Pathogenicity of Citrobacter freundii Causing Mass Mortalities of Macrobrachium rosenbergii and Its Induced Host Immune Response
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Isolation
2.2. Bacterial Virulence Assay
2.3. Histopathology
2.4. Identification of Bacteria
2.5. Determination of Extracellular Enzymes and Hemolysin
2.6. Determination of Virulence-Related Genes
2.7. Detection of Immune-Related Genes Expression After C. freundii Infection
3. Results
3.1. Virulence of the Isolate
3.2. Histopathological Changes
3.3. Characterization and Identification of Isolate FSNM-1
3.4. Virulence Genes of Isolate FSNM-1
3.5. Detection of Extracellular Enzymes and Hemolysin Activities
3.6. Expression Analysis of Immune-Related Genes
3.6.1. Immune-Related Genes Expression in Hepatopancreas After C. freundii Infection
3.6.2. Immune-Related Genes Expression in Gills After C. freundii Infection
3.6.3. Immune-Related Genes Expression in Intestines After C. freundii Infection
3.6.4. Immune-Related Genes Expression in Hemocytes After C. freundii Infection
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Xu, H.J.; Chen, Y.L.; Wang, Y.M.; Luo, J.Y.; Li, J.W.; Shen, S.Q.; Yang, J.S.; Ma, W.M. Full Functional Sex Reversal Achieved Through Silencing of MroDmrt11E Gene in Macrobrachium rosenbergii: Production of All-Male Monosex Freshwater Prawn. Front. Endocrinol. 2022, 12, 772498. [Google Scholar] [CrossRef]
- FAO. The State of World Fisheries and Aquaculture 2023. Sustainability in Action; Food and Agriculture Organization of the United Nations: Rome, Italy, 2023. [Google Scholar]
- Zhang, Y.Y.; Shi, Q.; Wei, W.Z.; Xu, F.; Nie, F.B.; Yang, H. Effects of microcystin-LR on the immune dysfunction and ultrastructure of hepatopancreas in giant freshwater prawn Macrobrachium rosenbergii. Fish Shellfish Immunol. 2019, 89, 586–594. [Google Scholar] [CrossRef]
- Liu, P.M.; Zhao, X.X.; Tang, Q.Y.; Li, J.F.; Xia, Z.L.; Dong, H.Y.; Yang, G.L.; Yi, S.K.; Gao, Q.X. Transcriptome analysis of the gonad reveals growth differences between large, medium and small individuals in a pure family of Macrobrachium rosenbergii. Aquaculture 2024, 586, 740739. [Google Scholar] [CrossRef]
- Dong, X.X.; Lv, L.L.; Zhao, W.H.; Yu, Y.B.; Liu, Q.G. Optimization of integrated multi-trophic aquaculture systems for the giant freshwater prawn Macrobrachium rosenbergii. Aquac. Environ. Interact. 2018, 10, 547–556. [Google Scholar] [CrossRef]
- Hooper, C.; Debnath, P.P.; Stentiford, G.D.; Bateman, K.S.; Salin, K.R.; Bass, D. Diseases of the giant river prawn Macrobrachium rosenbergii: A review for a growing industry. Rev. Aquac. 2023, 15, 738–758. [Google Scholar] [CrossRef]
- Gao, X.J.; Zhang, H.H.; Jiang, Q.; Chen, N.; Li, X.X.; Liu, X.D.; Yang, H.; Wei, W.H.; Zhang, X.J. Enterobacter cloacae associated with mass mortality in zoea of giant freshwater prawns Macrobrachium rosenbergii and control with specific chicken egg yolk immunoglobulins (IgY). Aquaculture 2019, 501, 331–337. [Google Scholar] [CrossRef]
- Gao, X.J.; Miao, Z.; Li, X.X.; Chen, N.; Gu, W.W.; Liu, X.D.; Yang, H.; Wei, W.H.; Zhang, X.J. Pathogenicity of non-O1/O139 Vibrio cholerae and its induced immune response in Macrobrachium rosenbergii. Fish Shellfish Immunol. 2019, 92, 300–307. [Google Scholar] [CrossRef]
- Li, X.X.; Zhou, Y.F.; Jiang, Q.; Yang, H.; Pi, D.M.; Liu, X.D.; Gao, X.J.; Chen, N.; Zhang, X.J. Virulence properties of Vibrio vulnificus isolated from diseased zoea of freshness shrimp Macrobrachium rosenbergii. Microb. Pathog. 2019, 127, 166–171. [Google Scholar] [CrossRef]
- Khuntia, C.P.; Das, B.K.; Samantaray, B.R.; Samal, S.K.; Mishra, B.K. Characterization and pathogenicity studies of Vibrio parahaemolyticus isolated from diseased freshwater prawn, Macrobrachium rosenbergii (de Man). Aquac. Res. 2008, 39, 301–310. [Google Scholar] [CrossRef]
- Abdolnabi, S.; Ina-Salwany, M.Y.; Daud, H.M.; Mariana, N.S.; Abdelhadi, Y.M. Pathogenicity of Aeromonas hydrophila in giant freshwater prawn; Macrobrachium rosenbergii, cultured in East. Iran. J. Fish. Sci. 2015, 14, 232–245. [Google Scholar]
- Peng, X.; Tu, H.H.; Yao, X.Y.; Lan, X.; Zhong, Z.X.; Luo, J.P.; Tang, Q.Y.; Yi, S.K.; Xia, Z.L.; Yang, G.L. Isolation, identification, and virulence gene analysis of pathogenic Aeromonas dhakensis in Macrobrachium rosenbergii and histopathological observation. J. Oceanol. Limnol. 2024, 42, 664–675. [Google Scholar] [CrossRef]
- Gao, X.J.; Chen, Z.; Zhang, Z.R.; Qian, Q.Q.; Chen, A.T.; Qin, L.J.; Tang, X.Z.; Jiang, Q.; Zhang, X.J. Pathogenicity of Aeromonas veronii Isolated from Diseased Macrobrachium rosenbergii and Host Immune-Related Gene Expression Profiles. Microorganisms 2024, 12, 694. [Google Scholar] [CrossRef]
- Citarasu, T.; Lelin, C.; Babu, M.M.; Anand, S.B.; Nathan, A.A.; Vakharia, V.N. Oral vaccination of Macrobrachium rosenbergii with baculovirus-expressed M. rosenbergii nodavirus (MrNV) capsid protein induces protective immunity against MrNV challenge. Fish Shellfish Immunol. 2019, 86, 1123–1129. [Google Scholar] [CrossRef]
- Ravi, M.; Hameed, A.S. Experimental transmission of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV) in Macrobrachium malcolmsonii and Macrobrachium rude. Aquac. Int. 2015, 23, 195–201. [Google Scholar] [CrossRef]
- Zhao, C.Y.; Miu, Q.J.; Liu, S.S.; Zhou, D.D.; He, X.Y.; Pang, J.H.; Weng, S.P.; He, J.G. Detection methods, epidemiological investigation, and host ranges of infectious precocity virus (IPV). Aquaculture 2023, 562, 738818. [Google Scholar] [CrossRef]
- Xia, J.T.; Wang, C.; Yao, L.; Wang, W.; Zhao, W.X.; Jia, T.C.; Yu, X.T.; Yang, G.L.; Zhang, Q.L. Investigation on Natural Infection of Covert Mortality Nodavirus in Farmed Giant Freshwater Prawn (Macrobrachium rosenbergii). Animals 2022, 12, 1370. [Google Scholar] [CrossRef]
- Zhang, L.; Li, Y.H.; Wu, M.L.; Ouyang, H.F.; Shi, R.X. The SNP polymorphisms associated with WSSV-resistance of prophenoloxidase in red swamp crayfish (Procambarus clarkii) and its immune response against white spot syndrome virus (WSSV). Aquaculture 2021, 538, 735787. [Google Scholar] [CrossRef]
- Nita, M.K.; Hazreen, K.B.C.; Bhassu, S.; Othman, R.Y. Detection and genetic profiling of infectious hypodermal and haematopoietic necrosis virus (IHHNV) infections in wild berried freshwater prawn, Macrobrachium rosenbergii collected for hatchery production. Mol. Biol. Rep. 2012, 39, 3785–3790. [Google Scholar] [CrossRef]
- Qian, Q.Q.; Zhou, Y.F.; Chen, Z.; Zhu, Y.J.; Xu, J.W.; Gao, X.J.; Jiang, Q.; Wang, J.; Zhang, X.J. Pathogenesis and complete genome sequence of Decapod iridescent virus 1 (DIV1) associated with mass mortality in Macrobrachium rosenbergii. Aquaculture 2023, 566, 739220. [Google Scholar] [CrossRef]
- Uddin, M.J.; Haque, F.J.; Ishrat, S.S.R. Characterization and whole-genome sequencing of an extreme arsenic-tolerant Citrobacter freundii SRS1 strain isolated from Savar area in Bangladesh. Can. J. Microbiol. 2023, 69, 44–52. [Google Scholar] [CrossRef]
- Pan, L.F.; Yang, Y.H.; Peng, Y.N.; Li, D.J.; Khan, T.A.; Chen, P.; Yan, L.; Hu, S.B.; Ding, X.Z.; Sun, Y.J.; et al. The novel pathogenic Citrobacter freundii (CFC202) isolated from diseased crucian carp (Carassius auratus) and its ghost vaccine as a new prophylactic strategy against infection. Aquaculture 2021, 533, 736190. [Google Scholar] [CrossRef]
- Cao, H.P.; Huang, X.D.; Gu, Y.; Zheng, X.R.; Xu, L.; Gai, C.L. Protective effects of Bacillus licheniformis against Citrobacter freundii infection in Chinese mitten crab Eriocheir sinensis. J. Invertebr. Pathol. 2022, 193, 107805. [Google Scholar] [CrossRef]
- Yang, J.; Tian, T.; Xiao, K.; Zeng, Q.K.; Tan, C.; Du, H.J. Pathogenic infection and immune-related gene expression of Chinese sturgeon (Acipenser sinensis) challenged by Citrobacter freundii. Dev. Comp. Immunol. 2021, 114, 103872. [Google Scholar] [CrossRef]
- Thanigaivel, S.; Vijayakumar, S.; Gopinath, S.; Mukherjee, A.; Chandrasekaran, N.; Thomas, J. In vivo and in vitro antimicrobial activity of Azadirachta indica (Lin) against Citrobacter freundii isolated from naturally infected Tilapia (Oreochromis mossambicus). Aquaculture 2015, 437, 252–255. [Google Scholar] [CrossRef]
- Özavci, V.; Dolgun, H.T.Y.; Kirkan, S. Identification of Citrobacter freundii from skin wounds in Goldfish (Carassius auratus) and determination of antibacterial susceptibility. Proc. Bulg. Acad. Sci. 2023, 76, 911–918. [Google Scholar] [CrossRef]
- Gong, C.P.; Guo, M.Y.; Lou, J.F.; Zhang, L.W.; An, Z.H.; Vakharia, V.N.; Kong, W.G.; Liu, X.D. Identification and characterization of a highly virulent Citrobacter freundii isolate and its activation on immune responses in largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2023, 143, 109224. [Google Scholar] [CrossRef]
- Behera, B.K.; Paria, P.D.; Abhishek, D.B.K. Molecular identification and pathogenicity study of virulent Citrobacter freundii associated with mortality of farmed Labeo rohita (Hamilton 1822), in India. Aquaculture 2022, 547, 737437. [Google Scholar] [CrossRef]
- Bandeira, G.; dos Santos, A.C.; Souza, C.D.; Baldissera, M.D.; Moreira, K.L.D.; da Veiga, M.L.; de Rocha, M.I.D.M.; de Vargas, A.P.C.; da Cunha, M.A.; Baldisserotto, B. Citrobacter freundii infection in silver catfish (Rhamdia quelen): Hematological and histological alterations. Microb. Pathog. 2018, 125, 276–280. [Google Scholar] [CrossRef]
- Sun, H.Y.; Cao, X.H.; Jiang, Y.F.; Ni, L.Y.; Mo, Z.Q.; Qin, Q.W.; Li, Y.W.; Dan, X.M. Outbreak of a novel disease associated with Citrobacter freundii infection in freshwater cultured stingray, Potamotrygon motoro. Aquaculture 2018, 492, 35–39. [Google Scholar] [CrossRef]
- Liu, X.D.; He, X.; An, Z.H.; Sun, W.; Chen, N.; Gao, X.J.; Li, X.X.; Zhang, X.J. Citrobacter freundii infection in red swamp crayfish (Procambarus clarkii) and host immune-related gene expression profiles. Aquaculture 2020, 515, 734499. [Google Scholar] [CrossRef]
- Guma, S.H.; Jiang, Z.Y.; Zhang, Y.J.; Wu, C.C.; Chen, Z.; Xu, J.W.; Jiang, Q.; Zhang, X.J.; Wang, C.B.; Gao, X.J. The pathogenic characterization of Citrobacter freundii and its activation on immune related genes in Macrobrachium nipponens. Microb. Pathog. 2022, 169, 105682. [Google Scholar] [CrossRef]
- Behreans, A.L.; Karber, L. Determination of LD50. In Screening in Pharmacology; Academic Press: New York, NY, USA, 1953; p. 60. [Google Scholar]
- Brenner, D.J.; Krieg, N.R.; Staley, J.T. Bergey’s Manual of Systematic Bacteriology, 2nd ed.; Part B; Springer: East Lan-sing, MI, USA, 2021; Volume 2, p. 561. [Google Scholar]
- Zhang, X.J.; Bai, X.S.; Yan, B.L.; Bi, K.R.; Qin, L. Vibrio harveyi as a causative agent of mass mortalities of megalopa in the seed production of swimming crab Portunus trituberculatus. Aquac. Int. 2014, 22, 661–672. [Google Scholar] [CrossRef]
- Zhao, C.Y.; Wen, H.G.; Huang, S.S.; Weng, S.P.; He, J.G. A Novel Disease (Water Bubble Disease) of the Giant Freshwater Prawn Macrobrachium rosenbergii Caused by Citrobacter freundii: Antibiotic Treatment and Effects on the Antioxidant Enzyme Activity and Immune Responses. Antioxidants 2022, 11, 1491. [Google Scholar] [CrossRef]
- Pang, R.; Xie, T.F.; Wu, Q.P.; Li, Y.P.; Lei, T.; Zhang, J.M.; Ding, Y.; Wang, J.; Xue, L.; Chen, M.T.; et al. Comparative Genomic Analysis Reveals the Potential Risk of Vibrio parahaemolyticus Isolated from Ready-To-Eat Foods in China. Front. Microbiol. 2019, 10, 186. [Google Scholar] [CrossRef]
- Sundell, K.; Landor, L.; Nicolas, P.; Jorgensen, J.; Castillo, D.; Middelboe, M.; Dalsgaard, I.; Donati, V.L.; Madsen, L.; Wiklund, T. Phenotypic and Genetic Predictors of Pathogenicity and Virulence in Flavobacterium psychrophilum. Front. Microbiol. 2019, 10, 1711. [Google Scholar] [CrossRef]
- Li, Y.; He, J.Z.; He, Z.L.; Zhou, Y.; Yuan, M.T.; Xu, X.; Sun, F.F.; Liu, C.C.; Li, J.Y.; Xie, W.B.; et al. Phylogenetic and functional gene structure shifts of the oral microbiomes in periodontitis patients. ISME J. 2014, 8, 1879–1891. [Google Scholar] [CrossRef]
- Grewal, H.M.S.; Sommerfelt, H. Genotypic detection of enterotoxigenic Escherichia coli colonisation factors. Apmis 2001, 109, 447–453. [Google Scholar] [CrossRef]
- Demirci, U.; Tekiner, I.H.; Cakmak, B.; Ozpinar, H. Occurrence and molecular characterization of different virulence-associated genes of Cronobacter sakazakii isolates from some foods and dust samples. Cienc. Rural 2018, 48, 127. [Google Scholar] [CrossRef]
- Meng, X.R.; Liu, X.L.; Zhang, L.Y.; Hou, B.; Li, B.Y.; Tan, C.; Li, Z.L.; Zhou, R.; Li, S.W. Virulence characteristics of extraintestinal pathogenic Escherichia coli deletion of gene encoding the outer membrane protein X. J. Vet. Med. Sci. 2016, 78, 1261–1267. [Google Scholar] [CrossRef]
- Minkara, M.S.; Ucisik, M.N.; Weaver, M.N.; Merz, K.M. Molecular dynamics study of Helicobacter pylori urease. J. Chem. Theory Comput. 2014, 247, 1852–1862. [Google Scholar] [CrossRef]
- Pinkaew, U.; Choolert, C.; Vaniksampanna, A.; Pasookhush, P.; Longyant, S.; Chaivisuthangkura, P. Characterization of a novel immune deficiency gene of Macrobrachium rosenbergii reveals antibacterial and antiviral defenses. J. Aquat. Anim. Health 2024, 36, 99–112. [Google Scholar] [CrossRef]
- Li, Y.N.; Zhan, F.B.; Li, F.L.; Lu, Z.J.; Shi, F.; Xu, Z.Z.; Yang, Y.C.; Zhao, L.J.; Qin, Z.D.; Lin, L. Immune function of cytosolic manganese superoxide dismutase from Macrobrachium rosenbergii in response to bacterial infection. Aquaculture 2021, 541, 736771. [Google Scholar] [CrossRef]
- Hancock, R.E.W.; Brown, K.L.; Mookherjee, N. Host defence peptides from invertebrates-emerging antimicrobial strategies. Immunobiology 2006, 211, 315–322. [Google Scholar] [CrossRef]
- Li, S.H.; Li, F.H. The Anti-lipopolysaccharide Factors in Crustaceans. Sub-Cell. Biochem. 2020, 94, 63–80. [Google Scholar]
- Zhou, L.; Li, G.Q.; Li, A.G.; Jiao, Y.; Li, S.M.; Huang, J.H.; Yang, L.S.; Wang, C.G. Characterization of a group D anti-lipopolysaccharide factor (ALF) involved in anti-Vibrio response in Penaeus monodon. Fish Shellfish Immunol. 2019, 89, 384–392. [Google Scholar] [CrossRef]
- Deepika, A.; Sreedharan, K.; Paria, A.; Makesh, M.; Rajendran, K.V. Toll-pathway in tiger shrimp (Penaeus monodon) responds to white spot syndrome virus infection: Evidence through molecular characterisation and expression profiles of MyD88, TRAF6 and TLR genes. Fish Shellfish Immunol. 2014, 41, 441–454. [Google Scholar] [CrossRef]
- Mahapatra, S.; Ganguly, B.; Pani, S.; Saha, A.; Samanta, M. A Comprehensive review on the dynamic role of toll-like receptors (TLRs) in frontier aquaculture research and as a promising avenue for fish disease management. Int. J. Biol. Macromol. 2023, 253, 126541. [Google Scholar] [CrossRef]
- Cai, S.H.; Huang, Y.C.; Wang, B.; Jian, J.C.; Xu, Y.H. Tumor necrosis factor receptor-associated factor 6 (TRAF6) participates in peroxinectin gene expression in Fenneropenaeus penicillatus. Fish Shellfish Immunol. 2017, 64, 193–201. [Google Scholar] [CrossRef]
- Deepika, A.; Sreedharan, K.; Rajendran, K.V. Responses of some innate immune-genes involved in the toll-pathway in black tiger shrimp (Penaeus monodon) to Vibrio harveyi infection and on exposure to ligands in vitro. J. World Aquac. Soc. 2020, 51, 1419–1429. [Google Scholar] [CrossRef]
- Bao, Y.F.; Shen, G.Q.; Guo, Y.N.; Wang, Q.; Fan, X.P.; Li, W.W. Effects of the tumor necrosis factor on hemocyte proliferation and bacterial infection in Chinese mitten crab (Eriocheir sinensis). Fish Shellfish Immunol. 2023, 143, 109175. [Google Scholar] [CrossRef]
- Huang, Y.; Si, Q.; Du, S.H.; Du, J.; Ren, Q. Molecular identification and functional analysis of a tumor necrosis factor superfamily gene from Chinese mitten crab (Eriocheir sinensis). Dev. Comp. Immunol. 2022, 134, 104456. [Google Scholar] [CrossRef]
- Fall, J.; Kono, T.; Tanekhy, M.; Itami, T.; Sakai, M. Expression of innate immune-related genes of Kuruma shrimp, Marsupenaeus japonicu, after challenge with Vibrio nigripulchritudo. Afr. J. Microbiol. Res. 2010, 4, 2426–2433. [Google Scholar]
- Du, J.; Zhu, H.X.; Ye, M.S.; Ma, Y. Macrobrachium rosenbergii Cu/Zn superoxide dismutase (Cu/Zn SOD) expressed in Saccharomyces cerevisiae and evaluation of the immune function to Vibrio parahaemolyticus. Fish Shellfish Immunol. 2019, 90, 363–375. [Google Scholar] [CrossRef]
- Panigrahi, A.; Sivakumar, M.R.; Sundaram, M.; Saravanan, A.; Das, R.R.; Katneni, V.K.; Ambasankar, K.; Dayal, J.S.; Gopikrishna, G. Comparative study on phenoloxidase activity of biofloc-reared pacific white shrimp Penaeus vannamei and Indian white shrimp Penaeus indicus on graded protein diet. Aquaculture 2020, 518, 734654. [Google Scholar] [CrossRef]
- Cerenius, L.; Lee, B.L.; Soderhall, K. The proPO-system: Pros and cons for its role in invertebrate immunity. Trends. Immunol. 2008, 29, 263–271. [Google Scholar] [CrossRef]
- Amparyup, P.; Charoensapsri, W.; Tassanakajon, A. Two prophenoloxidases are important for the survival of Vibrio harveyi challenged shrimp Penaeus monodon. Dev. Comp. Immunol. 2009, 33, 247–256. [Google Scholar] [CrossRef]
Target Gene | Primer Sequence (5′–3′) | Product Size (bp) | Reference |
---|---|---|---|
cfa1 | GCGGTTACTGGAAAGATG | 345 | CP016762.1 |
CGGCGATACTGAAATAGG | |||
cfa2 | ATCGTTAGGGTTGGGTGAA | 307 | CP016762.1 |
TTCAGCAATCATTTTTAGCTTCGCC | |||
ureD | GCCAGATGTCACGCATAACG | 243 | CP016762.1 |
GGCTGCCACTGCTGATAGAA | |||
ureG | AGGTTATCGCCACCGCTTTC | 119 | CP016762.1 |
GGTTGCCCGCATACTGCT | |||
ureE | TAACAGGCTTTGGCGAGTAGGA | 215 | CP016762.1 |
CGCCTTGACCACGCTCACT | |||
ureF | ATGCCGCAGAGTTGGCTGTC | 300 | CP016762.1 |
GGAGATTGGCTGGGTGAAAA | |||
ompX | CTACGAATACGGCTCTGC | 287 | CP016762.1 |
ATCGGTTCCTTCACTTACAC |
Target Gene | Primer Sequence (5′–3′) |
---|---|
ALF3 | GAACTGCTGTCCAACCCTG |
CCGGATGCTCCTCCGTTATC | |
TRAF6 | CGGACGGGAGTTCGATAA |
GGTGCCCACAGGTTGTCT | |
MyD88 | GAGTCATGTCAGGCCTACGA |
CACAGCTAGACCCCTCCAAT | |
TNF | TGAGCCGTTTAGCTTGGAGG |
CGCGATTATGAGACCGACCA | |
SOD | TGTCAGAAAGACCACGAA |
GATGCTGGCAACATAAGC | |
proPO | GCAACATTGGCGAACTGA |
GGGAAGGTCTCGACGACT | |
18S rRNA | CTGTTACGGGTGACGGAGAA |
TCGGAAGAGTCCCGCATT |
Biochemical Test | FSNM-1 | C. freundii |
---|---|---|
Phenylalanine | − | − |
Motility | + | + |
Sorbose | + | + |
O-F test | F | F |
Arabinol | − | − |
Maltose | + | + |
Mannitol | + | + |
Mannose | + | + |
Sorbitol | + | [+] |
Inositol | − | − |
Arabinose | + | + |
β-galactosidase | + | + |
Xylose | + | + |
Esculin | + | [+] |
Adonitol | − | − |
Inulin | + | + |
DNase | − | − |
Gelatin hydrolysis | − | − |
Tartrate utilization | + | + |
Nitrate reduction | + | + |
Citrate utilization | + | + |
Malonate utilization | − | − |
Extracellular Products | Clear Zone Diameter/mm |
---|---|
Hemolysin | 19.4 ± 1.6 |
Lecithin | 19.6 ± 2.1 |
Amylase | 27.7 ± 2.2 |
Lipase | 14.3 ± 1.2 |
Gelatinase | 17.3 ± 1.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, A.; Qian, Q.; Cai, X.; Yin, J.; Liu, Y.; Dong, Q.; Gao, X.; Jiang, Q.; Zhang, X. Pathogenicity of Citrobacter freundii Causing Mass Mortalities of Macrobrachium rosenbergii and Its Induced Host Immune Response. Microorganisms 2024, 12, 2079. https://doi.org/10.3390/microorganisms12102079
Chen A, Qian Q, Cai X, Yin J, Liu Y, Dong Q, Gao X, Jiang Q, Zhang X. Pathogenicity of Citrobacter freundii Causing Mass Mortalities of Macrobrachium rosenbergii and Its Induced Host Immune Response. Microorganisms. 2024; 12(10):2079. https://doi.org/10.3390/microorganisms12102079
Chicago/Turabian StyleChen, Anting, Qieqi Qian, Xiaoyu Cai, Jia Yin, Yan Liu, Qi Dong, Xiaojian Gao, Qun Jiang, and Xiaojun Zhang. 2024. "Pathogenicity of Citrobacter freundii Causing Mass Mortalities of Macrobrachium rosenbergii and Its Induced Host Immune Response" Microorganisms 12, no. 10: 2079. https://doi.org/10.3390/microorganisms12102079
APA StyleChen, A., Qian, Q., Cai, X., Yin, J., Liu, Y., Dong, Q., Gao, X., Jiang, Q., & Zhang, X. (2024). Pathogenicity of Citrobacter freundii Causing Mass Mortalities of Macrobrachium rosenbergii and Its Induced Host Immune Response. Microorganisms, 12(10), 2079. https://doi.org/10.3390/microorganisms12102079