Next Article in Journal
The Xanthomonas RaxH-RaxR Two-Component Regulatory System Is Orthologous to the Zinc-Responsive Pseudomonas ColS-ColR System
Previous Article in Journal
Indicative Marker Microbiome Structures Deduced from the Taxonomic Inventory of 67 Full-Scale Anaerobic Digesters of 49 Agricultural Biogas Plants
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 9
Issue 7
10.3390/microorganisms9071460
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Free-Living Amoebae in Soil Samples from Santiago Island, Cape Verde

by
Djeniffer Sousa-Ramos
1,†,
María Reyes-Batlle
1,2,3,*,†,
Natália K. Bellini
1,4,
Rubén L. Rodríguez-Expósito
1,2,3,
José E. Piñero
1,2,3,* and
Jacob Lorenzo-Morales
1,2,3,*
1
Instituto Universitario de Enfermedades Tropicales y Salud Pública de Canarias (IUETSPC), Universidad de La Laguna (ULL), Avda. Astrofísico Fco. Sánchez s/n, 38203 San Cristóbal de La Laguna, Tenerife, Spain
2
Red de Investigación Cooperativa en Enfermedades Tropicales (RICET), Universidad de Salamanca, 37008 Salamanca, Spain
3
Departamento de Obstetricia y Ginecología, Pediatría, Medicina Preventiva y Salud Pública, Toxicología, Medicina Legal y Forense y Parasitología, Universidad de La Laguna (ULL), 38200 San Cristóbal de La Laguna, Tenerife, Spain
4
Instituto de Física de São Carlos, Universidade de São Paulo, Caixa Postal 369, São Carlos 13560-590, SP, Brazil
*
Authors to whom correspondence should be addressed.
†
Both authors have contributed equally to this study.
Microorganisms 2021, 9(7), 1460; https://doi.org/10.3390/microorganisms9071460
Submission received: 16 June 2021 / Revised: 1 July 2021 / Accepted: 2 July 2021 / Published: 7 July 2021
(This article belongs to the Section Parasitology)
Browse Figures
Versions Notes

Abstract

:
Free-Living Amoebae (FLA) are widely distributed protozoa, which contain some groups considered as pathogenic microorganisms. These members are able to produce several opportunistic diseases including epithelial disorders, such as keratitis and fatal encephalitis. Even though they have been reported in numerous sources, such as soils, dust and water, there is no legislation related to the presence of these protozoa in soil-related environments worldwide. Therefore, there are no established prevention or disinfection protocols to advise the population regarding FLA infections or eliminate these microorganisms from human-related environments to date. Acanthamoeba spp. are the most common FLA isolated in soil samples, which is also the most common genera found in clinical cases. Thus, the aim of the present study was to evaluate the presence of potentially pathogenic FLA in human-related soil samples of Santiago Island, Cabo Verde. A total of 26 soil samples were seeded in non-nutrient agar plates (2%), incubated at 26 °C, and monitored daily to evaluate the presence of FLA. DNA was extracted from those plates on which there was suspected FLA growth, and PCR amplification of the 18S rRNA gene was carried out. A total of 17 from the 26 analysed samples were positive for FLA, where Acanthamoeba is the most abundant isolated genus (14/17; 82.4%), with the T4 genotype being the most common (13/14; 92.9%), followed by the T5 genotype, A. lenticulata (1/14; 7.1%). Moreover, Vermamoeba vermiformis, Stenamoeba dejonckheerei and Vannella pentlandi were isolated in three other samples. To the best of our knowledge, this is the first report of FLA presence in Cape Verde and the first report of V. vermiformis in beach sand worldwide.

Graphical Abstract

1. Introduction

Free-Living Amoeba (FLA) are ubiquitous protozoa reported in several different sources, such as soils, water, dust or air [1], which contribute to the microbiological population of the environment [2]. FLAs are a polyphyletic group, with stocks arising from different branches of the protozoal ancestral tree [1]. Amoebae are among the earliest eukaryotes, which have been studied since the discovery of the early microscope [3].
Acanthamoeba spp., N. fowleri, B. mandrillaris, S. pedata, Vahlkampfia spp., Paravahlkampfia spp. [1] and Vermamoeba spp. [4] have been described as FLAs which are able to produce several opportunistic diseases including epithelial disorders, such as keratitis, or fatal encephalitis. These pathogenic microorganisms depend on two phases in their life cycle: a vegetative and physiologically active trophozoite and a resistant phase called cyst [3]. However, some FLA genera possess a flagellated stage, such as N. fowleri [1].
The main FLA diet includes microorganisms such as fungi, protozoa and bacteria, as well as organic particles [5,6]. FLAs have been shown to act as reservoirs and transmission vectors for pathogenic bacteria which are capable of living within trophozoites or even cysts [7,8]. Several bacteria species have acquired resistance mechanisms to the FLA digestive enzymes (Amoeba-Resistant Bacteria (ARB)), using these protozoa as vehicles. Moreover, the cyst stage can favour the intracellular survival of bacteria, avoiding common water disinfection systems, but are non-effective against FLA cysts [7]. The high mortality of the FLA caused encephalitis and inefficacy of the current treatments and have created the need to increase knowledge of the pathogenic protozoa. Therefore, it is necessary to investigate their environmental niches and their ability to colonize human-related environments.
Cape Verde is an Atlantic archipelago country, located about 600 to 850 kilometres (320 to 460 nautical miles) west of Cap-Vert, situated at the westernmost point of continental Africa [9]. It consists of nine volcanic islands with a combined land area of about 4033 square kilometres (1557 sq mi), and forms part of the Macaronesia ecoregion, along with the Azores, the Canary Islands, Madeira, and the Savage Isles [10]. According to the National Institute of Statistics of Cape Verde (INE 2016), Santiago Island recorded the second highest population density of Cape Verde (301 inhabitants/Km2). The geographical location of Cape Verde archipelago is an arid and semi-arid, hot and dry climate, with scarce rainfall and an average annual temperature of 25 °C [10]. Cape Verde has few natural resources and only five of the nine main islands (Santiago, Santo Antão, São Nicolau, Fogo, and Brava) normally support significant agricultural production [11]. On the other hand, the number of tourists increased from approximately 45,000 in 1997 to more than 115,000 in 2001 and to over 765,000 in 2018, according to the Cape Verdean statistics bureau [12]. Therefore, in the present work, we aimed to evaluate the presence of pathogenic free-living amoeba in soil samples related to human activity in Santiago Island.

2. Materials and Methods

2.1. Sample Sites and Culture of FLA

A total of 26 soil samples were collected from different towns across Santiago Island in Cape Verde (15°04′40″ N 23°37′29″ O) (Figure 1). The evaluated soils corresponded to beach sand (5/26), garden soil (6/26) and crops soil (15/26). All samples were collected directly from the land using 15 mL sterile tubes in 2019. Samples were kept at 4 °C until further processing in the laboratory. The soil was placed directly into 2% of Non-Nutrient Agar (NNA) plates and incubated at 26 °C, then monitored them daily to evaluate the presence of FLA. Plates with suspected FLA growth, following the morphological features using the Page key [13], were cloned by dilution in NNA until a monoxenic culture was obtained [14,15,16].

2.2. DNA Extraction

In order to extract DNA from positive samples, 1–2 mL of amoebic culture suspensions were directly placed into a Maxwell® 16 tissue DNA purification kit sample cartridge (Promega, Madrid, Spain) following the manufacturer’s instructions, as has been described previously [18]. Amoebic genomic DNA yield and purity were determined using the DS-11 Spectro-photometer (DeNovix®, Wilmington, NC, USA).

2.3. PCR and Molecular Characterization of Isolates

PCR amplification of the 18S rRNA gene from the extracted DNA, was carried out using two universal primers for FLA: FLA-f 5′- CGCGGTAATTCCAGCTCCAATAGC -3′/FLA-r 5′- CAGGTTAAGGTCTCGTTCGTTAAC -3′ [19] (Tm = 62 °C) and Ame-f977 5′-GATYAGATACCGTCGTAGTC-3′ and Ame-r1534 5′-TCTAAGRGCATCACAGACCTG-3′ [20] (Tm = 55 °C), and for Acanthamoeba genus JDP-1f 5′- GGCCCAGATCGTTTACCGTGAA -3′ and JDP-2r 3′- TCTCACAAGCTGCTAGGGAGTCA -5′ [21] (Tm = 50 °C).
For FLA universal primers (FLA and Ame), PCRs’ amplification reactions were performed in a 50 μL mixture, containing 80 ng DNA and the 1U from the VWR Taq DNA Polymerase with 10x Key Buffer (15 mM MgCl2) kit. The PCR reactions were performed in 40 cycles with denaturation (95 °C, 30 s), annealing (FLAf/r 55 °C and Amef/r 62 °C, 30 s) and primer extension (72 °C, 30 s). However, in the case of Acanthamoeba spp. primers, the 50 μL PCR mixture contains 40 ng of DNA yield and the PCRs were performed in 35 cycles with denaturation (95 °C, 30 s), annealing (50 °C, 30 s) and primer extension (72 °C, 30 s). After the last cycles, the primer extension was maintained for 7 min at 72 °C. The expected amplicon length varies, at 500bp for JDP and Ame primers and 800bp for FLA primers. Amplification products from all PCRs were analyzed by electrophoresis through a 2% agarose gel and positive PCR products were sequenced using Macrogen Spain service (Avda. Sur del Aeropuerto, Madrid, Spain). Species identification was based on sequence homology analysis by comparison with the available DNA sequences in the Genbank database.

2.4. Phylogenetic Analyses

Mega X software program [22,23] was used for sequence alignment. The evolutionary history was inferred using the Neighbor-Joining method [24]. The evolutionary distances were computed using the Maximum Composite Likelihood method [22], and are shown in the units of the number of base substitutions per site. The analysis involved 23 nucleotide sequences: 15 sample sequences and 8 Genebank standard sequences. All ambiguous positions were removed for each sequence pair.

3. Results

From the total of 26 samples, 17 were positive for FLA growth in NNA and PCR (65.4%) (Table 1). Acanthamoeba spp. were the most abundantly isolated species, with a total of 14 samples (14/17; 82.4%), with the T4 genotype being the most common (13/14; 92.9%) followed by T5 genotype, A. lenticulata (CVS22) (1/14; 7.1%). Vermamoeba vermiformis, Stenamoeba dejonckheerei and Vannella pentlandi were isolated in samples of CVS3, CVS9, CVS10 respectively, with a 5.9% prevalence for each of them in our study (1/17).
The total FLA sequences obtained in the present report were deposited in the Genbank database under the accession numbers MT319991-MT320014 and presented ˃92% homology with the available DNA sequences in this database (Table 1). The evolutionary history was inferred using the Neighbor-Joining method [22]. The optimal tree for an isolated FLA phylogenetic relationship with the sum of branch length = 4.21659526 is shown in Figure 2. The isolates obtained in the present study are identified in boxes. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches [25]. The trees are drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. There were a total of 2231 positions in the final dataset. Evolutionary analyses were conducted in MEGA X [23].

4. Discussion

In the present study, we evaluated FLA prevalence in human-related environmental soils, such as beach sand, gardens or crop soils. These microorganisms are ubiquitous environmental protists, which have contributed enormously to the microbiological contamination of water sources [2]. The lack of effective antimicrobial therapy to treat amoebic infections and the difficultly diagnosing them makes FLA infections a cause for concern. Since many cases occur in immunocompromised hosts, it is also likely that large numbers of cases escape detection, particularly in developing countries of Africa and Southeast Asia, where HIV/AIDS remains at epidemic levels [1]. Cabo Verde belongs to the Macaronesia ecoregion, along with the Azores, the Canary Islands, Madeira, and the Savage Isles [10], but this archipelago is geographically part of Africa. FLAs are pathogenic protozoa which do not require a host organism to survive [5]. Therefore, over the last 40 years, they have been considered as an emerging group of opportunistic pathogens [7]. The presence of these pathogenic protozoa was only reported in the Macaronesia region in environmental [14,15,16,18,26,27,28,29,30,31,32,33,34] and clinical veterinary samples [35,36,37] of the Canary Islands. However, there has been no report of FLA in other Macaronesia regions to date. In the current study, we detected the presence of FLA in human-related soils of Santiago Island, Cabo Verde, with a relative presence of 65.4%, forming the total analyzed samples. The authors decided to use the rRNA 18s gene as target for molecular amplification due to these rRNA transcripts being indicative of ribosomes, not just ribosomal genes. Therefore, they are likely to be derived from metabolically active cells and can be considered as markers for living microorganisms [38].
The positive samples belong to human-related environments, such as garden soils, beach sand or crop spoils. Regarding the human use of these contexts, FLA forming these contaminated soils could easily enter the human body through the nose or eyes, which are the most common path of infection [7]. Interestingly, 82.4% of the positives belong to the Acanthamoeba genus, which is the most pathogenic and most common FLA group [4,7]. To date, 22 Acanthamoeba genotypes (T1-T22) have been described [39,40], with the T4 genotype being the most frequently identified in human infection cases [41] and environmental samples [42,43]. Our findings corroborated these previous reports. The most common pathology produced by Acanthamoeba spp. is the sight-threatening Acanthamoeba keratitis (AK), followed by the more-than-95%-mortal Granulomatous Amoebic Encephalitis (GAE) [4,7]. Moreover, in the crop soil sample CV22, we demonstrated the presence of Acanthamoeba spp. genotype T5. Despite genotype T5 still being categorized as only potentially pathogenic [44], there have been reports demonstrating its potential pathogenicity through its weak binding capacity to corneal cells in vitro [45], a cornea infection in the USA [46], and a case of disseminated cutaneous infection [47].
On the other hand, Vermamoeba vermiformis, Stenamoeba dejonckheerei and Vannella pentlandi were isolated in the present research work. The pathogenic potential of V. vermiformis is not only determined by its ability to produce an infection by itself [3,48,49], but also by its numerous reported relationships with pathogenic bacteria [50]. Recently, V. vermiformis has been considered as one of the most prevalent free-living amoebae, and it has been reported as a ubiquitous and thermotolerant amoeba [51]. This amoeba was reported as the causative agent of a painful ulcer adjacent to the eye and in a case of amoebic keratitis [52,53]. However, this is the first report of V. vermiformis in beach sand.
As with many other FLA, Vannella are commonly found in the human water supply [54,55], domestic appliances [56] or crops [57]. The cyst-producing soil amoeba Vannella pentlandii belongs to the sub-group within the genus, presently composed of V. placida, V. epipetala and V.fimicola (the PEF group) [58]. To date, there has been no indication of pathogenicity of Vannella spp. However, it can facilitate the growth of bacteria [50,59] including Legionella [60] or other human pathogenic organisms [61].
The genus Stenamoeba was first defined in 2007 [62], where it was demonstrated that the previously denoted taxa Platyamoeba stenopodia [13] was not correctly placed within the Vannellida, but was a member of the Thecamoebida [62,63]. Stenamoeba genus were isolated from animals, soil and water environments, such as drinking water plants, sediments from a rice field, or composting facilities, in several countries (Russia, Switzerland, Denmark, Canada, The Netherlands, Germany, Tibet and Tanzania) [42]. Although the presence of Stenamoeba spp. have been related to fresh-water reservoirs at 37 °C [64,65], to date, no pathogenicity has been associated with this genus [65]. Finally, in 2020, a previously undescribed species Stenamoeba dejonckheerei was reported by Borquez-Román and colleagues [66].

5. Conclusions

As Acanthamoeba was found in most of the isolates, the need for Cape Verde authorities to further study the presence of these parasites in human-related environments is enhanced. On the other hand, V. vermiformis and V. pentlandi represent a human health risk, which is not only determined by the ability to produce an infection by itself, in the case of the first one, but also by the capacity to harbour intracellular pathogenic bacteria for both genera. Moreover, to the best of our knowledge, this is the first report of potentially pathogenic FLA in Cape Verde.

Author Contributions

Conceptualization, D.S.-R., M.R.-B.; methodology, D.S.-R., M.R.-B., R.L.R.-E.; software, D.S.-R., M.R.-B., N.K.B.; validation, J.E.P., J.L.-M.; formal analysis, M.R.-B., N.K.B.; investigation, D.S.-R., M.R.-B., R.L.R.-E.; resources, J.E.P., J.L.-M.; data curation, D.S.-R., M.R.-B.; writing—original draft preparation, M.R.-B., R.L.R.-E.; writing—review and editing, M.R.-B., J.E.P., J.L.-M.; visualization, J.E.P., J.L.-M.; supervision, J.E.P., J.L.-M.; project administration, J.E.P., J.L.-M.; funding acquisition, J.E.P., J.L.-M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by Project PI18/01380 from Instituto de Salud Carlos III, Spain and RICET [RD16/0027/0001 project, from Programa Redes Temáticas de Investigación Cooperativa, FIS (Ministerio Español de Salud, Madrid, Spain), FEDER. D.S.-R. was founded by “Proyectos de Cooperación e Investigacion” (Cabildo Insular de Tenerife). M.R.-B. was funded by RICET. R.L.R.-E. was funded by a grant from the Agencia Canaria de Investigación, Innovación y Sociedad de la Información (ACIISI) cofunded by Fondo Social Europeo (FSE) y FEDER (TESIS2020010117).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Schuster, F.L.; Visvesvara, G.S. Free-living amoebae as opportunistic and non-opportunistic pathogens of humans and animals. Int. J. Parasitol. 2004, 34, 1001–1027. [Google Scholar] [CrossRef]
  2. Guimaraes, A.J.; Gomes, K.X.; Cortines, J.R.; Peralta, J.M.; Peralta, R.H. Acanthamoeba spp. as a universal host for pathogenic microorganisms: One bridge from environment to host virulence. Microbiol. Res. 2016, 193, 30–38. [Google Scholar] [CrossRef]
  3. Siddiqui, R.; Khan, N.A. Biology and pathogenesis of Acanthamoeba. Parasites Vectors 2012, 5. [Google Scholar] [CrossRef] [Green Version]
  4. Scheid, P.L.; Lâm, T.T.; Sinsch, U.; Balczun, C. Vermamoeba vermiformis as etiological agent of a painful ulcer close to the eye. Parasitol. Res. 2019, 118, 1999–2004. [Google Scholar] [CrossRef] [PubMed]
  5. Cateau, E.; Delafont, V.; Hechard, Y.; Rodier, M.H. Free-living amoebae: What part de they play in healthcare-associated infections? J. Hosp. Infec. 2014, 87, 131–140. [Google Scholar] [CrossRef]
  6. Schulz-Bohm, K.; Geisen, S.; Wubs, E.R.J.; Song, C.; de Boer, W.; Garbeva, P. The prey’s scent—Volatile organic compound mediated interactions between soil bacteria and their protist predators. ISME J. 2017, 11, 817–820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Lorenzo-Morales, J.; Khan, N.A.; Walochnik, J. An update on Acanthamoeba keratitis: Diagnosis, pathogenesis and treatment. Parasite 2015, 22, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Mella, C.; Medina, G.; Flores-Martin, S.; Toledo, Z.; Simaluiza, R.J.; Pérez-Pérez, G.; Fernández, H. Interaction between zoonotic bacteria and free living amoebas: A new angle of an epidemiological polyhedron of public health importance? Arch. Med. Vet. 2016, 48, 1–10. [Google Scholar] [CrossRef]
  9. Neto, C.; Costa, J.C.; Figueiredo, A.; Capelo, J.; Gomes, I.; Vitória, S.; Semedo, J.M.; Lopes, A.; Dinis, H.; Correia, E.; et al. The Role of Climate and Topography in Shaping the Diversity of Plant Communities in Cabo Verde Islands. Diversity 2020, 12, 80. [Google Scholar] [CrossRef] [Green Version]
  10. Freire, S.M.; Relvas, H.; Lopes, M. Impact of traffic emissions on air quality in Cabo Verde. Environ. Monit. Assess. 2020, 192, 726. [Google Scholar] [CrossRef]
  11. Ferreira Couto, C. Incerteza, Adaptabilidade e Inovação na Sociedade Rural da Ilha de Santiago de Cabo Verde; Fundação Galouste Gulbenkian: Lisbon, Portugal, 2010; Volume XXV, 461p. [Google Scholar]
  12. Berlitz Pocket Guide Cape Verde, 3rd revised ed.; Berlitz Travel, 2018; ISBN 978-1785730627.
  13. Page, F.C. Mitosis and pseudopod formation in Vexillifera bacillipedes n. sp.; A majorellid amoeba. Trans. Am. Microsc. Soc. 1969, 88, 394–400. [Google Scholar] [CrossRef]
  14. Lorenzo-Morales, J.; Monteverde-Miranda, C.A.; Jiménez, C.; Tejedor, M.L.; Valladares, B.; Ortega-Rivas, A. Evaluation of Acanthamoeba isolates from environmental sources in Tenerife, Canary Islands, Spain. Ann. Agric. Environ. Med. 2005, 12, 233–236. [Google Scholar] [PubMed]
  15. Lorenzo-Morales, J.; Ortega-Rivas, A.; Foronda, P.; Martínez, E.; Valladares, B. Isolation and identification of pathogenic Acanthamoeba strains in Tenerife, Canary Islands, Spain from water sources. Parasitol. Res. 2005, 95, 273–277. [Google Scholar] [CrossRef]
