Next Article in Journal
Sequence Stratigraphy of the Jurassic Strata and Occurrences of Potential Sandstone Reservoirs in the ST Gas Field, Northern West Siberia Basin
Previous Article in Journal
Absorption–Translocation of Veterinary Antibiotics in Rice Plants Introduced with Irrigation Water
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 13
Issue 22
10.3390/app132212095
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biocompatibility and Osteo/Odontogenic Potential of Various Bioactive Root-End Filling Materials

by
Pinar Ercal
1 and
Soner Sismanoglu
2,*
1
Faculty of Dentistry, Eastern Mediterranean University, North Cyprus via Mersin 10, Famagusta 99628, Turkey
2
Faculty of Dentistry, Department of Restorative Dentistry, Istanbul University-Cerrahpasa, Istanbul 34098, Turkey
*
Author to whom correspondence should be addressed.
Appl. Sci. 2023, 13(22), 12095; https://doi.org/10.3390/app132212095
Submission received: 12 October 2023 / Revised: 3 November 2023 / Accepted: 4 November 2023 / Published: 7 November 2023
(This article belongs to the Section Applied Dentistry and Oral Sciences)
Browse Figures
Versions Notes

Abstract

:
This in vitro study aimed to investigate if different bioactive root-end filling materials can promote osteo/odontogenic differentiation of mesenchymal stem cells (MSCs) and support their viability. MSCs from porcine tooth germs were isolated. Cells were exposed to extracts from MTA Angelus, BIOfactor MTA, Medcem MTA, Well-Root ST, and Pure Portland Cement for 7 days. Viability was determined with MTS and live/dead assay. Osteo/odontogenic differentiation was evaluated with alkaline phosphatase (ALP) activity and quantitative real-time PCR (RUNX2, DMP-1, and DSPP genes) which were compared with osteo/odontogenic-induced MSCs and non-treated cells. All the tested materials supported cell proliferation and cells maintained their viability after 7 days. Osteo/odontogenic differentiation of MSCs was promoted by the tested materials in varying levels as demonstrated by increased ALP activity and upregulation of related gene markers in comparison to the control group. Pure Portland Cement demonstrated a continuous high ALP activity on day 7, showing the highest value among all materials and significantly increased in comparison to the control group (p < 0.001). Significant RUNX2 expression and high ALP activity (p < 0.001) similar to that of osteogenically induced cells was detected for Pure Portland Cement after 7 days. Tested MTA-based cement materials are biocompatible and induce osteo/odontogenic differentiation in vitro. MTA materials performed similarly to Pure Portland Cement regarding osteo/odontogenic differentiation.

1. Introduction

First introduced to the market in 1993, mineral trioxide aggregate (MTA) is developed for root repair and can be used for both non-surgical and surgical interventions, such as root-end filling, vital pulp therapy, pulp capping, root, and furcation perforation repair, and apexification. The composition of MTA materials includes tricalcium silicate, dicalcium silicate, calcium sulfate dihydrate, calcium aluminoferrite, and tricalcium after mixing raw materials of MTA [1]. MTA is derived from Portland cement, and the main difference is the presence of bismuth oxide and lack of potassium in MTA [2]. Although similar in some characteristics, MTA and Portland cement are unlike as MTA products have comparatively smaller particle sizes and include fewer heavy metals, with implications of lesser inflammatory and allergic reactions [3]. However, a previous in vitro study on the biocompatibility of MTA and Portland cement indicated similar cytotoxic effects on cells and failed to detect DNA damage after exposure to the tested treatment conditions [4,5]. Minimal inflammatory response and bone healing were demonstrated in vivo, with a similar response and good toleration towards MTA and Portland cement [6]. Considering the successful results of several investigations, Portland cement can be rendered as a reasonable alternative for MTA in permanent teeth with the advantage of its low cost [7,8].
With the aim of overcoming the disadvantages of MTA, a wide range of bioactive cements with variations in composition are introduced to the market, offering similar properties to MTA with fewer drawbacks [1]. Among MTA-based materials, ProRoot MTA was the first available MTA product, which was followed by MTA Angelus with a reduced setting time due to its decreased calcium sulfate concentration [9]. Nowadays, various MTA materials are offered in the market with different qualities regarding their setting time, color properties, or ease of handling to enhance their clinical properties. Medcem MTA (Medcem GmbH, Weinfelden, Switzerland) is a second-generation MTA that comprises Pure Portland Cement (Medcem GmbH, Weinfelden, Switzerland) with a color-stable X-ray contrast media, zirconium oxide, according to the product manual. Pure Portland Cement is similar in content except for an additional X-ray opaque ingredient, with a slightly higher hardness according to the manufacturer. Well-Root ST (Vericom, Chuncheon-si, Gangwon-Do, Republic of Korea) is a novel bioceramic root canal sealer presented in the form of a premixed injectable bioactive paste with ease of use. Recently, it was reported that Well-Root ST is an appropriate alternative to ProRoot MTA and Biodentine due to its superior angiogenesis potential as indicated by better vascularization [10]. There are still limited data available on its properties and its interactions in the scientific literature. BIOfactor MTA (Imicryl Dental, Konya, Turkey) is another bioactive material consisting of tricalcium silicate without bismuth but includes ytterbium oxide as a radiopacifier.
The wide range of choices poses a challenge to clinicians as it is difficult to recognize the differences between these products. Hence, extensive investigations into their specific characteristics and behaviors may improve the understanding of the biological properties of these materials to give some insight to the clinician when making a valid clinical decision. To the best of our knowledge, there is no study available comparing the aforementioned bioactive MTA-based materials in terms of their biocompatibility and osteo/odontogenic differentiation potential. Therefore, the main aim of the present study was to evaluate the cell viability and osteo/odontogenic responses of MSCs derived from tooth germs when exposed to various MTA-based materials. Two null hypotheses were tested: (1) MTA-based materials would not interfere with the viability of stem cells and (2) all tested bioactive materials would support osteo/odontogenic differentiation of stem cells similarly.

2. Materials and Methods

Impacted third molars were obtained from porcine sources after ethical clearance (HDK-2016/39) of the Animal Ethics Committee of Acibadem University. Isolation of MSCs from germ tissues was performed as described previously [11]. Established MSCs were incubated in the growth medium which comprised MEMα (Gibco, Grand Island, NY, USA), 10% FBS (Gibco, Grand Island, NY, USA), and 100 u/mL Penicillin-Streptomycin-Amphotericin (PSA) solution (Pan Biotech, Aidenbach, Germany) at 37 °C, in a 90% humidified atmosphere of 5% CO2. Cells were sub-cultured until 3rd passage to be used in the experiments and the medium was changed every other day. Flow cytometry was used to analyze the surface antigen profiles of the cells and data were reported previously [12].

2.1. Preparation of Material Extracts

Five bioactive materials, including Medcem MTA, MTA Angelus, BIOfactor MTA, Well-Root ST, and Pure Portland Cement were tested in the present study (Table 1). MTA materials and Pure Portland Cement were prepared by mixing powder and liquid according to manufacturers’ instructions while Well-Root ST did not require any preparation as it was pre-mixed supplied in syringes. Samples were prepared as discs 5 mm in diameter and 3 mm thick in pre-sterilized Teflon® molds in a laminar flow under aseptic conditions using the manufacturer’s recommendations. Material extracts were prepared as previously described [13]. All prepared samples were incubated at 37 °C for 6 h. Samples were exposed to UV light at room temperature for 1 h. After sterilization, sample discs were submerged into 1 mL of growth medium and kept in a 90% humidified atmosphere of 5% CO2 for a day. The next day, each collected extract was filtered through sterile filters with 0.22 µm pores. The extract containing media was diluted 1 to 10 with growth medium for each experiment.

2.2. Cell Viability Assay

Cells were seeded at 10,000 cells/well for 96-well plates in 200 µL of growth medium. Plates were incubated in an incubator at 37 °C with 5% CO2 overnight for cell adherence. The next day, MSCs were exposed to 200 µL of extract solutions diluted in growth medium, and a control group was included with cells incubated only in growth medium. An osteogenic group was determined for the positive control of osteo/odontogenic differentiation in which the cells were cultured in osteogenic medium (DMEM with low glucose containing 10% FBS, 1% PSA, 50 μM ascorbic acid, 10 nM dexamethasone, and 10 nM ß-glycerophosphate). CellTiter 96® Aqueous One Solution Cell Proliferation Assay (MTS, Promega, Madison, WI, USA) was used to measure cell viability according to the manufacturer’s instructions on days 1, 3, and 7 of cell culture. Absorbance was determined with an ELISA Plate Reader (Varioskan LUX, Thermo Fisher Scientific, Waltham, MA, USA) at 490 nm. The reading of the control group was adjusted as 100% to calculate the viability in test groups accordingly. Each group was worked in triplicates.

2.3. Live/Dead Assay

The LIVE/DEAD® Viability/Cytotoxicity Kit (Thermo Fisher Scientific, USA) for mammalian cells was used to assess the viability of cells. This assay determines cell functions of live and dead cells by staining intracellular esterase activity with green fluorescent calcein-AM and loss of plasma membrane integrity with red-fluorescent ethidium homodimer-1. MSCs were seeded at 20,000/well in 24-well plates in growth medium and incubated overnight. The next day, cells were treated with extract solutions, growth medium, and osteogenic medium as controls. All media was refreshed twice a week. Viability was assessed on days 1, 3, and 7 of cell culture with prepared reagent solutions according to the manufacturer’s instructions. Stained cells were observed under the fluorescence microscope (Nikon, Eclipse TC100, Tokyo, Japan).

2.4. Alkaline Phosphatase Activity

Cells were seeded at 20,000 cells/well in 24-well plates in growth medium and incubated overnight to allow cell adhesion. After 24 h, cells were incubated with extract solutions, and control groups were also determined with osteogenic and growth medium. All media was refreshed twice a week. ALP activity was measured with SigmaFast p-nitrophenyl phosphate tablets (Sigma-Aldrich, St. Louis, MO, USA) on days 1, 3, and 7 of incubation. After washing of cells, the active solution was added to the wells, and the plates were incubated at room temperature in the dark for 1 h. Absorbance was measured with an ELISA Plate Reader (Varioskan LUX, Thermo Fisher Scientific, USA) and readings were converted to moles with a calibration curve set with known moles of ALP.

2.5. Quantitative Real-Time PCR

Total RNA from cells treated with each material was isolated by using GeneJet RNA Purification Kit (Thermo Scientific, Vilnius, Lithuania) on days 1, 3, and 7 of cell culture. Following RNA measurement, cDNA was synthesized with an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA) following the manufacturer’s instructions. Relative gene expression levels for Runt-related transcription factor 2 (RUNX2), Dentin matrix protein-1 (DMP-1), and Dentin sialophosphoprotein (DSPP) were determined according to the Maxima SYBR Green Master Mix (Thermo Scientific, Waltham, MA, USA) protocol. Β-actin was used as the reference housekeeping gene to normalize data. Table 2 presents the used primer sequences. Every sample was worked in triplicates. Real-time PCR experiments were performed by using CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). ΔCT was determined as the difference between the CT of each marker and ß-actin. ΔΔCT was calculated as the difference of the ΔCT value of the calibrator sample and the ΔCT value of the test sample. The resultant data are given as the relative mRNA expression level, calculated as the fold change (2−ΔΔCT).

2.6. Statistical Analysis

Statistical significance was analyzed using one-way analysis of variance (ANOVA) with Tukey’s pairwise comparison tests. Statistical analysis was performed with statistical software (GraphPad Prism version 5.0; La Jolla, CA, USA). The p-value less than 0.05 was considered statistically significant for all statistical analyses.

3. Results

3.1. Cell Viability

Initial exposure of cells to the tested materials indicated significantly reduced proliferation for Medcem MTA group (75%) on day 1 compared to control (p < 0.001), whereas no significant decrease was detected in the viability of MSCs irrespective of the material extracts (Figure 1). Cell proliferation in tested groups increased on day 3, without any difference, but was significantly increased for Medcem MTA (p < 0.001), Pure Portland Cement, Well-Root MTA and osteogenic group (p < 0.01) compared to the control group. On day 7, cell proliferation was highest in the osteogenic group and was significantly higher in Medcem MTA, Pure Portland Cement, and MTA Angelus groups in comparison to the control group. Similar viability of exposed cells was seen among the tested materials except for BIOfactor MTA in which proliferation was reduced compared to that of Pure Portland Cement.
Images obtained with live/dead assay supported the MTS findings as indicated by the clear visualization of the green-stained live cells whereas red-stained dead cells were less frequently observed (Figure 2).

3.2. ALP Activity

There was no difference among groups on day 1 of cell culture and ALP activity was promoted for all groups throughout the incubation time (Figure 3). Pure Portland Cement had significantly higher ALP activity compared to that of the control group, BIOfactor MTA, and Medcem MTA (p < 0.05) whereas no other significant difference was noted among other materials on day 3. High ALP activity for Pure Portland Cement continued on day 7, showing the highest value among all materials and significantly increased in comparison to the control group (p < 0.001). Osteogenically induced cells were used to compare osteo/odontogenic potential of MTA extracts and no significant increase in ALP activity was detected between MTA-exposed cells and osteogenic group on day 7. Among MTA materials, MTA Angelus and BIOfactor MTA demonstrated significantly lower ALP activity than that of Pure Portland Cement and Well-Root ST.

3.3. Quantitative Real-Time PCR

Relative mRNA expressions of osteo/odontogenic gene markers are given in Figure 4. On day 3, MSCs exposed to Medcem MTA indicated a nearly three-fold increase in RUNX2 expression whereas other materials indicated similar expression levels to the control group. Osteogenic induction of MSCs resulted in significantly higher RUNX2 levels as expected (p < 0.001). Longer exposure of all tested materials significantly promoted RUNX2 expression in comparison to the control group on day 7, indicating a nearly four-to six-fold increase (p < 0.001), similar to the osteogenic group.
DMP-1 expression was significantly increased in MTA Angelus, Medcem MTA (p < 0.001), and BIOfactor MTA (p < 0.05) on day 3. Osteogenically induced cells expressed significantly higher DMP-1 only on day 7. On the same day, all tested materials expressed significantly higher DMP-1 except for Well-Root ST and Pure Portland Cement, which indicated a similar DMP-1 gene expression with the control group without any significant difference. BIOfactor MTA and Medcem MTA groups demonstrated a nearly 8 to 10-fold increase for DMP-1 expression at the end of cell culture, a higher increase than the osteogenic group.
Another odontogenic marker, DSPP expression, was significantly upregulated only in MTA Angelus among all groups (p = 0.003). In parallel with DMP-1 expression, all tested materials expressed significantly increased DSPP gene, except for Well-Root ST and Pure Portland Cement on day 7. Medcem MTA had a nearly nine-fold increase in the DSPP gene. The osteogenic induction group had similar a DSPP gene expression level with the control group without any significant difference (p > 0.999).

