006, 9, 466–475. [Google Scholar] [CrossRef]
  32. Podschun, R.; Ullmann, U. Klebsiella Spp. as Nosocomial Pathogens: Epidemiology, Taxonomy, Typing Methods, and Pathogenicity Factors. Clin. Microbiol. Rev. 1998, 11, 589–603. [Google Scholar] [CrossRef] [PubMed]
  33. Keynan, Y.; Rubinstein, E. The Changing Face of Klebsiella pneumoniae Infections in the Community. Int. J. Antimicrob. Agents 2007, 30, 385–389. [Google Scholar] [CrossRef] [PubMed]
  34. McNulty, C.A.M.; Lecky, D.M.; Xu-McCrae, L.; Nakiboneka-Ssenabulya, D.; Chung, K.T.; Nichols, T.; Thomas, H.L.; Thomas, M.; Alvarez-Buylla, A.; Turner, K.; et al. CTX-M ESBL-Producing Enterobacteriaceae: Estimated Prevalence in Adults in England in 2014. J. Antimicrob. Chemother. 2018, 73, 1368–1388. [Google Scholar] [CrossRef] [PubMed]
  35. Müller-Schulte, E.; Tuo, M.N.; Akoua-Koffi, C.; Schaumburg, F.; Becker, S.L. High Prevalence of ESBL-Producing Klebsiella pneumoniae in Clinical Samples from Central Côte d’Ivoire. Int. J. Infect. Dis. 2020, 91, 207–209. [Google Scholar] [CrossRef]
  36. Founou, R.C.; Founou, L.L.; Allam, M.; Ismail, A.; Essack, S.Y. Whole Genome Sequencing of Extended Spectrum β-Lactamase (ESBL)-Producing Klebsiella pneumoniae Isolated from Hospitalized Patients in KwaZulu-Natal, South Africa. Sci. Rep. 2019, 9, 6266. [Google Scholar] [CrossRef]
  37. Natoubi, S.; Barguigua, A.; Zriouil, S.B.; Baghdad, N.; Timinouni, M.; Hilali, A.; Amghar, S.; Zerouali, K. Incidence of Extended-Spectrum Be-Ta-Lactamase-Producing Klebsiella pneumoniae among Patients and in the Environment of Hassan II Hospital, Settat, Morocco. Adv. Microbiol. 2016, 6, 152–161. [Google Scholar] [CrossRef]
  38. Bariz, K.; De Mendonça, R.; Denis, O.; Nonhoff, C.; Azzam, A.; Houali, K. Multidrug Resistance of the Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolated in Tizi-Ouzou (Algeria). Cell. Mol. Biol. 2019, 65, 11–17. [Google Scholar] [CrossRef]
  39. Aysert-Yildiz, P.; Özgen-Top, Ö.; Habibi, H.; Dizbay, M. Efficacy and Safety of Intravenous Fosfomycin for the Treatment of Carbapenem-Resistant Klebsiella pneumoniae. J. Chemother. 2023, 35, 471–476. [Google Scholar] [CrossRef]
  40. Ghayaz, F.; Kelishomi, F.Z.; Amereh, S.; Aali, E.; Javadi, A.; Peymani, A.; Nikkhahi, F. In Vitro Activity of Fosfomycin on Multidrug-Resistant Strains of Klebsiella pneumoniae and Klebsiella Oxytoca Causing Urinary Tract Infection. Curr. Microbiol. 2023, 80, 115. [Google Scholar] [CrossRef]
  41. Ahmadi, Z.; Noormohammadi, Z.; Ranjbar, R.; Behzadi, P. Prevalence of Tetracycline Resistance Genes Tet (A, B, C, 39) in Klebsiella pneumoniae Isolated from Tehran, Iran. Iran. J. Med. Microbiol. 2022, 16, 141–147. [Google Scholar] [CrossRef]
  42. Caubey, M.; Suchitra, M.S. Occurrence of TEM, SHV and CTX-M β Lactamases in Clinical Isolates of Proteus Species in a Tertiary Care Center. Infect. Disord. Drug Targets 2017, 18, 68–71. [Google Scholar] [CrossRef] [PubMed]
  43. Mairi, A.; Meyer, S.; Tilloy, V.; Barraud, O.; Touati, A. Whole Genome Sequencing of Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolated from Neonatal Bloodstream Infections at a Neonatal Care Unit, Algeria. Microb. Drug Resist. 2022, 28, 867–876. [Google Scholar] [CrossRef] [PubMed]
  44. Nordmann, P.; Poirel, L. The Difficult-to-Control Spread of Carbapenemase Producers among Enterobacteriaceae Worldwide. Clin. Microbiol. Infect. 2014, 20, 821–830. [Google Scholar] [CrossRef] [PubMed]
  45. Giakkoupi, P.; Papagiannitsis, C.C.; Miriagou, V.; Pappa, O.; Polemis, M.; Tryfinopoulou, K.; Tzouvelekis, L.S.; Vatopoulos, A.C. An Update of the Evolving Epidemic of BlaKPC-2-Carrying Klebsiella pneumoniae in Greece (2009–2010). J. Antimicrob. Chemother. 2011, 66, 1510–1513. [Google Scholar] [CrossRef]
  46. Patel, G.; Huprikar, S.; Factor, S.H.; Jenkins, S.G.; Calfee, D.P. Outcomes of Carbapenem-Resistant Klebsiella pneumoniae Infection and the Impact of Antimicrobial and Adjunctive Therapies. Infect. Control Hosp. Epidemiol. 2008, 29, 1099–1106. [Google Scholar] [CrossRef]
  47. Olowo-Okere, A.; Ibrahim, Y.K.E.; Olayinka, B.O. Molecular Characterisation of Extended-Spectrum β-Lactamase-Producing Gram-Negative Bacterial Isolates from Surgical Wounds of Patients at a Hospital in North Central Nigeria. J. Glob. Antimicrob. Resist. 2018, 14, 85–89. [Google Scholar] [CrossRef]
  48. Saseedharan, S. Act Fast as Time Is Less: High Faecal Carriage of CarbapenemResistant Enterobacteriaceae in Critical Care Patients. J. Clin. Diagn. Res. 2016, 10, DC01. [Google Scholar] [CrossRef]
  49. European Centre for Disease Prevention and Control. Surveillance Surveillance Atlas of Infectious Diseases; European Centre for Disease Prevention and Control: Solna, Sweden, 2019. [Google Scholar]
  50. Maseda, E.; Salgado, P.; Anillo, V.; Ruiz-Carrascoso, G.; Gómez-Gil, R.; Martín-Funke, C.; Gimenez, M.-J.; Granizo, J.-J.; Aguilar, L.; Gilsanz, F. Risk Factors for Colonization by Carbapenemase-Producing Enterobacteria at Admission to a Surgical ICU: A Retrospective Study. Enferm. Infecc. Microbiol. Clin. 2017, 35, 333–337. [Google Scholar] [CrossRef]
  51. David, S.; Reuter, S.; Harris, S.R.; Glasner, C.; Feltwell, T.; Argimon, S.; Abudahab, K.; Goater, R.; Giani, T.; Errico, G.; et al. Epidemic of Carbapenem-Resistant Klebsiella pneumoniae in Europe Is Driven by Nosocomial Spread. Nat. Microbiol. 2019, 4, 1919–1929. [Google Scholar] [CrossRef]
  52. Martínez-Martínez, L.; Conejo, M.C.; Pascual, A.; Hernández-Allés, S.; Ballesta, S.; Ramírez De Arellano-Ramos, E.; Benedí, V.J.; Perea, E.J. Activities of Imipenem and Cephalosporins against Clonally Related Strains of Escherichia Coli Hyperproducing Chromosomal Beta-Lactamase and Showing Altered Porin Profiles. Antimicrob. Agents Chemother. 2000, 44, 2534–2536. [Google Scholar] [CrossRef]
  53. Nordmann, P.; Carrer, A. Les Carbapénèmases des Entérobactéries. Arch. Pediatr. 2010, 17, S154–S162. [Google Scholar] [CrossRef] [PubMed]
  54. Codjoe, F.S.; Donkor, E.S. Carbapenem Resistance: A Review. Med. Sci. 2017, 6, 1. [Google Scholar] [CrossRef] [PubMed]
  55. Hindler, J.A.; Humphries, R.M. Colistin MIC Variability by Method for Contemporary Clinical Isolates of Multidrug-Resistant Gram-Negative Bacilli. J. Clin. Microbiol. 2013, 51, 1678–1684. [Google Scholar] [CrossRef] [PubMed]
  56. Nordmann, P. Résistance Aux Carbapénèmes Chez Les Bacilles à Gram Négatif. Med. Sci. 2010, 26, 950–959. [Google Scholar] [CrossRef] [PubMed]
  57. Sugawara, E.; Kojima, S.; Nikaido, H. Klebsiella pneumoniae Major Porins OmpK35 and OmpK36 Allow More Efficient Diffusion of β-Lactams than Their Escherichia Coli Homologs OmpF and OmpC. J. Bacteriol. 2016, 198, 3200–3208. [Google Scholar] [CrossRef]
  58. Aggoune, N.; Tali-Maamar, H.; Assaous, F.; Guettou, B.; Laliam, R.; Benamrouche, N.; Zerouki, A.; Naim, M.; Rahal, K. Wide Spread of Oxa-48-Producing Enterobacteriaceae in Algerian Hospitals: A Four Years’ Study. J. Infect. Dev. Ctries. 2018, 12, 1039–1044. [Google Scholar] [CrossRef]
  59. Memariani, M.; Najar-Peerayeh, S.; Salehi, T.Z.; Mostafavi, S.K.S. Occurrence of SHV, TEM and CTX-M β-Lactamase Genes among Enteropathogenic Escherichia Coli Strains Isolated from Children with Diarrhea. Jundishapur J. Microbiol. 2015, 8, e15620. [Google Scholar] [CrossRef]
  60. Blot, K.; Hammami, N.; Blot, S.; Vogelaers, D.; Lambert, M.L. Gram-Negative Central Line-Associated Bloodstream Infection Incidence Peak during the Summer: A National Seasonality Cohort Study. Sci. Rep. 2022, 12, 5202. [Google Scholar] [CrossRef]
  61. Wang, Y.; Liu, F.; Hu, Y.; Zhang, G.; Zhu, B.; Gao, G.F. Detection of Mobile Colistin Resistance Gene Mcr-9 in Carbapenem-Resistant Klebsiella pneumoniae Strains of Human Origin in Europe. J. Infect. 2020, 80, 578–606. [Google Scholar] [CrossRef]
  62. Abdelhamid, S.M.; Abd-Elaal, H.M.; Matareed, M.O.; Baraka, K. Genotyping and Virulence Analysis of Drug Resistant Clinical Klebsiella pneumoniae Isolates in Egypt. J. Pure Appl. Microbiol. 2020, 14, 1967–1975. [Google Scholar] [CrossRef]
  63. Kulkarni, A.A.; Ebadi, M.; Zhang, S.; Meybodi, M.A.; Ali, A.M.; Defor, T.; Shanley, R.; Weisdorf, D.; Ryan, C.; Vasu, S.; et al. Comparative Analysis of Antibiotic Exposure Association with Clinical Outcomes of Chemotherapy versus Immunotherapy across Three Tumour Types. ESMO Open 2020, 5, e000803. [Google Scholar] [CrossRef] [PubMed]
  64. Fuster, B.; Salvador, C.; Tormo, N.; García-González, N.; Gimeno, C.; González-Candelas, F. Molecular Epidemiology and Drug-Resistance Mechanisms in Carbapenem-Resistant Klebsiella pneumoniae Isolated in Patients from a Tertiary Hospital in Valencia, Spain. J. Glob. Antimicrob. Resist. 2020, 22, 718–725. [Google Scholar] [CrossRef] [PubMed]
  65. Poudyal, A.; Howden, B.P.; Bell, J.M.; Gao, W.; Owen, R.J.; Turnidge, J.D.; Nation, R.L.; Li, J. In Vitro Pharmacodynamics of Colistin against Multidrug-Resistant Klebsiella pneumoniae. J. Antimicrob. Chemother. 2008, 62, 1311–1318. [Google Scholar] [CrossRef] [PubMed]
  66. Zahedi Bialvaei, A.; Eslami, P.; Ganji, L.; Dolatyar Dehkharghani, A.; Asgari, F.; Koupahi, H.; Barzegarian Pashacolaei, H.R.; Rahbar, M. Prevalence and Epidemiological Investigation of MgrB-Dependent Colistin Resistance in Extensively Drug Resistant Klebsiella pneumoniae in Iran. Sci. Rep. 2023, 13, 10680. [Google Scholar] [CrossRef] [PubMed]
  67. Mansour, W.; Haenni, M.; Saras, E.; Grami, R.; Mani, Y.; Ben Haj Khalifa, A.; el Atrouss, S.; Kheder, M.; Fekih Hassen, M.; Boujâafar, N.; et al. Outbreak of Colistin-Resistant Carbapenemase-Producing Klebsiella pneumoniae in Tunisia. J. Glob. Antimicrob. Resist. 2017, 10, 88–94. [Google Scholar] [CrossRef]
  68. Wang, X.; Wang, Y.; Zhou, Y.; Li, J.; Yin, W.; Wang, S.; Zhang, S.; Shen, J.; Shen, Z.; Wang, Y. Emergence of a Novel Mobile Colistin Resistance Gene, Mcr-8, in NDM-Producing Klebsiella pneumoniae Article. Emerg. Microbes Infect. 2018, 7, 1–9. [Google Scholar] [CrossRef]
  69. Carroll, L.M.; Gaballa, A.; Guldimann, C.; Sullivan, G.; Henderson, L.O.; Wiedmann, M. Identification of Novel Mobilized Colistin Resistance Gene Mcr-9 in a Multidrug-Resistant, Colistin-Susceptible Salmonella Enterica Serotype Typhimurium Isolate. MBio 2019, 10, 10–1128. [Google Scholar] [CrossRef]
  70. Olowo-Okere, A.; Yacouba, A. Molecular Mechanisms of Colistin Resistance in Africa: A Systematic Review of Literature. Germs 2020, 10, 367. [Google Scholar] [CrossRef]
  71. Belbel, Z.; Lalaoui, R.; Bakour, S.; Nedjai, S.; Djahmi, N.; Rolain, J.M. First Report of Colistin Resistance in an OXA-48- and a CTX-M-15 Producing Klebsiella pneumoniae Clinical Isolate in Algeria Due to PmrB Protein Modification and MgrB Inactivation. J. Glob. Antimicrob. Resist. 2018, 14, 158–160. [Google Scholar] [CrossRef]
  72. Nabti, L.Z.; Sahli, F.; Ngaiganam, E.P.; Radji, N.; Mezaghcha, W.; Lupande-Mwenebitu, D.; Baron, S.A.; Rolain, J.M.; Diene, S.M. Development of Real-Time PCR Assay Allowed Describing the First Clinical Klebsiella pneumoniae Isolate Harboring Plasmid-Mediated Colistin Resistance Mcr-8 Gene in Algeria. J. Glob. Antimicrob. Resist. 2020, 20, 266–271. [Google Scholar] [CrossRef]
Microorganisms 12 01942 g001
Figure 1. Distribution of K. pneumoniae clinical isolates according to: age, sex, department, clinical sample.
Figure 1. Distribution of K. pneumoniae clinical isolates according to: age, sex, department, clinical sample.
Microorganisms 12 01942 g001
Microorganisms 12 01942 g002
Figure 2. Dendrogram analysis of antibiotic profiles in K. pneumoniae strains: antibiotic susceptibility assessment; amoxicillin (AMX), amoxicillin + clavulanic acid (AMC), cefepime (FEP), piperacillin + tazobactam (TZP), mecillinam (MEC), ceftriaxone (CRO), ertapenem (ETP), imipenem (IPM), fosfomycin (FF), nitrofurantoin (F), trimethoprim + sulfamethoxazole (SXT), amikacin (AK), ciprofloxacin (CIP), tetracycline (TET), colistin (CS), gentamicin (GN).
Figure 2. Dendrogram analysis of antibiotic profiles in K. pneumoniae strains: antibiotic susceptibility assessment; amoxicillin (AMX), amoxicillin + clavulanic acid (AMC), cefepime (FEP), piperacillin + tazobactam (TZP), mecillinam (MEC), ceftriaxone (CRO), ertapenem (ETP), imipenem (IPM), fosfomycin (FF), nitrofurantoin (F), trimethoprim + sulfamethoxazole (SXT), amikacin (AK), ciprofloxacin (CIP), tetracycline (TET), colistin (CS), gentamicin (GN).
Microorganisms 12 01942 g002
Microorganisms 12 01942 g003
Figure 3. Genetic landscape: ESBL genes in K. pneumoniae strains.
Figure 3. Genetic landscape: ESBL genes in K. pneumoniae strains.
Microorganisms 12 01942 g003
Microorganisms 12 01942 g004
Figure 4. Genomic landscape: distribution of carbapenem and colistin genes in clinical isolates of K. pneumoniae from Northern Algeria.
Figure 4. Genomic landscape: distribution of carbapenem and colistin genes in clinical isolates of K. pneumoniae from Northern Algeria.
Microorganisms 12 01942 g004
Table 1. Primers and probes used for real-time PCR.
Table 1. Primers and probes used for real-time PCR.
GenePrimer/ProbeSequence (5′-3′)Size
(bp)		Reference
blaOXA-51OXA-51-F1 OXA-51-R1 OXA-51-
Probe		GCTCGTGCTTCGACCGAGTA TTTTTGCCCGTCCCACTTAAA
FAM-TCGGCCTTGAGCACCATAAGGCA-TAMRA		117[24]
blaOXA-23OXA-23-F1 OXA-23-R1 OXA-23-
Probe		TGCTCTAAGCCGCGCAAATA TGACCTTTTCTCGCCCTTCC
FAM-GCCCTGATCGGATTGGAGAACCA-TAMRA		130[24]
blaOXA-24OXA-24-F OXA-24-R OXA-24-
Probe		CAAATGAGATTTTCAAATGGGATGG TCCGTCTTGCAAGCTCTTGAT
FAM-GGTGAGGCAATGGCATTGTCAGCA-TAMRA		123[24]
blaOXA-58OXA-58-F OXA-58-R OXA-58-
Probe		CGCAGAGGGGAGAATCGTCT TTGCCCATCTGCCTTTTCAA
FAM-GGGGAATGGCTGTAGACCCGC-TAMRA		102[24]
blaNDM-1NDM-1-F NDM-1-R
NDM-1-probe		GCGCAACACAGCCTGACTTT CAGCCACCAAAAGCGATGTC
FAM-CAACCGCGCCCAACTTTGGC-TAMRA		155[24]
blaOXA-48OXA-48-F OXA-48-R OXA-48-
Probe		TCTTAAACGGGCGAACCAAG GCGTCTGTCCATCCCACTTA
FAM-AGCTTGATCGCCCTCGATTTGC-TAMRA		125[25]
blaKPCKPC-F KPC-R
KPC-probe		GATACCACGTTCCGTCTGGA GGTCGTGTTTCCCTTTAGCC
FAM-CGCGCGCCGTGACGGAAAGC-TAMRA		180[25]
bla VIMVIM-F VIM-R
VIM-probe		CACAGYGGCMCTTCTCGCGGAGA GCGTACGTYGCCACYCCAGCC FAMAGTCTCCACGCACTTTCATGACCGCGTCGGC
G-TAMRA		132Jean.M. ROLAIN
Laboratory [23]
blaCTX-MCTX-M F CTX-M R CTX-M
Probe		CGGGCRATGGCGCARAC TGCRCCGGTSGTATTGCC CCARCGGGCGCAGYTGGTGAC105[26]
Table 2. Primers Used for Standard PCR.
Table 2. Primers Used for Standard PCR.
GenePositive ControlPrimerSequence 5′-3′Size (bp)Reference
blaTEMKpnaseyFATGAGTATTCAACATTTCCGTG861[27]
RTTACCAATGCTTAATCAGTGAG
blaCTXKpnaseyFCCCATGGTTAAAAAATCACTGC944[26]
RCAGCGCTTTTGCCGTCTCCG
blaSHVKpnaseyFATTTGTCGCTTCTTTACTCGC1051[28]
RTTTATGGCGTTACCTTTGACC
blaOXA-48E. coli
CMUL64		FTTGGTGGCATCGATTATCGG744[29]
RGAGCACTTCTTTTGTGATGGC
blaKPCKpnaseyFATGTCACTGTATCGCCGTCT893Jean.M. ROLAIN
Laboratory [23]
RTTTTCAGAGCCTTACTGCCC
Table 3. Analysis of carbapenem-resistant K. pneumoniae strains: profiling and characteristics.
Table 3. Analysis of carbapenem-resistant K. pneumoniae strains: profiling and characteristics.
StrainsERT
MIC (mg/L)		IMP
MIC (mg/L)		Carba
Gene		bla Gene TypesSamplesDepartmentAge (Year)Gender
KP130.75 0.25 OXA-48blaCTX-M; blaTEM;
blaSHV		Respiratory sample *Surgery 63M
KP341 2 OXA-48blaCTX-M; blaTEM;
blaSHV		BloodICU19M
KP460.75 0.75 OXA-48blaCTX-M; blaTEMPus Miscellaneous *2M
KP860.75 2 OXA-48blaTX-M; blaTEMBloodNeonatal service25daysM
KP8732 2 -blaSHVBloodSurgery32M
KP10332 32 OXA-48 BloodNeonatal service23 daysF
KP1110.75 0.5 OXA-48 Pus Neonatal service14 daysF
KP1171 0.25 - BloodMiscellaneous **32F
KP1180.75 0.38 OXA-48 UrineICU43F
KP1211 1 OXA-48 UrineICU70M
KP1222 0.25 -blaCTX-M blaTEM
blaSHV		UrineICU41F
KP1240.5 1 OXA-48 BloodICU70M
ERT: ertapenem; IMP: imipenem; MIC: minimum inhibitory concentration; Carba R: carbapenem resistance; F: female; M: male; ICU: intensive care unit; S: susceptible; R: resistant; miscellaneous *: forensic medicine; miscellaneous **: hematology; respiratory sample *: tracheal swab.
Table 4. Comprehensive molecular analysis of colistin-resistant K. pneumoniae strains: phenotype, MIC, resistance genes, and clinical demographics.
Table 4. Comprehensive molecular analysis of colistin-resistant K. pneumoniae strains: phenotype, MIC, resistance genes, and clinical demographics.
StrainsResistance PhenotypeColMIC (mg/L)bla Gene Typesmcr GenesmgrB MutationsDepartmentSamplesAgeGender
KP23CT, AMX, AMC, CRO, FEP, TPZ, AK, FF, SXT, TET16blaCTX-M, blaTEM, blaSHVmcr-82 insertions
1 substitution		Internal medicineRespiratory sample *48F
KP24CT, AMX, AMC, CRO, FEP, TPZ, AK GN, FF, SXT4blaCTX-M, blaTEM, blaSHV-1 insertionPediatricsPus12M
KP27CT, AMX, AMC, CRO, FEP, TPZ, AK, GN, FF, SXT, TET4blaCTX-M, blaTEM, blaSHV-3 insertionsMiscellaneous *Respiratory **46M
KP33CT, AMX, AMC, CRO, FEP, TPZ, FF, SXT, TET8blaCTX–M, blaSHVmcr-82 insertionsMiscellaneous *Biological fluid *11 monthsF
KP46CT, AMX, AMC, CRO, FEP, TPZ, MEC, ETP, AK, GN, CIP, FF, SXT, TET16blaCTX-M, blaTEM, blaOXA-48--3 insertionsNeonatologyBlood25 daysM
KP86CT, AMX, AMC, CRO, FEP, TPZ, MEC, ETP, AK, GN, CIP, FF, SXT, TET4blaCTX–M, blaTEM, blaOXA-48--2 insertionsMiscellaneous *Pus2M
KP115CT, AMX, AMC, CRO, FEP, TPZ, AK, GN, CIP, FF, SXT, TET23blaCTX-M, blaTEM,
blaSHV		-1 insertionICUUrine27F
COL: colistin; MIC: minimum inhibitory concentration; Col R: colistin resistance; miscellenous *: forensic medicine; respiratory sample *: sputum; respiratory sample **: pleural fluid; biological fluid *: cerebrospinal fluid (CSF); F: female; M: male.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rihane, R.; Hecini-Hannachi, A.; Bentchouala, C.; Benlabed, K.; Diene, S.M. Molecular Characterization of Carbapenem and Colistin Resistance in Klebsiella pneumoniae Isolates Obtained from Clinical Samples at a University Hospital Center in Algeria. Microorganisms 2024, 12, 1942. https://doi.org/10.3390/microorganisms12101942

AMA Style

Rihane R, Hecini-Hannachi A, Bentchouala C, Benlabed K, Diene SM. Molecular Characterization of Carbapenem and Colistin Resistance in Klebsiella pneumoniae Isolates Obtained from Clinical Samples at a University Hospital Center in Algeria. Microorganisms. 2024; 12(10):1942. https://doi.org/10.3390/microorganisms12101942

Chicago/Turabian Style

Rihane, Riyane, Abla Hecini-Hannachi, Chafia Bentchouala, Kaddour Benlabed, and Seydina M. Diene. 2024. "Molecular Characterization of Carbapenem and Colistin Resistance in Klebsiella pneumoniae Isolates Obtained from Clinical Samples at a University Hospital Center in Algeria" Microorganisms 12, no. 10: 1942. https://doi.org/10.3390/microorganisms12101942

APA Style

Rihane, R., Hecini-Hannachi, A., Bentchouala, C., Benlabed, K., & Diene, S. M. (2024). Molecular Characterization of Carbapenem and Colistin Resistance in Klebsiella pneumoniae Isolates Obtained from Clinical Samples at a University Hospital Center in Algeria. Microorganisms, 12(10), 1942. https://doi.org/10.3390/microorganisms12101942

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop