Differential Pathogenic Gene Expression of E. histolytica in Patients with Different Clinical Forms of Amoebiasis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Obtention of Samples
2.2. Microscopic Detection of Entamoeba Trophozoites
2.3. Anti-Amebic Antibody Detection
2.4. Obtention of DNA and RNA from Biological Samples
2.5. cDNA Synthesis
2.6. PCR Identification of E. histolytica
2.7. Molecular Analysis of the Expression of Amoebic Genes
2.8. Statistical Analysis
3. Results
3.1. General Characteristics of Studied Patients
3.2. Analysis of the Expression of Amoebic Genes Associated with Pathogenicity
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- WHO; PAN American Health Organization; UNESCO. Expert Consultation on Amoebiasis. WHO Wkly. Epidem. Rec. 1997, 72, 97–100. [Google Scholar]
- Mortimer, L.; Chadee, K. The immunopathogenesis of Entamoeba histolytica. Exp. Parasitol. 2010, 126, 366–380. [Google Scholar] [CrossRef] [PubMed]
- Haque, R.; Huston, C.D.; Hughes, M.; Houpt, E.; Petri, W.A., Jr. Amebiasis. N. Engl. J. Med. 2003, 348, 1565–1573. [Google Scholar] [CrossRef] [PubMed]
- Huston, C.D.; Haque, R.; Petri, W.A., Jr. Molecular-based diagnosis of Entamoeba histolytica infection. Exp. Rev. Mol. Med. 1999, 1999, 1–11. [Google Scholar] [CrossRef]
- Ximénez, C.; Cerritos, R.; Rojas, L.; Dolabella, S.; Morán, P.; Shibayama, M.; Gonzalez, E.; Valadez, A.; Hernandez, E.; Valenzuela, O.; et al. Human amebiasis: Breaking the paradigm? Int. J. Environ. Res. Public Health 2010, 7, 1105–1120. [Google Scholar] [CrossRef]
- Antony, S.J.; Lopez-Po, P. Genital amebiasis: Historical perspective of an unusual disease presentation. Urology 1999, 54, 952–955. [Google Scholar] [CrossRef]
- Ríos-Yuil, J.M.; Mercadillo-Pérez, P.; Yuil-de Ríos, E.; Ríos-Castro, M. Amebiasis Cutánea: Conceptos actuals. Rev. Med. Hosp. Gen. Mex. 2012, 75((2)), 114–122. [Google Scholar]
- Schmerin, M.J.; Gelston, A.; Jones, T.C. Amebiasis. An increasing problem among homosexuals in New York City. JAMA 1977, 238, 1386–1387. [Google Scholar] [CrossRef]
- Suzuki, J.; Ise, I. Amebiasis as a sexually transmitted disease with special emphasis on the Entamoeba histolytica antibody prevalence in females in Tokyo. Infect. Agents. Surveill. Rep. 2007, 28, 108–109. [Google Scholar]
- Chelsea, M.; Petri, W.A., Jr. Regulation of Virulence of Entamoeba histolytica. Annu. Rev. Microbiol. 2014, 68, 493–520. [Google Scholar] [CrossRef]
- Petri, W.A., Jr.; Haque, R.; Mann, B.J. The bittersweet interface of parasite and host: Lectin-carbohydrate interactions during human invasion by the parasite Entamoeba histolytica. Annu. Rev. Microbiol. 2002, 56, 39–64. [Google Scholar] [CrossRef] [PubMed]
- Petri, W.A., Jr.; Chapman, M.D.; Snodgrass, T.L.-; Mann, B.J.; Broman, J.; Ravdin, J.I. Subunit structure of the galactose and N-acetyl-D galactosamine-inhibitable adherence lectin of Entamoeba histolytica. J. Biol. Chem. 1989, 264, 3007–3012. [Google Scholar] [PubMed]
- Bruchhaus, I.; Jacobs, T.; Leippe, M.; Tannich, E. Entamoeba histolytica and Entamoeba dispar: Differences in numbers and expression of cysteine proteinase genes. Mol. Microbiol. 1996, 22, 255–263. [Google Scholar] [CrossRef] [PubMed]
- Lidell, M.E.; Moncada, D.M.; Chadee, K.; Hansson, G.C. Entamoeba histolytica cysteine proteases cleave the MUC2 mucin in its C-terminal domain and dissolve the protective colonic mucus gel. Proc. Natl. Acad. Sci. USA 2006, 103, 9298–9303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bruchhaus, I.; Loftus, B.J.; Hall, N.; Tannich, E. The intestinal protozoan parasite Entamoeba histolytica contains 20 cysteine protease genes of which only as mall subset is expressed during in vitro cultivation. Eukaryot. Cell. 2003, 2, 501–509. [Google Scholar] [CrossRef] [Green Version]
- Ravdin, J.I.; Croft, B.Y.; Guerrant, R.L. Cytopathogenic mechanisms of Entamoeba histolytica. J. Exp. Med. 1980, 152, 377–390. [Google Scholar] [CrossRef] [Green Version]
- Petri, W.A., Jr.; Ravdin, J.I. Cytopathogenicity of Entamoeba histolytica: The role of amebic adherence and contact-dependent cytolysis in pathogenesis. Eur. J. Epidemiol. 1987, 3, 123–136. [Google Scholar] [CrossRef] [PubMed]
- Huston, C.D.; Houpt, E.R.; Mann, B.J.; Hahn, C.S.; Petri, W.A. Caspase 3-dependent killing of host cells by the parasite Entamoeba histolytica. Cell. Microbiol. 2000, 2, 617–625. [Google Scholar] [CrossRef]
- Ravdin, J.I.; Moreau, F.; Sullivan, J.A.; Petri, W.A., Jr.; Mandell, G.L. Relationship of free intracellular calcium to the cytolytic activity of Entamoeba histolytica. Infect. Immun. 1988, 56, 1505–1512. [Google Scholar] [CrossRef] [Green Version]
- Ragland, B.D.; Ashley, L.S.; Vaux, D.L.; Petri, W.A., Jr. Entamoeba histolytica: Target cells killed by trophozoites undergo DNA fragmentation which is not blocked by Bcl-2. Exp. Parasitol. 1994, 79, 460–467. [Google Scholar] [CrossRef]
- Seydel, K.B.; Stanley, S.L., Jr. Entamoeba histolytica induces host cell death in amebic liver abscess by a non-Fas-dependent, non-tumor necrosis factor alpha-dependent pathway of apoptosis. Infect. Immun. 1998, 66, 2980–2983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trissl, D.; Martínez-Palomo, A.; de la Torre, M.; de la Hoz, R.; de Suarez, E.P. Surface properties of Entamoeba: Increased rates of human erythrocyte phagocytosis in pathogenic strains. J. Exp. Med. 1978, 148, 1137–1145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Orozco, E.; Guarneros, G.; Martínez-Palomo, A. Entamoeba histolytica: Phagocytosis as a virulence factor. J. Exp. Med. 1983, 158, 1511. [Google Scholar] [CrossRef] [PubMed]
- Torres, F. Manual de Técnicas en Histología y Anatomía Patológica; Ariel Press: Barcelona, Spain, 2002; pp. 31–74. [Google Scholar]
- Morán, P.; Gómez, A.; Valadez, A.; Ramos, F.; González, E.; García, G.; Limón, A.; Valenzuela, O.; Ramiro, M.; Hidalgo, H.; et al. Amebic and pyogenic liver abscess: Importance of differential diagnosis in areas of endemic amebiasis. Trop. Med. Int. Health. 2007, 12, 57–64. [Google Scholar]
- Clark, C.G.; Diamond, L.S. Differentiation of pathogenic Entamoeba histolytica from other intestinal protozoa by riboprinting. Arch. Med. Res. 1992, 23, 15–16. [Google Scholar] [PubMed]