  16. Reyes-Batlle, M.; Niyyati, M.; Martín-Navarro, C.M.; López-Arencibia, A.; Valladares, B.; Martínez-Carretero, E.; Piñero, J.E.; Lorenzo-Morales, J. Unusual Vermamoeba vermiformis strain isolated from snow in Mount Teide, Tenerife, Canary Islands, Spain. Nov. Biomed. 2015, 3, 189–192. [Google Scholar] [CrossRef]
  17. Alves, J.; Roque, A.L.; Cravo, P.; Valdez, T.; Jelinek, T.; Rosário, V.E.; Arez, A.P. Epidemiological characterization of Plasmodium falciparum in the Republic of Cabo Verde: Implications for potential large-scale re-emergence of malaria. Malar. J. 2006, 5, 32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Reyes-Batlle, M.; Zamora-Herrera, J.; Vargas-Mesa, A.; Valerón-Tejera, M.A.; Wagner, C.; Martín-Navarro, C.M.; López-Arencibia, A.; Sifaoui, I.; Martínez-Carretero, E.; Valladares, B.; et al. Acanthamoeba genotypes T2, T4, and T11 in soil sources from El Hierro island, Canary Islands, Spain. Parasitol. Res. 2016, 115, 2953–2956. [Google Scholar] [CrossRef] [PubMed]
  19. Tsvetkova, N.; Schild, M.; Panaiotov, S.; Kurdova-Mintcheva, R.; Gottstein, B.; Walochnik, J.; Aspöck, H.; Lucas, M.S.; Müller, N. The identification of free-living environmental isolates of amoebae from Bulgaria. Parasit. Res. 2004, 92, 405–413. [Google Scholar] [CrossRef] [Green Version]
  20. Liang, S.Y.; Ji, D.R.; Hsia, K.T.; Hung, C.C.; Sheng, W.H.; Hsu, B.M.; Chen, J.S.; Wu, M.H.; Lai, C.H.; Ji, D.D. Isolation and identification of Acanthamoeba species related to amoebic encephalitis and nonpathogenic free-living amoeba species from the rice field. J. Appl. Microbiol. 2010, 109, 1422–1429. [Google Scholar] [CrossRef]
  21. Schroeder, J.M.; Booton, G.C.; Hay, J. Use of subgenic 18S ribosomal DNA PCR and sequencing for genus and genotype identification of Acanthamoebae from humans with keratitis and from sewage sludge. J. Clin. Microbiol. 2001, 39, 1903–1911. [Google Scholar] [CrossRef] [Green Version]
  22. Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef] [Green Version]
  23. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  24. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
  25. Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [PubMed]
  26. Lorenzo-Morales, J.; López-Darias, M.; Martínez-Carretero, E.; Valladares, B. Isolation of potentially pathogenic strains of Acanthamoeba in wild squirrels from the Canary Islands and Morocco. Exp. Parasitol. 2007, 117, 74–79. [Google Scholar] [CrossRef] [PubMed]
  27. De Jonckheere, J.F. Isolation and Molecular Identification of Vahlkampfiid Amoebae from an Island (Tenerife, Spain). Acta Protozool. 2006, 45, 91–96. [Google Scholar]
  28. Dyková, I.; Lorenzo-Morales, J.; Kostka, M.; Valladares, B.; Pecková, H. Neoparamoeba branchiphila infections in moribund sea urchins Diadema aff. antillarum in Tenerife, Canary Islands, Spain. Dis. Aquat. Organ. 2011, 95, 225–231. [Google Scholar] [CrossRef] [PubMed]
  29. Reyes-Batlle, M.; Todd, C.D.; Martín-Navarro, C.M.; López-Arencibia, A.; Cabello-Vilchez, A.M.; González, A.C.; Córdoba-Lanús, E.; Lindo, J.F.; Valladares, B.; Piñero, J.E.; et al. Isolation and characterization of Acanthamoeba strains from soil samples in Gran Canaria, Canary Islands, Spain. Parasitol. Res. 2014, 113, 1383–1388. [Google Scholar] [CrossRef] [PubMed]
  30. Reyes-Batlle, M.; Wagner, C.; Zamora-Herrera, J.; Vargas-Mesa, A.; Sifaoui, I.; González, A.C.; López-Arencibia, A.; Valladares, B.; Martínez-Carretero, E.; Piñero, J.E.; et al. Isolation and Molecular Identification of Vermamoeba vermiformis Strains from Soil Sources in El Hierro Island, Canary Islands, Spain. Curr. Microbiol. 2016, 73, 104–107. [Google Scholar] [CrossRef] [PubMed]
  31. Reyes-Batlle, M.; Wagner, C.; Zamora-Herrera, J.; Vargas-Mesa, A.; Sifaoui, I.; González, A.C.; López-Arencibia, A.; Valladares, B.; Martínez-Carretero, E.; Piñero, J.E.; et al. Isolation of thermotolerant Vermamoeba vermiformis strains from water sources in Lanzarote Island, Canary Islands, Spain. Acta Parasitol. 2016, 61, 650–653. [Google Scholar] [CrossRef]
  32. Reyes-Batlle, M.; Hernández-Piñero, I.; Rizo-Liendo, A.; López-Arencibia, A.; Sifaoui, I.; Bethencourt-Estrella, C.J.; Chiboub, O.; Valladares, B.; Piñero, J.E.; Lorenzo-Morales, J. Isolation and molecular identification of free-living amoebae from dishcloths in Tenerife, Canary Islands, Spain. Parasitol. Res. 2019, 118, 927–933. [Google Scholar] [CrossRef] [PubMed]
  33. Reyes-Batlle, M.; Rizo-Liendo, A.; Viera-Santana, R.A.; Afonso-Morales, S.; López-Arencibia, A.; Sifaoui, I.; Chiboub, O.; Bethencourt-Estrella, C.J.; San Nicolás-Hernández, D.; Rodríguez-Expósito, R.L.; et al. Isolation and molecular identification of Naegleria australiensis in irrigation water of Fuerteventura Island, Spain. Acta Parasitol. 2019, 64, 331–335. [Google Scholar] [CrossRef]
  34. Reyes-Batlle, M.; Díaz, F.J.; Sifaoui, I.; Rodríguez-Expósito, R.; Rizo-Liendo, A.; Piñero, J.E.; Lorenzo-Morales, J. Free living amoebae isolation in irrigation waters and soils of an insular arid agroecosystem. Sci. Total Environ. 2021, 753, 141833. [Google Scholar] [CrossRef]
  35. Lorenzo-Morales, J.; Valladares, M.; Sancho, J.; Reyes-Batlle, M.; Martin-Navarro, C.M.; Lopez-Arencibia, A.; Gonzalez, A.C.; Lopez-Medina, L.; Piñero, J.E.; Martinez-Carretero, E.; et al. First report of a case of prostatitis due to Acanthamoeba in a dog. Acta Protozool. 2013, 52, 325–329. [Google Scholar] [CrossRef]
  36. Valladares, M.; Reyes-Batlle, M.; Mora-Peces, I.; Martín-Navarro, C.M.; López-Arencibia, A.; Dorta-Gorrín, A.; Comyn-Afonso, E.; Martínez-Carretero, E.; Maciver, S.K.; Piñero, J.E.; et al. A multisystemic Acanthamoeba infection in a dog in Tenerife, Canary Islands, Spain. Vet. Parasitol. 2014, 205, 707–711. [Google Scholar] [CrossRef]
  37. Valladares, M.; Reyes-Batlle, M.; Martín-Navarro, C.M.; López-Arencibia, A.; Dorta-Gorrín, A.; Wagner, C.; Martínez-Carretero, E.; Piñero, J.E.; Valladares, B.; Lorenzo-Morales, J. Molecular characterization of Acanthamoeba strains isolated from domestic dogs in Tenerife, Canary Islands, Spain. Arch. Microbiol. 2015, 197, 639–643. [Google Scholar] [CrossRef]
  38. Petters, S.; Groß, V.; Söllinger, A.; Pichler, M.; Reinhard, A.; Bengtsson, M.M.; Urich, T. The soil microbial food web revisited: Predatory myxobacteria as keystone taxa? ISME J. 2021. [Google Scholar] [CrossRef] [PubMed]
  39. Corsaro, D.; Walochnik, J.; Kohsler, M.; Rott, M.B. Acanthamoeba misidentifcation and multiple labels: Redefning genotypes T16, T19, and T20 and proposal for Acanthamoeba micheli sp. nov. (genotype T19). Parasitol. Res. 2015, 114, 2481–2490. [Google Scholar] [CrossRef] [PubMed]
  40. Fuerst, P.A.; Booton, G.C. Species, Sequence Types and Alleles: Dissecting Genetic Variation in Acanthamoeba. Pathogens 2020, 9, 534. [Google Scholar] [CrossRef] [PubMed]
  41. Omaña-Molina, M.; Vanzzini-Zago, V.; Hernandez-Martinez, D.; Gonzalez-Robles, A.; Salazar-Villatoro, L.; Ramirez-Flores, E.; Oregon-Miranda, E.; Lorenzo-Morales, J.; Martinez-Palomo, A. Acanthamoeba genotypes T3 and T4 as causative agents of amoebic keratitis in Mexico. Parasitol. Res. 2016, 115, 873–878. [Google Scholar] [CrossRef]
  42. Castro-Artavia, E.; Retana-Moreira, L.; Lorenzo-Morales, J.; Abrahams-Sandi, E. Potentially pathogenic Acanthamoeba genotype T4 isolated from dental units and emergency combination showers. Memórias Inst. Oswaldo Cruz. 2017, 112, 817–821. [Google Scholar] [CrossRef] [Green Version]
  43. Geisen, S.; Koller, R.; Hünninghaus, M.; Dumack, K.; Urich, T.; Bonkowski, M. The soil food web revisited: Diverse and widespread mycophagous soil protists. Soil Biol. Biochem. 2016, 94, 10–18. [Google Scholar] [CrossRef]
  44. Twafeek, G.M.; Biahara, S.A.H.; Sarhan, R.M.; Taher, E.E.; Khayyal, A.E. Genotypic, physiological, and biochemical characterization of potentially pathogenic Acanthamoeba isolated from environment in Cairo, Egypt. Parasitol. Res. 2016, 115, 1871–1881. [Google Scholar] [CrossRef]
  45. Khan, N.A. The pathogenesis of Acanthamoeba infections: Current status and future implications. Microb. Pathog. 2003, 34, 277–285. [Google Scholar] [CrossRef]
  46. Leede, D.R.; Lovieno, A.; Miller, D.; Mandal, N.; Diaz, M.; Fell, J.; Fini, M.E.; Alfonso, E.C. Molecular identification of T4 and T5 genotypes in isolates from Acanthamoeba keratitis patients. J. Clin. Microbiol. 2009, 47, 1458–1462. [Google Scholar] [CrossRef] [Green Version]
  47. Barete, S.; Combes, A.; De Jomcheere, J.; Datry, A.; Varnous, S.; Martinez, V.; Ptacek, S.G.; Caumes, E.; Capron, F.; Frances, C.; et al. Fatal disseminated Acanthamoeba lenticulata acanthamebiasis in a heart transplant patient. Emerg. Infect. Dis. 2007, 13, 736–738. [Google Scholar] [CrossRef]
  48. Centeno, M.; Rivera, F.; Cerva, L.; Tsutsumi, V.; Gallegos, E.; Calderón, A.; Ortiz, R.; Bonilla, P.; Ramírez, E.; Suárez, G. Hartmannella vermiformis isolated from the cerebrospinal fluid of a young male patient with meningoencephalitis and bronchopneumonia. Arch. Med. Res. 1996, 27, 579–586. [Google Scholar]
  49. Delafont, V.; Rodier, M.H.; Maisonneuve, E.; Cateau, E. Vermamoeba vermiformis: A Free-Living Amoeba of Interest. Microbial. Ecol. 2018, 76, 991–1001. [Google Scholar] [CrossRef]
  50. Loret, J.F.; Jousset, M.; Robert, S.; Saucedo, G.; Ribas, F.; Thomas, V.; Greub, G. Amoebae-resisting bacteria in drinking water: Risk assessment and management. Water Sci. Tech. 2008, 58, 571–577. [Google Scholar] [CrossRef]
  51. Siddiqui, R.; Makhlouf, Z.; Khan, N.A. The Increasing Importance of Vermamoeba vermiformis. J. Eukaryot. Microbiol. 2021, e12857. [Google Scholar] [CrossRef]
  52. Abedkhojasteh, H.; Niyyati, M.; Rahimi, F.; Heidari, M.; Farnia, S.; Rezaeian, M. First Report of Hartmannella keratitis in a Cosmetic Soft Contact Lens Wearer in Iran. Iran. J. Parasitol. 2013, 8, 481–485. [Google Scholar] [PubMed]
  53. Scheid, L.P. Vermamoeba vermiformis-A free-living Amoeba with public health and environmental health significance. Open Parasitol. J. 2019, 7. [Google Scholar] [CrossRef]
  54. Thomas, V.; Loret, J.-F.; Jousset, M.; Greub, G. Biodiversity of amoebae and amoebae-resisting bacteria in a drinking water treatment plant. Environ. Microbiol. 2008, 10, 2728–2745. [Google Scholar] [CrossRef]
  55. Poitelon, J.-B.; Joyeux, M.; Welte, B.; Duguet, J.-P.; Peplies, J.; DuBow, M.S. Identification and phylogeny of eukaryotic 18S rDNA phylotypes detected in chlorinated finished drinking water samples from three Parisian surface water treatment plants. Lett. Appl. Microbiol. 2009, 49, 589–595. [Google Scholar] [CrossRef]
  56. Rivera, F.; Ramírez, E.; Bonilla, P.; Calderon, A.; Gallegos, E.; Rodríguez, S.; Ortiz, R.; Zaldívar, B.; Ramírez, P.; Duran, A. Pathogenic and free living amoebae isolated from swimming pools and physiotherapy tubs in Mexico. Environ. Res. 1993, 62, 43–52. [Google Scholar] [CrossRef]
  57. Chavatte, N.; Lambrecht, E.; Van Damme, I.; Sabbe, K.; Houf, K. Abundance, diversity and community composition of free-living protozoa on vegetable sprouts. Food Microbiol. 2016, 55, 55–63. [Google Scholar] [CrossRef]
  58. Maciver, S.K.; De Obeso Fernandez Del Valle, A.; Koutsogiannis, Z. Vannella pentlandii n. sp.; (Amoebozoa, Discosea, Vannellida) a small, cyst-forming soil amoeba. Exp. Parasitol. 2017, 183, 109–116. [Google Scholar] [CrossRef] [Green Version]
  59. Schulz, F.; Tyml, T.; Pizzetti, I.; Dykova, I.; Fazi, S.; Kostka, M.; Horn, M. Marine amoebae with cytoplasmic and perinuclear symbionts deeply branching in the Gammaproteobacteria. Sci. Rep. 2015, 5, 13381. Available online: https://pubmed.ncbi.nlm.nih.gov/26303516/ (accessed on 7 July 2021). [CrossRef] [Green Version]
  60. Kuroki, T.; Yagita, K.; Yabuuchi, E.; Agata, K.; Ishima, T.; Katsube, Y.; Endo, T. Kansenshogaku zasshi. JJID 1998, 72, 1050–1055. [Google Scholar] [CrossRef] [Green Version]
  61. Scheid, P. Mechanism of intrusion of a microspordian-like organism into the nucleus of host amoebae (Vannella sp.) isolated from a keratitis patient. Parasitol. Res. 2007, 101, 1097–1102. [Google Scholar] [CrossRef]
  62. Smirnov, A.V.; Nassonova, E.S.; Chao, E.; Cavalier-Smith, T. Phylogeny, Evolution, and Taxonomy of Vannellid Amoebae. Protist 2007, 158, 295–324. [Google Scholar] [CrossRef]
  63. Adl, S.M.; Bass, D.; Lane, C.E.; Lukeš, J.; Schoch, C.L.; Smirnov, A.; Agatha, S.; Berney, C.; Brown, M.W.; Burki, F.; et al. Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes. J. Eukaryot. Microbiol. 2019, 66, 4–119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Gianinazzi, C.; Schild, M.; Zumkehr, B.; Wuthrich, F.; Nuesch, I.; Ryter, R.; Schurch, N.; Gottstein, B.; Muller, N. Screening of Swiss hot spring resorts for potentially pathogenic free-living amoebae. Exp. Parasitol. 2010, 126, 45–53. [Google Scholar] [CrossRef] [PubMed]
  65. Lares-Jiménez, L.F.; Borquez-Román, M.A.; Lares-García, C.; Otero-Ruiz, A.; Gonzalez-Galaviz, J.R.; Ibarra-Gámez, J.C.; Lares-Villa, F. Potentially pathogenic genera of free-living amoebae coexisting in a thermal spring. Exp. Parasitol. 2018, 195, 54–58. [Google Scholar] [CrossRef]
  66. Borquez-Román, M.A.; Lares-Jiménez, L.F.; Rodriguez-Anaya, L.Z.; Gonzalez-Galaviz, J.R.; Fuerst, P.A.; Ibarra-Gámez, J.C.; Casillas-Hernández, R.; Lares-Villa, F. Stenamoeba dejonckheerei sp. nov.; a Free-Living Amoeba Isolated from a Thermal Spring. Pathogens 2020, 9, 586. [Google Scholar] [CrossRef]
Microorganisms 09 01460 g001 550
Figure 1. Geographical localization of the Cape Verde Archipelago and Santiago Island. Adapted from [17].
Figure 1. Geographical localization of the Cape Verde Archipelago and Santiago Island. Adapted from [17].
Microorganisms 09 01460 g001
Microorganisms 09 01460 g002 550
Figure 2. Original tree representing the evolutionary relationships of taxa carried out by the Neighbor-Joining method [22]. Phylogenetic relationship of the Amoebozoa strains isolated in the present study. The percentage of replicate trees, in which the associated taxa clustered together in the bootstrap test, are shown next to the branches [13]. The isolates obtained in the present study are identified in boxes.
Figure 2. Original tree representing the evolutionary relationships of taxa carried out by the Neighbor-Joining method [22]. Phylogenetic relationship of the Amoebozoa strains isolated in the present study. The percentage of replicate trees, in which the associated taxa clustered together in the bootstrap test, are shown next to the branches [13]. The isolates obtained in the present study are identified in boxes.
Microorganisms 09 01460 g002
Table
Table 1. Report of the FLA species isolated from environmental soils of Cape Verde (NNA: FLA growth in non-nutrient agar culture; PCR: FLA detection by PCR;bp: base pairs; * Homology (%) related to NCBI Data Base sequence).
Table 1. Report of the FLA species isolated from environmental soils of Cape Verde (NNA: FLA growth in non-nutrient agar culture; PCR: FLA detection by PCR;bp: base pairs; * Homology (%) related to NCBI Data Base sequence).
Sample CodeLocalitySoil TypeNNAPCRIsolate SpecieSeq Length (bp)Identity (%) *Sequence ID BLASTn
CVS1Varzea, PraiaGarden++Acanthamoeba sp. T4412>99%MN153014.1
CVS2Santa CruzGarden++Acanthamoeba sp. T4368>92%MN239986.1
CVS3Camboinha, PraiaBeach++Vermamoeba vermiformis422>99%MK202435.1
CVS9PraiaGarden++Stenamoeba dejonckheerei200>96%MT386405.1
CVS10Palmarejo, PraiaGarden++Vannella pentlandi189>95%KY344796.1
CVS11Palmarejo, PraiaGarden++Acanthamoeba sp. T4276>95%MT613705.1
CVS14Santa CruzCrop++Acanthamoeba sp. T4414>95%KU936118.1
CVS16Santa CruzCrop++Acanthamoeba sp. T4412100%LC373015.1
CVS17Santa CruzCrop++Acanthamoeba sp. T4246>95%MK390856.1
CVS19Santa CruzCrop++Acanthamoeba sp. T4403>99%JQ418500.1
CVS20Santa CruzCrop++Acanthamoeba sp. T4406>99%MN700306.1
CVS21Santa CruzCrop++Acanthamoeba sp. T4437>98%GU808328.1
CVS22Santa CruzCrop++Acanthamoeba lenticulata T5363>99%KM189378.1
CVS23Santa CruzCrop++Acanthamoeba sp. T4427>98%MT645313.1
CVS24Santa CruzCrop++Acanthamoeba sp. T4406100%JF702882.1
CVS25Santa CruzCrop++Acanthamoeba sp. T4408>95%KY827390.1
CVS26Santa CruzCrop++Acanthamoeba sp. T4315100%MT613705.1
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sousa-Ramos, D.; Reyes-Batlle, M.; Bellini, N.K.; Rodríguez-Expósito, R.L.; Piñero, J.E.; Lorenzo-Morales, J. Free-Living Amoebae in Soil Samples from Santiago Island, Cape Verde. Microorganisms 2021, 9, 1460. https://doi.org/10.3390/microorganisms9071460

AMA Style

Sousa-Ramos D, Reyes-Batlle M, Bellini NK, Rodríguez-Expósito RL, Piñero JE, Lorenzo-Morales J. Free-Living Amoebae in Soil Samples from Santiago Island, Cape Verde. Microorganisms. 2021; 9(7):1460. https://doi.org/10.3390/microorganisms9071460

Chicago/Turabian Style

Sousa-Ramos, Djeniffer, María Reyes-Batlle, Natália K. Bellini, Rubén L. Rodríguez-Expósito, José E. Piñero, and Jacob Lorenzo-Morales. 2021. "Free-Living Amoebae in Soil Samples from Santiago Island, Cape Verde" Microorganisms 9, no. 7: 1460. https://doi.org/10.3390/microorganisms9071460

APA Style

Sousa-Ramos, D., Reyes-Batlle, M., Bellini, N. K., Rodríguez-Expósito, R. L., Piñero, J. E., & Lorenzo-Morales, J. (2021). Free-Living Amoebae in Soil Samples from Santiago Island, Cape Verde. Microorganisms, 9(7), 1460. https://doi.org/10.3390/microorganisms9071460

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop