Non-Conventional Metal Ion Cofactor Requirement of Dinoflagellate Alkaline Phosphatase and Translational Regulation by Phosphorus Limitation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Algal Strains, Culture Conditions and Sample Collection
2.2. Alkaline Phosphatase Activity Measurement on Algal Cells and Protein Extract
2.3. Heterologous Expression of Recombinant ACAAP and Production of Antibody
2.4. Western Blot Analysis
2.5. Metal Ion Dependency Analysis
3. Results
3.1. Metal Ion Requirement of Dino-AP
3.2. Expression Pattern of AP in A. carterae (ACAAP) under Varied P Conditions
4. Discussion
4.1. Inducible Expression of Dinoflagellate APs Through Transcriptional and Translational Regulation
4.2. Evidence of Dinoflagellate AP Protein Modification from Observation on ACAAP
4.3. Metal Ion Requirement of Dino-AP
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Moore, C.M.; Mills, M.M.; Arrigo, K.R.; Bermanfrank, I.; Bopp, L.; Boyd, P.W.; Galbraith, E.D.; Geider, R.J.; Guieu, C.; Jaccard, S.L.; et al. Processes and patterns of oceanic nutrient limitation. Nat. Geosci. 2013, 6, 701–710. [Google Scholar] [CrossRef] [Green Version]
- Karl, D.M. Microbially mediated transformations of phosphorus in the sea: New views of an old cycle. Annu. Rev. Mar. Sci. 2014, 6, 279–337. [Google Scholar] [CrossRef] [PubMed]
- Benitez-Nelson, C.R. The biogeochemical cycling of phosphorus in marine systems. Earth-Sci. Rev. 2000, 51, 109–135. [Google Scholar] [CrossRef]
- Kolowith, L.C.; Ingall, E.D.; Benner, R. Composition and cycling of marine organic phosphorus. Limnol. Oceanogr. 2001, 46, 309–321. [Google Scholar] [CrossRef]
- Paytan, A.; McLaughlin, K. The oceanic phosphorus cycle. Chem. Rev. 2007, 107, 563–576. [Google Scholar] [CrossRef]
- Mather, R.L.; Reynolds, S.E.; Wolff, G.A.; Williams, R.G.; Torresvaldes, S.; Woodward, E.M.S.; Landolfi, A.; Pan, X.; Sanders, R.; Achterberg, E.P. Phosphorus cycling in the north and south atlantic ocean subtropical gyres. Nat. Geosci. 2008, 1, 439–443. [Google Scholar] [CrossRef]
- Lin, S.; Litaker, R.W.; Sunda, W.G. Phosphorus physiological ecology and molecular mechanisms in marine phytoplankton. J. Phycol. 2016, 52, 10–36. [Google Scholar] [CrossRef] [PubMed]
- Dyhrman, S.T.; Ammerman, J.W.; Mooy, B.A.S.V. Microbes and the marine phosphorus cycle. Oceanography 2007, 20, 110–116. [Google Scholar] [CrossRef]
- Armbrust, E.V.; Berges, J.A.; Bowler, C.; Green, B.R.; Martinez, D.; Putnam, N.H.; Zhou, S.; Allen, A.E.; Apt, K.E.; Bechner, M.; et al. The genome of the diatom Thalassiosira pseudonana: Ecology, evolution, and metabolism. Science 2004, 306, 79–86. [Google Scholar] [CrossRef]
- Dyhrman, S.T.; Jenkins, B.D.; Rynearson, T.A.; Saito, M.A.; Mercier, M.L.; Alexander, H.; Whitney, L.P.; Drzewianowski, A.; Bulygin, V.V.; Bertrand, E.M.; et al. The transcriptome and proteome of the diatom Thalassiosira pseudonana reveal a diverse phosphorus stress response. PLoS ONE 2012, 7, e33768. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Zhang, H.; Cui, Y.; Lin, S. High sequence variability, diverse subcellular localizations, and ecological implications of alkaline phosphatase in dinoflagellates and other eukaryotic phytoplankton. Front. Microbiol. 2012, 3, 235. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.Y.; Shih, C.Y.; Liu, H.C.; Chang, J.; Chen, Y.L.; Chen, Y.R.; Lin, H.T.; Chang, Y.Y.; Hsu, C.H.; Lin, H.J. Identification and characterization of an extracellular alkaline phosphatase in the marine diatom Phaeodactylum tricornutum. Mar. Biotechnol. 2013, 15, 425–436. [Google Scholar] [CrossRef] [PubMed]
- Luo, H.; Benner, R.; Long, R.A.; Hu, J. Subcellular localization of marine bacterial alkaline phosphatases. Proc. Natl. Acad. Sci. USA 2009, 106, 21219–21223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sebastian, M.; Ammerman, J.W. The Alkaline Phosphatase PhoX is more widely distributed in marine bacteria than the classical PhoA. ISME J. 2009, 3, 563–572. [Google Scholar] [CrossRef] [PubMed]
- White, A.E. New insights into bacterial acquisition of phosphorus in the surface ocean. Proc. Natl. Acad. Sci. USA 2009, 106, 21013–21014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kathuria, S.; Martiny, A.C. Prevalence of a calcium-based alkaline phosphatase associated with the marine cyanobacterium Prochlorococcus and other ocean bacteria. Environ. Microbiol. 2011, 13, 74–83. [Google Scholar] [CrossRef]
- Yong, S.C.; Roversi, P.; Lillington, J.; Rodriguez, F.; Krehenbrink, M.; Zeldin, O.B.; Garman, E.F.; Lea, S.M.; Berks, B.C. A complex iron-calcium cofactor catalyzing phosphotransfer chemistry. Science 2014, 345, 1170–1173. [Google Scholar] [CrossRef] [Green Version]
- Coleman, J.E. Structure and mechanism of alkaline phosphatase. Annu. Rev. Biophys. Biomol. Struct. 1992, 21, 441–483. [Google Scholar] [CrossRef]
- Zalatan, J.G.; Fenn, T.D.; Brunger, A.T.; Herschlag, D. Structural and functional comparisons of nucleotide pyrophosphatase/phosphodiesterase and alkaline phosphatase: Implications for mechanism and evolution. Biochemistry 2006, 45, 9788–9803. [Google Scholar] [CrossRef]
- Luo, M.; Guo, Y.C.; Deng, J.Y.; Wei, H.P.; Zhang, Z.P.; Leng, Y.; Men, D.; Song, L.R.; Zhang, X.E.; Zhou, Y.F. Characterization of a monomeric heat-labile classical alkaline phosphatase from Anabaena sp. PCC7120. Biochemistry 2010, 75, 655. [Google Scholar] [CrossRef]
- Zaheer, R.; Morton, R.; Proudfoot, M.; Yakunin, A.; Finan, T.M. Genetic and biochemical properties of an alkaline phosphatase PhoX family protein found in many bacteria. Environ. Microbiol. 2009, 11, 1572–1587. [Google Scholar] [CrossRef] [PubMed]
- Sebastian, M.; Ammerman, J.W. Role of the phosphatase PhoX in the phosphorus metabolism of the marine bacterium Ruegeria pomeroyi DSS-3. Environ. Microbiol. Rep. 2011, 3, 535–542. [Google Scholar] [CrossRef] [PubMed]
- Quisel, J.D.; Wykoff, D.D.; Grossman, A.R. Biochemical characterization of the extracellular phosphatases produced by phosphorus-deprived Chlamydomonas reinhardtii. Plant Physiol. 1996, 111, 839–848. [Google Scholar] [CrossRef] [PubMed]
- Hallmann, A. Enzymes in the extracellular matrix of Volvox: An inducible, calcium-dependent phosphatase with a modular composition. J. Biol. Chem. 1999, 274, 1691–1697. [Google Scholar] [CrossRef]
- Moseley, J.L.; Chang, C.W.; Grossman, A.R. Genome-based approaches to understanding phosphorus deprivation responses and PSR1 control in Chlamydomonas reinhardtii. Eukaryot. Cell 2006, 5, 26–44. [Google Scholar] [CrossRef]
- Kageyama, H.; Tripathi, K.; Rai, A.K.; Chaum, S.; Waditeesirisattha, R.; Takabe, T. An alkaline phosphatase/phosphodiesterase, PhoD, induced by salt stress and secreted out of the cells of Aphanothece halophytica, a halotolerant cyanobacterium. Appl. Environ. Microbiol. 2011, 77, 5178–5183. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.M.; Sun, J.; Qiu, J.W.; Jing, H.; Liu, H. Characterization of the proteomic profiles of the brown tide alga Aureoumbra lagunensis under phosphate- and nitrogen-limiting conditions and of its phosphate limitation-specific protein with alkaline phosphatase activity. Appl. Environ. Microbiol. 2012, 78, 2025–2033. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Wahlund, T.M.; Feng, L.; Shaked, Y.; Morel, F.M.M. A novel alkaline phosphatase in the Coccolithophore Emiliania huxleyi (Prymnesiophyceae) and its regulation by phosphorus. J. Phycol. 2006, 42, 835–844. [Google Scholar] [CrossRef]
- Feng, T.Y.; Yang, Z.K.; Zheng, J.W.; Xie, Y.; Li, D.W.; Murugan, S.B.; Yang, W.D.; Liu, J.S.; Li, H.Y. Examination of metabolic responses to phosphorus limitation via proteomic analyses in the marine diatom Phaeodactylum tricornutum. Sci. Rep. 2015, 5, 10373. [Google Scholar] [CrossRef]
- Bowler, C.; Allen, A.E.; Badger, J.H.; Grimwood, J.; Jabbari, K.; Kuo, A.; Maheswari, U.; Martens, C.; Maumus, F.; Otillar, R.P.; et al. The Phaeodactylum genome reveals the evolutionary history of diatom genomes. Nature 2008, 456, 239–244. [Google Scholar] [CrossRef]
- Ou, L.; Qin, X.; Shi, X.; Feng, Q.; Zhang, S.; Lu, S.; Qi, Y. Alkaline phosphatase activities and regulation in three harmful Prorocentrum species from the coastal waters of the East China Sea. Microb. Ecol. 2019, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Wang, L.; Shi, X.; Lin, S. Rapidly diverging evolution of an atypical alkaline phosphatase (PhoAaty) in marine phytoplankton: Insights from dinoflagellate alkaline phosphatases. Front. Microbiol. 2015, 6, 868. [Google Scholar] [CrossRef] [PubMed]
- LaJeunesse, T.C.; Parkinson, J.E.; Gabrielson, P.W.; Jeong, H.J.; Reimer, J.D.; Voolstra, C.R.; Santos, S.R. Systematic revision of Symbiodiniaceae highlights the antiquity and diversity of coral endosymbionts. Curr. Biol. 2018, 28, 2570–2580. [Google Scholar] [CrossRef] [PubMed]
- Guillard, R.R.L.; Hargraves, P.E. Stichochrysis immobilis is a diatom, not a chrysophyte. Phycologia 1993, 32, 234–236. [Google Scholar] [CrossRef]
- Parsons, T.R.; Marita, Y.; Lalli, C.M. A Manual of Chemical and Biological Methods for Seawater Analysis, 1st ed.; Pergamon Press: Oxford, UK, 1984; pp. 22–25. [Google Scholar]
- Lin, X.; Zhang, H.; Cui, Y.; Lin, S. Alkaline phosphatase gene sequence and transcriptional regulation by phosphate limitation in Amphidinium carterae (Dinophyceae). J. Phycol. 2011, 47, 1110–1120. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Zhang, H.; Cui, Y.; Lin, S. Alkaline phosphatase gene sequence characteristics and transcriptional regulation by phosphate limitation in Karenia brevis (Dinophyceae). Harmful Algae 2012, 17, 14–24. [Google Scholar] [CrossRef]
- Zhang, C.; Lin, S.; Huang, L.; Lu, W.; Li, M.; Liu, S. Suppression subtraction hybridization analysis revealed regulation of some cell cycle and toxin genes in Alexandrium catenella by phosphate limitation. Harmful Algae 2014, 39, 26–39. [Google Scholar] [CrossRef]
- Shi, X.; Lin, X.; Li, L.; Palenik, B.; Lin, S. Transcriptomic and microRNAomic profiling reveals multi-faceted mechanisms to cope with phosphate stress in a dinoflagellate. ISME J. 2017, 11, 2209. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Guo, C.; Zhang, Y.; Wang, C.; Lin, X.; Lin, S. Identification and expression analysis of an atypical alkaline phosphatase in Emiliania huxleyi. Front. Microbiol. 2018, 9, 2156. [Google Scholar] [CrossRef] [PubMed]
- Gentile, F.; Amodeo, P.; Febbraio, F.; Picaro, F.; Motta, A.; Formisano, S.; Nucci, R. SDS-resistant active and thermostable dimers are obtained from the dissociation of homotetrameric β-Glycosidase from hyperthermophilic Sulfolobus solfataricus in SDS stabilizing role of the A-C intermonomeric interface. J. Biol. Chem. 2002, 277, 44050–44060. [Google Scholar] [CrossRef]
- Rosen, R.F.; Tomidokoro, Y.; Ghiso, J.A.; Walker, L.C. SDS-PAGE/immunoblot detection of Aβ multimers in human cortical tissue homogenates using antigen-epitope retrieval. J. Vis. Exp. 2010, 38, e1916. [Google Scholar]
- Mann, M.; Jensen, O.N. Proteomic analysis of post-translational modifications. Nat. Biotechnol. 2003, 21, 255–261. [Google Scholar] [CrossRef] [PubMed]
- Khoury, G.A.; Baliban, R.C.; Floudas, C.A. Proteome-wide post-translational modification statistics: Frequency analysis and curation of the swiss-prot database. Sci. Rep. 2011, 1, 1161–1166. [Google Scholar] [CrossRef] [PubMed]
- Dudev, M.; Lim, C. Principles governing Mg, Ca, and Zn binding and selectivity in proteins. Chem. Rev. 2003, 103, 773–788. [Google Scholar] [CrossRef] [PubMed]
- Hou, G.; Cui, Q. Stabilization of different types of transition states in a single enzyme active site: QM/MM analysis of enzymes in the alkaline phosphatase superfamily. J. Am. Chem. Soc. 2013, 135, 10457–10469. [Google Scholar] [CrossRef] [PubMed]
- Jing, Z.; Liu, C.; Qi, R.; Ren, P. Many-body effect determines the selectivity for Ca2+ and Mg2+ in proteins. Proc. Natl. Acad. Sci. USA 2018, 115, E7495–E7501. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.R.; Shien, J.H.; Shieh, H.K.; Hu, C.C.; Gong, S.R.; Chen, L.Y.; Chang, P.C. Cloning of the gene and characterization of the enzymatic properties of the monomeric alkaline phosphatase (PhoX) from Pasteurella multocida strain X-73. FEMS Microbiol. Lett. 2007, 267, 113–120. [Google Scholar] [CrossRef] [PubMed]
- Dyhrman, S.T.; Palenik, B.P. The identification and purification of a cell-surface alkaline phosphatase from the dinoflagellate Prorocentrum minimum (Dinophyceae). J. Phycol. 1997, 33, 602–612. [Google Scholar] [CrossRef]
- Dyhrman, S.T. Ectoenzymes in Prorocentrum minimum. Harmful Algae 2005, 4, 619–627. [Google Scholar] [CrossRef]
- Rivkin, R.; Swift, E. Characterization of alkaline phosphatase and organic phosphorous utilization in the oceanic dinoflagellate Pyrocystis noctiluca. Mar. Biol. 1980, 61, 1–8. [Google Scholar] [CrossRef]
- Dudev, M.; Lim, C. Discovering structural motifs using a structural alphabet: Application to magnesium-binding sites. BMC Bioinform. 2007, 8, 106. [Google Scholar] [CrossRef] [PubMed]
- Dudev, M.; Lim, C. Competition among metal ions for protein binding sites: Determinants of metal ion selectivity in proteins. Chem. Rev. 2013, 114, 538–556. [Google Scholar] [CrossRef] [PubMed]
- Moore, C.M. Microbial proteins and oceanic nutrient cycles. Science 2014, 345, 1120–1121. [Google Scholar] [CrossRef] [PubMed]
Applications | Primer Name | Direction | Primer sequence (5′-3′) | PCR Condition |
---|---|---|---|---|
pACAAP | PF1 | F | TTGAGCACATACACCGACGA | 94 °C 3min, 35 cycles (94 °C, 30 s, 56 °C, 45s, 72 °C, 1 min), 72 °C, 10 min |
PR1 | R | AGATGCATTCAGATACATGATG | ||
rACAAP | PF2 | F | AAGGGACGTAGGCTTGCTAG | |
PR2 | R | CGCACGCACGGTCAAGAAG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, X.; Guo, C.; Li, L.; Li, T.; Lin, S. Non-Conventional Metal Ion Cofactor Requirement of Dinoflagellate Alkaline Phosphatase and Translational Regulation by Phosphorus Limitation. Microorganisms 2019, 7, 232. https://doi.org/10.3390/microorganisms7080232
Lin X, Guo C, Li L, Li T, Lin S. Non-Conventional Metal Ion Cofactor Requirement of Dinoflagellate Alkaline Phosphatase and Translational Regulation by Phosphorus Limitation. Microorganisms. 2019; 7(8):232. https://doi.org/10.3390/microorganisms7080232
Chicago/Turabian StyleLin, Xin, Chentao Guo, Ling Li, Tangcheng Li, and Senjie Lin. 2019. "Non-Conventional Metal Ion Cofactor Requirement of Dinoflagellate Alkaline Phosphatase and Translational Regulation by Phosphorus Limitation" Microorganisms 7, no. 8: 232. https://doi.org/10.3390/microorganisms7080232
APA StyleLin, X., Guo, C., Li, L., Li, T., & Lin, S. (2019). Non-Conventional Metal Ion Cofactor Requirement of Dinoflagellate Alkaline Phosphatase and Translational Regulation by Phosphorus Limitation. Microorganisms, 7(8), 232. https://doi.org/10.3390/microorganisms7080232