- Livak, K.J.; Schmittgen, K.J. Analysis of relative gene expression data using real time quantitative PCR and the 2(-Delta Delta Ct) method. Methods. 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Yalcin, A. Quantification of thioredoxin mRNA expression in the rat hippocampus by real-time PCR following oxidative stress. Act. Biochem. Pol. 2004, 51, 1059–1065. [Google Scholar] [PubMed]
- Vicente, J.B.; Ehrenkaufer, G.M.; Saraiva, L.M.; Teixeira, M.; Singh, U. Entamoeba histolytica modulates a complex repertoire of novel genes in response to oxidative and nitrosative stresses: Implications for amebic pathogenesis. Cell. Microbiol. 2009, 11, 51–69. [Google Scholar] [CrossRef] [Green Version]
- Nagaraja, S.; Ankri, S. Utilization of Different Omic Approaches to Unravel Stress Response Mechanisms in the Parasite Entamoeba histolytica. Front. Cell. Infect. Microbiol. 2018, 8, 19. [Google Scholar] [CrossRef] [Green Version]
- Naiyer, S.; Bhattacharya, A.; Bhattacharya, S. Advances in Entamoeba histolytica Biology Through Transcriptomic Analysis. Front. Microbiol. 2019, 10, 1921. [Google Scholar] [CrossRef]
- Meyer, M.; Fehling, H.; Matthiessen, J.; Lorenzen, S.; Schuldt, K.; Bernin, H.; Zaruba, M.; Lender, C.; Ernst, T.; Ittrich, H.; et al. Overexpression of differentially expressed genes identified in non-pathogenic and pathogenic Entamoeba histolytica clones allow identification of new pathogenicity factors involved in amoebic liver abscess formation. PLoS Pathog. 2016, 12, e1005853. [Google Scholar] [CrossRef]
- Gilchrist, C.A.; Houpt, E.; Trapaidze, N.; Fei, Z.; Crasta, O.; Asgharpour, A.; Evans, C.; Martino-Catt, S.; Baba, D.J.; Stroup, S.; et al. Impact of intestinal colonization and invasion on the Entamoeba histolytica transcriptome. Mol. Biochem. Parasitol. 2006, 147, 163–176. [Google Scholar] [CrossRef]
- Thibeaux, R.; Weber, C.; Hon, C.C.; Dillies, M.A.; Avé, P.; Coppée, J.Y.; Labruyere, E.; Guillen, N. Identification of the virulence landscape essential for Entamoeba histolytica invasion of the human Colon. PLoS Pathog. 2013, 9, e1003824. [Google Scholar] [CrossRef] [Green Version]
- De Cádiz, A.E.; Jeelani, G.; Nakada-Tsukui, K.; Caler, E.; Nozaki, T. Transcriptome analysis of encystation in Entamoeba invadens. PLoS ONE 2013, 8, e74840. [Google Scholar] [CrossRef] [PubMed]
- Baumel-Alterzon, S.; Weber, C.; Guillén, N.; Ankri, S. Identification of dihydropyrimidine dehydrogenase as a virulence factor essential for the survival of Entamoeba histolytica in glucose-poor environments. Cell. Microbiol. 2013, 15, 130–144. [Google Scholar] [CrossRef] [PubMed]
- Iyer, L.R.; Singh, N.; Verma, A.K.; Paul, J. Differential expression and immunolocalization of antioxidant enzymes in Entamoeba histolytica isolates during metronidazole stress. Biomed. Res. Int. 2014, 2014, 704937. [Google Scholar] [CrossRef] [Green Version]
- Weber, C.H.; Koutero, M.; Dillies, M.A.; Varet, H.; Lopez Camarillo, C.; Coppée, J.Y.; Hon, C.; Guillén, N. Extensive transcriptome analysis correlates the plasticity of Entamoeba histolytica pathogenesis to rapid phenotype changes depending on the environment. Sci. Rep. 2016, 6, 35852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davis, P.H.; Schulze, J.; Stanley, S.L., Jr. Transcriptomic comparison of two Entamoeba histolytica strains with defined virulence phenotypes identifies new virulence factor candidates and key differences in the expression patterns of cysteine proteases, lectin light chains, and calmodulin. Mol. Biochem. Parasitol. 2007, 151, 118–128. [Google Scholar] [CrossRef]
- Taylor, S.; Wakam, M.; Dijkman, G.; Alsarraj, M.; Nguyen, M. A practical approach to RT-qPCR publishing data that conform to the MIQE guidelines. Methods 2010, 50, S1–S5. [Google Scholar] [CrossRef]
- Wuerz, T.; Kane, J.B.; Boggild, A.K.; Krajden, S.; Keystone, J.S.; Fuksa, M.; Kain, K.C.; Warren, R.; Kempston, J.; Anderson, J. A Review of Amoebic Liver Abscess for Clinicians in a Non endemic Setting. Can. J. Gastroenterol. Hepatol. 2012, 26, 729–733. [Google Scholar] [CrossRef]
- Santos, F.; Nequiz, M.; Hernández-Cuevas, N.A.; Hernández, K.; Pineda, E.; Encalada, R.; Guillen, N.; Luis-Garcia, E.; Saralegui, A.; Saavedra, E.; et al. Maintenance of intracellular hypoxia and adequate heat shock response are essential requirements for pathogenicity and virulence of Entamoeba histolytica. Cell. Microbiol. 2015, 17, 1037–1051. [Google Scholar] [CrossRef] [PubMed]
- Rastew, E.; Vicente, J.B.; Singh, U. Oxidative stress resistance genes contribute to the pathogenic potential of the anaerobic protozoan parasite, Entamoeba histolytica. Int. J. Parasitol. 2012, 42, 1007–1015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Akbar, A.; Chatterjee, N.S.; Sena, P.; Debnath, A.; Pal, A.; Bera, T.; Das, P. Genes induced by a high-oxygen environment in Entamoeba histolytica. Mol. Biochem. Parasitol. 2004, 133, 187–196. [Google Scholar] [CrossRef] [PubMed]
- Sen, A.; Chatterjee, N.S.; Ali Akbar, M.; Nandi, N.; Das, P. The 29-kilodalton thiol-dependent peroxidase of Entamoeba histolytica is a factor involved in pathogenesis and survival of the parasite during oxidative stress. Eukaryot. Cell. 2007, 6, 664–673. [Google Scholar] [CrossRef] [Green Version]
- De Nadal, E.; Ammerer, G.; Posas, F. Controlling gene expression in response to stress. Nat. Rev. Genet. 2011, 3, 833–845. [Google Scholar] [CrossRef]
- Santi-Rocca, J.; Smith, S.; Weber, C.; Pineda., E.; Hon, C.C.; Saavedra, E.; Olivos-García, A.; Rousseau, S.; Dillies, M.A.; Coppée, J.Y.; et al. Endoplasmic reticulum stress-sensing mechanism is activated in Entamoeba histolytica upon treatment with nitric oxide. PLoS ONE 2012, 7, e31777. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, K.T.; Workman, J.L. Chromatin proteins: Key responders to stress. PLoS Biol. 2012, 10, e1001371. [Google Scholar] [CrossRef] [Green Version]
- Matthiensen, J.; Bär, A.K.; Bartels, A.K.; Marien, D.; Ofori, S.; Biller, L.; Tannich, E.; Lotter, H.; Bruchhaus, I. Overexpression of Specific Cysteine Peptidases Confers Pathogenicity to a Nonpathogenic Entamoeba histolytica Clone. mBio 2013, 4, e00072-13. [Google Scholar] [CrossRef] [Green Version]
- Macfarlane, R.C.; Singh, U. Identification of an Entamoeba histolytica serine, threonine, isoleucine, rich protein with roles in adhesion and cytotoxicity. Eukaryot. Cell 2007, 6, 2139–2146. [Google Scholar] [CrossRef] [Green Version]
- Faust, D.M.; Guillen, N. Virulence and virulence factors in Entamoeba histolytica, the agent of human amoebiasis. Microbes. Infect. 2012, 14, 1428–1441. [Google Scholar] [CrossRef]
- MacFarlane, R.C.; Singh, U. Identification of differentially expressed genes in virulent and Entamoeba species: Potential implications for amebic pathogenesis. Infect. Immun. 2006, 74, 340–351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakada-Tsukui, K.; Sekizuka, T.; Sato-Ebine, E.; Escueta-de Cadiz, A.; Ji, D.D.; Tomii, K.; Kuroda, M.; Nozaki, T. (AIG1) affects in vitro and in vivo virulence in clinical isolates of Entamoeba histolytica. PLoS Pathog. 2018, 14, e1006882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Access Number | Size of Products (pb) | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|---|---|
Ehcrt | XM_650149.1 | 355 | TGGACCAGATGTATGTGGAGG | TGGTGCTTCCCATTCTCCATC |
Ehcp-5 | XM_645845.2 | 255 | GTTGCCGCTGCTATTGATGC | ACCCCAACTGGATAAGCAGC |
Ehcp-2 | XM_645550 | 115 | ATCCAAGCACCAGAATCAGT | TTCCTTCAAGAGCTGCAAGT |
Ehlect | AF337950.1 | 281 | ACCAGTGAATGGAGCATGTGT | TTG TGC ATT CGC CTT CTC CT |
hprd | XM_646911.2 | 121 | TCAAGAGAAAGAATGTTGTTGT | ACATGGACAATATGCTGCTGC |
Ehsod | XM_6437351 | 172 | GCAGCCCAAGCATGGAATCA | ACCAACACCATCCACTTCCA |
Ehstirp | XM-648869 | 305 | GCTAACAACGCGGAAAGTAGC | ACAAGAGCAGAGCACCCTTC |
Ehhsp-70 | XM_001734367.1 | 135 | GAAACAGAACCACGTCCAGTT | TTACGTCCTCCAAGTCTCCAAT |
Ehsp-90 | AB092411.1 | 357 | ACAAGAGCAGAGCACCCTTC | CCCCATGTGCACTTGTTACAG |
Ehactin-α | XM_650064.2 | 211 | AGCTGTTCTTTCATTATATGC | TTCTCTTTCAGCAGTAGTGGT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
González-Rivas, E.; Nieves-Ramírez, M.; Magaña, U.; Morán, P.; Rojas-Velázquez, L.; Hernández, E.; Serrano-Vázquez, A.; Partida, O.; Pérez-Juárez, H.; Ximénez, C. Differential Pathogenic Gene Expression of E. histolytica in Patients with Different Clinical Forms of Amoebiasis. Microorganisms 2020, 8, 1556. https://doi.org/10.3390/microorganisms8101556
González-Rivas E, Nieves-Ramírez M, Magaña U, Morán P, Rojas-Velázquez L, Hernández E, Serrano-Vázquez A, Partida O, Pérez-Juárez H, Ximénez C. Differential Pathogenic Gene Expression of E. histolytica in Patients with Different Clinical Forms of Amoebiasis. Microorganisms. 2020; 8(10):1556. https://doi.org/10.3390/microorganisms8101556
Chicago/Turabian StyleGonzález-Rivas, Enrique, Miriam Nieves-Ramírez, Ulises Magaña, Patricia Morán, Liliana Rojas-Velázquez, Eric Hernández, Angélica Serrano-Vázquez, Oswaldo Partida, Horacio Pérez-Juárez, and Cecilia Ximénez. 2020. "Differential Pathogenic Gene Expression of E. histolytica in Patients with Different Clinical Forms of Amoebiasis" Microorganisms 8, no. 10: 1556. https://doi.org/10.3390/microorganisms8101556
APA StyleGonzález-Rivas, E., Nieves-Ramírez, M., Magaña, U., Morán, P., Rojas-Velázquez, L., Hernández, E., Serrano-Vázquez, A., Partida, O., Pérez-Juárez, H., & Ximénez, C. (2020). Differential Pathogenic Gene Expression of E. histolytica in Patients with Different Clinical Forms of Amoebiasis. Microorganisms, 8(10), 1556. https://doi.org/10.3390/microorganisms8101556