4. Discussion

The biocompatibility of bioactive materials used in vital pulp therapies or repair of dentinal tissue in perforation sealing and retrograde filling is a determining factor in the success of the treatment outcome as the irritation to surrounding tissues can delay wound healing. As well as its biocompatibility, the biomaterial should have osteo/odontogenic induction properties to support differentiation of peripheral potent cells and initiate mineralization. Therefore, in the current study, MSCs were treated with different bioactive MTA-based material extracts diluted in the growth medium and were compared against osteo/odontogenic-induced and non-induced MSCs.
Dental stem cells have been extensively investigated in terms of multiple lineage differentiation and demonstrated great potential in the hard tissue engineering applications of the oral region, such as the healing of bone defects or supporting cell-based pulp-dentin complex regeneration [14]. Isolated from the tooth germs of third molars, which can be considered a more primitive tissue present during young adulthood compared to more developed pulp and apical papilla tissues, tooth germ-derived MSCs are multipotent stem cells that can benefit from interactions between ectoderm and mesoderm as they are derived from epithelial cells and the underlying mesenchyme [15]. Recent studies reported a high osteo/odontogenic potential for tooth germ-derived MSCs both in vivo and in vitro, alone or in combination with scaffolds [11,13,16]. Hence, the present study used tooth germ-derived MSCs to demonstrate if MTA-based biomaterials can support the induction of odontogenesis and maintain viability. This investigation was able to demonstrate that tooth germ-derived MSCs can be induced with MTA-based biomaterials with comparable results to osteo/odontogenic medium-induced cells, as indicated by the elevated ALP activity and osteo/odontogenic marker genes with varying degrees.
All test materials exhibited significant cell viability as indicated by comparable results in test groups with the controls via MTS and live/dead assay. Immediate exposure to extracts did not cause cytotoxicity to MSCs, but Medcem MTA demonstrated less viability initially which was compensated over the 7-day cell culture as the cells were able to proliferate. As the decrease in cell viability was not more than 30%, none of the materials were considered cytotoxic according to ISO-10993-5. Medcem MTA is composed of Pure Portland Cement with zirconium oxide added as the opacifier. Interestingly, zirconium oxide is reported to have a better biological response than bismuth oxide, which has been involved in the cytotoxicity shown by some MTA materials [17]. In the present study, Angelus MTA contains bismuth oxide as the opacifier, which demonstrated no inhibitory effects on the cell viability of MSCs.
Various MTA materials were tested on bone marrow-derived MSCs and were demonstrated to be non-toxic, but they could affect tooth-derived stem cells in a concentration and time-dependent manner [18]. Studies indicate that MTA materials can promote the proliferation and survival of MSCs derived from dental tissues including apical papilla, exfoliated deciduous teeth, and dental pulp [19]. Despite minor differences, some behavioral tendencies must be acknowledged among MTA materials. MTA Angelus has been studied for a longer period and has established high biocompatibility with similar results to control medium with different types of cells including dental pulp stem cells (DPSCs), periodontal ligament fibroblasts, and osteoblasts [20,21]. Another study reported that undiluted exposition to MTA Angelus increased cell proliferation [22], in accordance with our results which indicated higher proliferation on day 7 with the MTA Angelus group compared to that of the control group. The difference between studies can be attributed to the dilution of the MTA extract or the growth rate of the cell type, which may be comparably higher in stem cells than in fibroblasts [20]. Cell viability is reported to be enhanced two- to three-fold with Pure Portland Cement in DPSCs, at days 3 and 7 compared to cells cultured in control media, which confirms the finding of the present study [23]. When MSCs were previously exposed to Well-Root ST, cell viability was found to be similar on days 1 and 7 but significantly increased compared to the control group on day 3, which is in accordance with our findings [10]. Culturing human periodontal ligament stem cells on Well-Root ST indicated favorable cell attachment and proliferation potentially due to both chemical composition and the smooth surface of the material [24]. There were no recent reports on stem cell viability when treated with BIOfactor MTA and Medcem MTA. However, it should be noted that osteogenically induced MSCs performed better over the 7-day incubation with a consistent increase in proliferation and were significantly promoted on day 7 in comparison to all tested materials, suggesting cell viability may be more prone to change over a longer course of exposure with the MTA-based materials. Additionally, several factors that may cause disparities between studies need to be considered while interpreting cellular response to MTA-based materials, such as the type of tested cells, cytotoxicity assessment methods, concentration, and exposure type of the tested materials. Despite minor variances between tested materials, the null hypothesis that all tested MTA-based materials would not interfere with the viability of the stem cells was accepted.
The early phase of osteoblast differentiation involves an increase in ALP activity which reflects the number of osteogenically committed progenitor cells. A high correlation between ALP induction during in vitro osteogenic differentiation and in vivo bone-forming capacity is demonstrated both in enzyme activity and in mRNA expression [25]. A material with a faster osteogenic induction during early exposure may be more favorable for regenerative pulp therapies as it would immediately stimulate a mineralization barrier. ALP activity results indicated no difference among the tested materials on the immediate exposure measured on day 1. However, Pure Portland Cement exhibited elevated ALP activity on day 3 which continued until the end of cell culture with a significant increase compared to the control group, which may indicate its potential for maintaining osteo/odontogenic activity.
The capacity of the tested materials to induce differentiation was further evaluated with the expression of osteogenic and odontogenic gene markers, RUNX2, DMP-1, and DSPP. RUNX2, a major transcription factor in mineralization, is highly expressed through all stages of craniofacial bone development in osteogenic mesenchyme [26]. RUNX2 directs MSCs to differentiate towards osteoblast lineage and supplies immature osteoblasts in forming immature bone, while downregulation is necessary for mature osteoblasts in their terminal differentiation [27]. RUNX2 was significantly upregulated in MSCs cultured in osteogenic media as expected on both day 3 and day 7, which was used as a positive control of the osteogenic differentiation capacity of used cells. Only Medcem MTA indicated significant upregulation of RUNX2 starting on day 3; however, all other tested materials also promoted RUNX2 expression after 7 days in accordance with previous studies [18], indicating their commitment towards osteogenic differentiation. Interestingly, Pure Portland Cement-exposed MSCs demonstrated a nearly six-fold increase in RUNX2 expression, reaching the highest level among all groups. Pure Portland Cement was reported to express higher levels of RUNX2 and elevated ALP activity in DPSCs compared to that of MTA and the control group, which also confirms the findings of the present study to suggest Pure Portland Cement may have an enhanced osteogenic capacity [23]. On the other hand, RUNX2 is not specific to osteogenic differentiation, as the protein is detectable in the nuclei of pre- and immature odontoblasts during the early stages of tooth development and regulates both tooth and bone-related expressions [27].
The most commonly evaluated phenotypic markers for odontogenic differentiation are DMP-1 and DSPP. DMP-1 acts as an inducer in the odontogenic differentiation of pulp cells whereas DSPP is a non-collagenous protein highly expressed in the dentin matrix and regarded as the terminal differentiation marker of odontoblasts [28]. Overexpression of RUNX2 in odontoblasts inhibits their terminal differentiation and reduces DSPP expression, which indicates RUNX2 is able to induce transdifferentiation of odontoblasts into osteoblasts and needs to be inhibited during odontoblast differentiation to promote normal cell maturation and dentinogenesis [29]. Although these interactions overlap and cannot be singled out as a specific marker of osteogenesis or odontogenesis, a predisposition in MSCs towards osteogenic or odontogenic differentiation with the tested materials can be noted. In the present study, RUNX2 and DSPP expression levels were different between tested materials and osteogenic medium. MTA Angelus showed upregulation of DSPP after 7 days, unlike osteogenic medium, whereas RUNX2 was highly expressed in both groups, which confirms the findings of a similar study with DPSCs [30]. Among the tested biomaterials, Medcem MTA demonstrated significant upregulation of DMP-1 on both time points while BIOfactor MTA also indicated a significant increase on day 7. Regarding DSPP expression, MTA Angelus responded with a significant increase early in cell culture whereas Medcem MTA demonstrated a dramatic increase on day 7. In a previous report when MSCs were seeded on MTA-coated cell plates to assess odontogenic differentiation, ALP activity was decreased but relative DSPP gene expression was upregulated [31]. The low ALP activity may be associated with decreased cell viability, possibly due to the direct exposure of cells to MTA; nevertheless, the cells were able to demonstrate odontogenic differentiation capabilities. In the present study, the cells treated with Well-Root ST and Pure Portland Cement responded with a lesser increase in DSPP expression. Tested MTA materials resulted in upregulation of odontogenic gene markers DMP-1 and DSPP whereas Pure Portland Cement and the osteogenic differentiation control group indicated higher ALP levels in addition to upregulation on RUNX2 expression. Although it is not conclusive, this may suggest a predisposition of MTA materials to direct cells towards odontogenic differentiation while the osteogenic medium may promote cells towards osteogenic lineage. Minor differences in gene expression and cell viability between different formulations of tested MTA materials provide little evidence that one material is superior than the other. Therefore, the second null hypothesis that all tested bioactive materials would support osteo/odontogenic differentiation of stem cells similarly was partially accepted.
As with all in vitro studies, the major limitation lies in the lack of mimicking host reactions to environmental stimuli compared to animal and human studies. Although the biological properties and potential of bioactive cements, like the ones tested in the present study, have been investigated in numerous studies, there are new materials introduced to the market in accordance with high demand. Updated biological profiling of these materials is necessary before their vast clinical use. Hence, it is crucial to test biocompatibility and bioactivity before moving to in vivo investigations and clinical trials to elucidate underlying mechanisms and cell behaviors. The use of standardized procedures such as cytotoxicity assessment according to ISO-10993-5 guidelines and relative gene expression profiles calculated with 2−ΔΔCT ensure reporting reliable results. However, an important limitation of the present study may be due to the lack of a long-term incubation time to demonstrate mineralization and also to determine if the cells can maintain their reported properties in the presence of the tested materials. Nevertheless, the demonstrated properties of the tested materials in the present study may serve as a preliminary evaluation of their potential use, which can further be developed as a biomaterial–cell combination, a potential strategy for many applications in regenerative pulp therapies and root repair.

5. Conclusions

All tested materials favored cell viability and supported osteo/odontogenic differentiation at varying levels with minor differences compared to the control group. Osteo/odontogenic activity in the treated cells increased throughout the culture period, but the behavior of various MTA-based materials did not differ significantly among the groups. In order to establish a truly superior material for a clinical recommendation, further in vivo investigations are necessary.

Author Contributions

P.E. and S.S. designed this study; P.E. performed the experiments; S.S. analyzed the data, and P.E. drafted and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

All procedures involving animals were in compliance with the European Community Council Directive of 24 November 1986 and ethical approval was granted by the Committee for Animal Ethics of Acibadem University, Istanbul, Turkey (Approval no. HDK-2016/39).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the present article.

Acknowledgments

We would like to thank Gamze Torun Kose and her laboratory for their help during the conduct of the experiments.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Parirokh, M.; Torabinejad, M.; Dummer, P.M.H. Mineral trioxide aggregate and other bioactive endodontic cements: An updated overview—Part I: Vital pulp therapy. Int. Endod. J. 2018, 51, 177–205. [Google Scholar] [CrossRef]
  2. Parirokh, M.; Torabinejad, M. Mineral trioxide aggregate: A comprehensive literature review—Part I: Chemical, physical, and antibacterial properties. J. Endod. 2010, 36, 6–27. [Google Scholar] [CrossRef]
  3. Shahi, S.; Fakhri, E.; Yavari, H.; Maleki, D.S.; Salatin, S.; Khezri, K. Portland Cement: An Overview as a Root Repair Material. BioMed Res. Int. 2022, 2022, 3314912. [Google Scholar] [CrossRef]
  4. Ribeiro, D.A.; Hungaro Duarte, M.A.; Matsumoto, M.A.; Alencar Marques, M.E.; Favero Salvadori, D.M. Biocompatibility In Vitro Tests of Mineral Trioxide Aggregate and Regular and White Portland Cements. J. Endod. 2005, 31, 605–607. [Google Scholar] [CrossRef] [PubMed]
  5. de Deus, G.; Ximenes, R.; Gurgel-Filho, E.D.; Plotkowski, M.C.; Coutinho-Filho, T. Cytotoxicity of MTA and Portland cement on human ECV 304 endothelial cells. Int. Endod. J. 2005, 38, 604–609. [Google Scholar] [CrossRef] [PubMed]
  6. Khalil, I.; Isaac, J.; Chaccar, C.; Sautier, J.; Berdal, A.; Naaman, N.; Naaman, A. Biocompatibility assessment of modified Portland cement in comparison with MTA®: In vivo and in vitro studies. Saudi Endod. J. 2012, 2, 6–13. [Google Scholar] [CrossRef]
  7. Bhagat, D.; Sunder, R.K.; Devendrappa, S.N.; Vanka, A.; Choudaha, N. A comparative evaluation of ProRoot mineral trioxide aggregate and Portland cement as a pulpotomy medicament. J. Indian Soc. Pedod. Prev. Dent. 2016, 34, 172–176. [Google Scholar] [CrossRef] [PubMed]
  8. Nosrat, A.; Seifi, A.; Asgary, S. Pulpotomy in caries-exposed immature permanent molars using calcium-enriched mixture cement or mineral trioxide aggregate, a randomized clinical trial. Int. J. Paediatr. Dent. 2013, 23, 56–63. [Google Scholar] [CrossRef]
  9. Tawil, P.Z.; Duggan, D.J.; Galicia, J.C. MTA: A Clinical Review. Compend. Contin. Educ. Dent. 2015, 36, 247–264. [Google Scholar] [PubMed]
  10. Olcay, K.; Taşli, P.N.; Güven, E.P.; Ülker, G.M.Y.; Öğüt, E.E.; Çiftçioğlu, E.; Kiratli, B.; Şahin, F. Effect of a novel bioceramic root canal sealer on the angiogenesis-enhancing potential of assorted human odontogenic stem cells compared with principal tricalcium silicate-based cements. J. Appl. Sci. 2020, 28, e20190215. [Google Scholar] [CrossRef] [PubMed]
  11. Pekozer, G.G.; Ramazanoglu, M.; Schlegel, K.A.; Kok, F.N.; Kose, G.T. Role of STRO-1 sorting of porcine dental germ stem cells in dental stem cell-mediated bone tissue engineering. Artif. Cells Nanomed. Biotechnol. 2018, 46, 607–618. [Google Scholar] [CrossRef] [PubMed]
  12. Ercal, P.; Cayir, F.; Pekozer, G.G.; Kose, G.T. Osteo/odontogenic differentiation analysis of dental stem cells from tooth germ, apical papilla, and dental follicle. Oral Sci. Int. 2022, 19, 180–192. [Google Scholar] [CrossRef]
  13. Sismanoglu, S.; Ercal, P. Effects of calcium silicate-based cements on odonto/osteogenic differentiation potential in mesenchymal stem cells. Aust. Dent. J. 2023, 49, 66–74. [Google Scholar] [CrossRef] [PubMed]
  14. Sismanoglu, S.; Ercal, P. Dentin-pulp tissue regeneration approaches in dentistry: An overview and current trends. Adv. Exp. Med. Biol. 2020, 1298, 79–103. [Google Scholar]
  15. Yalvac, M.E.; Ramazanoglu, M.; Rizvanov, A.A.; Sahin, F.; Bayrak, O.F.; Salli, U.; Palotás, A.; Kose, G.T. Isolation and characterization of stem cells derived from human third molar tooth germs of young adults: Implications in neo-vascularization, osteo-, adipo-and neurogenesis. Pharmacogenomics J. 2020, 10, 105–113. [Google Scholar] [CrossRef]
  16. Ramazanoglu, M.; Moest, T.; Ercal, P.; Polyviou, Z.; Herrmann, K.; Gurel Pekozer, G.; Molenberg, A.; Lutz, R.; Kose, G.T.; Neukam, F.W.; et al. The effect of polyethylenglycol gel on the delivery and osteogenic differentiation of homologous tooth germ–derived stem cells in a porcine model. Clin. Oral Investig. 2021, 25, 3043–3057. [Google Scholar] [CrossRef] [PubMed]
  17. Silva, G.F.; Bosso, R.; Ferino, R.; Tanomaru-Filho, M.; Bernardi, M.I.B.; Guerreiro-Tanomaru, J.M.; Cerri, P.S. Microparticulated and nanoparticulated zirconium oxide added to calcium silicate cement: Evaluation of physicochemical and biological properties. J. Biomed. Mater. Res. Part A 2014, 102, 4336–4345. [Google Scholar] [CrossRef]
  18. Babaki, D.; Yaghoubi, S.; Matin, M.M. The effects of mineral trioxide aggregate on osteo/odontogenic potential of mesenchymal stem cells: A comprehensive and systematic literature review. Biomater. Investig. Dent. 2020, 7, 175–185. [Google Scholar] [CrossRef]
  19. Song, W.; Sun, W.; Chen, L.; Yuan, Z. In vivo Biocompatibility and Bioactivity of Calcium Silicate-Based Bioceramics in Endodontics. Front. Bioeng. Biotechnol. 2020, 8, 580954. [Google Scholar] [CrossRef]
  20. Khedmat, S.; Sarraf, P.; Seyedjafari, E.; Sanaei-rad, P.; Noori, F. Comparative evaluation of the effect of cold ceramic and MTA-Angelus on cell viability, attachment and differentiation of dental pulp stem cells and periodontal ligament fibroblasts: An in vitro study. BMC Oral Health 2020, 21, 628. [Google Scholar] [CrossRef]
  21. de Oliveira, N.G.; de Souza Araújo, P.R.; da Silveira, M.T.; Sobral, A.P.V.; de Vasconcelos Carvalho, M. Comparison of the biocompatibility of calcium silicate-based materials to mineral trioxide aggregate: Systematic review. Front. Bioeng. Biotechnol. 2018, 12, 317–326. [Google Scholar] [CrossRef] [PubMed]
  22. Tomás-Catalá, C.J.; Collado-González, M.; García-Bernal, D.; Oñate-Sánchez, R.E.; Forner, L.; Llena, C.; Lozano, A.; Castelo-Baz, P.; Moraleda, J.M.; Rodríguez-Lozano, F.J. Comparative analysis of the biological effects of the endodontic bioactive cements MTA-Angelus, MTA Repair HP and NeoMTA Plus on human dental pulp stem cells. Int. Endod. J. 2017, 50, e63–e72. [Google Scholar] [CrossRef]
  23. Maher, A.; Núnez-Toldrà, R.; Carrio, N.; Ferres-Padro, E.; Ali, H.; Montori, S.; Al Madhoun, A. The Effect of Commercially Available Endodontic Cements and Biomaterials on Osteogenic Differentiation of Dental Pulp Pluripotent-Like Stem Cells. J. Dent. 2018, 6, 48. [Google Scholar] [CrossRef]
  24. Lee, J.K.; Kim, S.; Lee, S.; Kim, H.C.; Kim, E. In Vitro Comparison of Biocompatibility of Calcium Silicate-Based Root Canal Sealers. Materials 2019, 12, 2411. [Google Scholar] [CrossRef] [PubMed]
  25. Prins, H.J.; Braat, A.K.; Gawlitta, D.; Dhert, W.J.A.; Egan, D.A.; Tijssen-Slump, E.; Yuan, H.; Coffer, P.J.; Rozemuller, H.; Martens, A.C. In vitro induction of alkaline phosphatase levels predicts in vivo bone forming capacity of human bone marrow stromal cells. Stem Cell Res. 2014, 12, 428–440. [Google Scholar] [CrossRef] [PubMed]
  26. Chen, S.; Gluhak-Heinrich, J.; Wang, Y.H.; Wu, Y.M.; Chuang, H.H.; Chen, L.; Yuan, G.H.; Dong, J.; Gay, I.; MacDougall, M. Runx2, osx, and dspp in tooth development. J. Dent. Res. 2009, 88, 904–909. [Google Scholar] [CrossRef] [PubMed]
  27. Komori, T. Regulation of Osteoblast and Odontoblast Differentiation by RUNX2. J. Oral Biosci. 2010, 52, 22–25. [Google Scholar] [CrossRef]
  28. Chen, Y.; Zhang, Y.; Ramachandran, A.; George, A. DSPP Is Essential for Normal Development of the Dental-Craniofacial Complex. J. Dent. Res. 2016, 95, 302–310. [Google Scholar] [CrossRef] [PubMed]
  29. Li, S.; Kong, H.; Yao, N.; Yu, Q.; Wang, P.; Lin, Y.; Wang, J.; Kuang, R.; Zhao, X.; Xu, J.; et al. The role of runt-related transcription factor 2 (Runx2) in the late stage of odontoblast differentiation and dentin formation. Biochem. Biophys. Res. Commun. 2011, 410, 698–704. [Google Scholar] [CrossRef] [PubMed]
  30. Rodríguez-Lozano, F.J.; López-García, S.; García-Bernal, D.; Sanz, J.L.; Lozano, A.; Pecci-Lloret, M.P.; Melo, M.; López-Ginés, C.; Forner, L. Cytocompatibility and bioactive properties of the new dual-curing resin-modified calcium silicate-based material for vital pulp therapy. Clin. Oral Investig. 2021, 25, 5009–5024. [Google Scholar] [CrossRef]
  31. Guven, E.P.; Yalvac, M.E.; Sahin, F.; Yazici, M.M.; Rizvanov, A.A.; Bayirli, G. Effect of dental materials calcium hydroxide-containing cement, mineral trioxide aggregate, and enamel matrix derivative on proliferation and differentiation of human tooth germ stem cells. J. Endod. 2011, 37, 650–656. [Google Scholar] [CrossRef] [PubMed]
Applsci 13 12095 g001
Figure 1. Viability of MSCs under tested calcium silicate-based materials. Different letters indicate a significant difference between the test groups (p < 0.05) excluding the control group. Asterisk indicates difference between the control group and another group *** p < 0.001, ** p < 0.01, * p < 0.05. (OS: Osteogenic medium, ANG: MTA Angelus, BF: BIOfactor MTA, MED: Medcem MTA, PC: Pure Portland Cement, WR: Well-Root ST).
Figure 1. Viability of MSCs under tested calcium silicate-based materials. Different letters indicate a significant difference between the test groups (p < 0.05) excluding the control group. Asterisk indicates difference between the control group and another group *** p < 0.001, ** p < 0.01, * p < 0.05. (OS: Osteogenic medium, ANG: MTA Angelus, BF: BIOfactor MTA, MED: Medcem MTA, PC: Pure Portland Cement, WR: Well-Root ST).
Applsci 13 12095 g001
Applsci 13 12095 g002
Figure 2. Live/dead viability assay of MSCs cultured with tested calcium silicate-based materials under a fluorescence microscope. The merged images show live cells exhibiting green and dead cells exhibiting red fluorescence. The scale bar represents 200 µm. (OS: Osteogenic medium, ANG: MTA Angelus, BF: BIOfactor MTA, MED: Medcem MTA, PC: Pure Portland Cement, WR: Well-Root ST).
Figure 2. Live/dead viability assay of MSCs cultured with tested calcium silicate-based materials under a fluorescence microscope. The merged images show live cells exhibiting green and dead cells exhibiting red fluorescence. The scale bar represents 200 µm. (OS: Osteogenic medium, ANG: MTA Angelus, BF: BIOfactor MTA, MED: Medcem MTA, PC: Pure Portland Cement, WR: Well-Root ST).
Applsci 13 12095 g002
Applsci 13 12095 g003
Figure 3. ALP activity of MSCs treated with tested calcium silicate-based materials. Different letters indicate a significant difference between the test groups (p < 0.05) excluding the control group. Asterisk indicates difference between the control group and another group *** p < 0.001, * p < 0.05. (OS: Osteogenic medium, ANG: MTA Angelus, BF: BIOfactor MTA, MED: Medcem MTA, PC: Pure Portland Cement, WR: Well-Root ST).
Figure 3. ALP activity of MSCs treated with tested calcium silicate-based materials. Different letters indicate a significant difference between the test groups (p < 0.05) excluding the control group. Asterisk indicates difference between the control group and another group *** p < 0.001, * p < 0.05. (OS: Osteogenic medium, ANG: MTA Angelus, BF: BIOfactor MTA, MED: Medcem MTA, PC: Pure Portland Cement, WR: Well-Root ST).
Applsci 13 12095 g003
Applsci 13 12095 g004
Figure 4. Relative mRNA expression profiles of MSCs treated with calcium silicate-based materials showing osteo/odontogenic gene markers, RUNX2, DMP-1, and DSPP. Different letters indicate a significant difference between the test groups (p < 0.05) excluding the control group. Asterisk indicates difference between the control group and another group *** p < 0.001, ** p < 0.01, * p < 0.05. (OS: Osteogenic medium, ANG: MTA Angelus, BF: BIOfactor MTA, MED: Medcem MTA, PC: Pure Portland Cement, WR: Well-Root ST).
Figure 4. Relative mRNA expression profiles of MSCs treated with calcium silicate-based materials showing osteo/odontogenic gene markers, RUNX2, DMP-1, and DSPP. Different letters indicate a significant difference between the test groups (p < 0.05) excluding the control group. Asterisk indicates difference between the control group and another group *** p < 0.001, ** p < 0.01, * p < 0.05. (OS: Osteogenic medium, ANG: MTA Angelus, BF: BIOfactor MTA, MED: Medcem MTA, PC: Pure Portland Cement, WR: Well-Root ST).
Applsci 13 12095 g004
Table 1. Materials used in this study.
Table 1. Materials used in this study.
ProductCompositionBatch Number
MTA-Angelus (Angelus Industria
de Produtos Odontologicos,
Londrina, Brazil)		Powder: tricalcium silicate, dicalcium silicate, tricalcium aluminate, calcium oxide, bismuth oxide.
Liquid: distilled water.		41,804
BIOfactor MTA (Imicryl Dental,
Konya, Turkey)		Powder: tricalcium silicate, dicalcium silicate, tricalcium aluminate, ytterbium oxide as a radiopacifier.
Liquid: 0.5–3% hydrosoluble carboxylated polymer, demineralized water.		19,163
Medcem-MTA (Medcem GmbH, Wien, Austria)Portland cement (tricalcium silicate, dicalcium silicate, calcium oxide) and zirconium oxide as radiopacifier.RX181020
Pure Portland Cement (Medcem GmbH, Wien, Austria)Portland cement (tricalcium silicate, dicalcium silicate, calcium oxide).MTZ171002
Well-Root ST (Vericom, Chuncheon-si, Gangwon-Do, Republic of Korea)Calcium aluminosilicate, zirconium oxide, filler, thickening agent.WR996100
Table 2. Primer sequences and conditions used in the real-time PCR.
Table 2. Primer sequences and conditions used in the real-time PCR.
GenesPrimer Sequence (5′–3′)Product Size
(Base Pairs)		Annealing
Temperature (°C)
β-actinF: TCGTCCACCGCAAATGCTTC21156.0
R: TGCTGTCACCTTCACCGTTC56.0
DMP-1F: CAGAAGCGGTGAGGACTCTG39356.0
R: CTGGCATACCCCACTGATCG56.0
DSPPF: GAAGGCAGTATCACAGAACTCA 29856.0
R: GAATGGCCCATGCTATTGCC 56.0
RUNX2F: AGTTTGTTCTCTGACCGCCTCA23056.0
R: ACCTGCCTGGCTTTTCTTACT56.0
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ercal, P.; Sismanoglu, S. Biocompatibility and Osteo/Odontogenic Potential of Various Bioactive Root-End Filling Materials. Appl. Sci. 2023, 13, 12095. https://doi.org/10.3390/app132212095

AMA Style

Ercal P, Sismanoglu S. Biocompatibility and Osteo/Odontogenic Potential of Various Bioactive Root-End Filling Materials. Applied Sciences. 2023; 13(22):12095. https://doi.org/10.3390/app132212095

Chicago/Turabian Style

Ercal, Pinar, and Soner Sismanoglu. 2023. "Biocompatibility and Osteo/Odontogenic Potential of Various Bioactive Root-End Filling Materials" Applied Sciences 13, no. 22: 12095. https://doi.org/10.3390/app132212095

APA Style

Ercal, P., & Sismanoglu, S. (2023). Biocompatibility and Osteo/Odontogenic Potential of Various Bioactive Root-End Filling Materials. Applied Sciences, 13(22), 12095. https://doi.org/10.3390/app132212095

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop