Obesity as Inducer of Cognitive Function Decline via Dysbiosis of Gut Microbiota in Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Diets
2.2. Design of Animal Experiment
2.3. Determination of Acetyl Cholinesterase, Inflammatory Markers, and Metabolic and Oxidative Stress Parameters
2.4. Lipid Profile and Liver and Kidney Functions
2.5. DNA Extraction and Phylum Quantification Using Real-Time PCR
2.6. 16S Library Preparation and Metagenomic Sequencing
2.7. Sequence Processing and Analysis
2.8. Behavioral Assessment of the Impact of Obesity on Cognitive Functions
2.9. Statistical Analysis
3. Results
3.1. Impact of High-Fat/High-Sucrose Diets on Nutritional Parameters of Obese Rats
3.2. Impact of Obesity on Acetyl Cholinesterase, Oxidative Stress, Inflammation, and Hyperglycemia
3.3. Impact of Obesity on Lipid Profile and Liver and Kidney Functions
3.4. Impact of Obesity on Cognitive Functions
3.4.1. Y–Maze Test
3.4.2. The MWM Test
3.5. Quantification of Two Major Fecal Phyla Using Real-Time PCR
3.6. Metagenomic Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ahima, R.S. Overview of metabolic syndrome. In Metabolic Syndrome: A Comprehensive Textbook; Springer International Publishing: Cham, Switzerland, 2024; pp. 3–14. [Google Scholar]
- McCracken, E.; Monaghan, M.; Sreenivasan, S. Pathophysiology of the metabolic syndrome. Clin. Dermatol. 2018, 36, 14–20. [Google Scholar] [CrossRef] [PubMed]
- Kaur, J. Assessment and screening of the risk factors in metabolic syndrome. Med. Sci. 2014, 2, 140–152. [Google Scholar] [CrossRef]
- Mohamed, S.M.; Shalaby, M.A.; El-Shiekh, R.A.; El-Banna, H.A.; Emam, S.R.; Bakr, A.F. Metabolic syndrome: Risk factors, diagnosis, pathogenesis, and management with natural approaches. Food Chem. Adv. 2023, 3, 100335. [Google Scholar] [CrossRef]
- van de Vyver, M. Immunology of chronic low-grade inflammation: Relationship with metabolic function. J. Endocrinol. 2023, 257, e220271. [Google Scholar] [CrossRef] [PubMed]
- Chassaing, B.; Gewirtz, A.T. Gut microbiota, low-grade inflammation, and metabolic syndrome. Toxicol. Pathol. 2014, 42, 49–53. [Google Scholar] [CrossRef] [PubMed]
- Gardner, C.D.; Trepanowski, J.F.; Del Gobbo, L.C.; Hauser, M.E.; Rigdon, J.; Ioannidis, J.P.A.; Desai, M.; King, A.C. Effect of low-fat vs low-carbohydrate diet on 12-month weight loss in overweight adults and the association with genotype pattern or insulin secretion: The DIETFITS randomized clinical trial. JAMA 2018, 319, 667–679. [Google Scholar] [CrossRef] [PubMed]
- De Lorenzo, A.; Gratteri, S.; Gualtieri, P.; Cammarano, A.; Bertucci, P.; Di Renzo, L. Why primary obesity is a disease? J. Transl. Med. 2019, 17, 169. [Google Scholar] [CrossRef] [PubMed]
- Wharton, S.; Lau, D.C.W.; Vallis, M.; Sharma, A.M.; Biertho, L.; Campbell-Scherer, D.; Adamo, K.; Alberga, A.; Bell, R.; Boulé, N.; et al. Obesity in adults: A clinical practice guideline. Can. Med Assoc. J. 2020, 192, E875–E891. [Google Scholar] [CrossRef] [PubMed]
- WHO. Regional Office for Africa, Obesity. Available online: https://www.afro.who.int/health-topics/obesity (accessed on 22 April 2024).
- Keaver, L.; Webber, L.; Dee, A.; Shiely, F.; Marsh, T.; Balanda, K.; Perry, I.J.; Perry, I. Application of the UK foresight obesity model in Ireland: The health and economic consequences of projected obesity trends in Ireland. PLoS ONE 2013, 8, e79827. [Google Scholar] [CrossRef]
- WHO. Global Report on Diabetes; World Health Organization: Geneva, Switzerland, 2016. Available online: https://www.who.int/publications/i/item/9789241565257 (accessed on 21 April 2016).
- Elmaleh-Sachs, A.; Schwartz, J.L.; Bramante, C.T.; Nicklas, J.M.; Gudzune, K.A.; Jay, M. Obesity management in adults: A review. Jama 2023, 330, 2000–2015. [Google Scholar] [CrossRef]
- Wiciński, M.; Gębalski, J.; Gołębiewski, J.; Malinowski, B. Probiotics for the Treatment of Overweight and Obesity in Humans—A Review of Clinical Trials. Microorganisms 2020, 8, 1148. [Google Scholar] [CrossRef] [PubMed]
- Chaiyasut, C.; Sivamaruthi, B.S.; Kesika, P.; Khongtan, S.; Khampithum, N.; Thangaleela, S.; Peerajan, S.; Bumrungpert, A.; Chaiyasut, K.; Sirilun, S.; et al. Synbiotic Supplementation Improves Obesity Index and Metabolic Biomarkers in Thai Obese Adults: A Randomized Clinical Trial. Foods 2021, 10, 1580. [Google Scholar] [CrossRef] [PubMed]
- Marques-Vidal, P.; Velho, S.; Waterworth, D.; Waeber, G.; von Känel, R.; Vollenweider, P. The association between inflammatory biomarkers and metabolically healthy obesity depends of the definition used. Eur. J. Clin. Nutr. 2012, 66, 426–435. [Google Scholar] [CrossRef] [PubMed]
- Barazzoni, R.; Cappellari, G.; Ragni, M.; Nisoli, E. Insulin resistance in obesity: An overview of fundamental alterations. Eat. Weight Disord.-Stud. Anorex. Bulim. Obes. 2018, 23, 149–157. [Google Scholar] [CrossRef] [PubMed]
- Newens, K.J.; Walton, J. A review of sugar consumption from nationally representative dietary surveys across the world. J. Hum. Nutr. Diet. 2016, 29, 225–240. [Google Scholar] [CrossRef] [PubMed]
- Malik, V.S.; Hu, F.B. The role of sugar-sweetened beverages in the global epidemics of obesity and chronic diseases. Nat. Rev. Endocrinol. 2022, 18, 205–218. [Google Scholar] [CrossRef] [PubMed]
- Bray, G.A. Fructose and risk of cardiometabolic disease. Curr. Atheroscler. Rep. 2012, 14, 570–578. [Google Scholar] [CrossRef] [PubMed]
- Assy, N.; Nasser, G.; Kamayse, I.; Nseir, W.; Beniashvili, Z.; Djibre, A.; Grosovski, M. Soft drink consumption linked with fatty liver in the absence of traditional risk factors. Can. J. Gastroenterol. 2008, 22, 811–816. [Google Scholar] [CrossRef] [PubMed]
- Abid, A.; Taha, O.; Nseir, W.; Farah, R.; Grosovski, M.; Assy, N. Soft drink consumption is associated with fatty liver disease independent of metabolic syndrome. J. Hepatol. 2009, 51, 918–924. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.T.; Kao, Y.H.; Li, M.S.; Luo, T.; Lin, H.Y.; Lee, C.H.; Seal, D.W.; Hu, C.Y.; Chen, L.S.; Tseng, T.S. Sugar-Sweetened Beverages Intake, Abdominal Obesity, and Inflammation among US Adults without and with Prediabetes—An NHANES Study. Int. J. Environ. Res. Public Health 2023, 20, 681. [Google Scholar] [CrossRef] [PubMed]
- Lee, I.S.; Shin, G.; CHoUe, R. Shifts in diet from high fat to high carbohydrate improved levels of adipokines and pro-inflammatory cytokines in mice fed a high-fat diet. Endocr. J. 2010, 57, 39–50. [Google Scholar] [CrossRef] [PubMed]
- Jamar, G.; Ribeiro, D.A.; Pisani, L.P. High-fat or high-sugar diets as trigger inflammation in the microbiota-gut-brain axis. Crit. Rev. Food Sci. Nutr. 2021, 61, 836–854. [Google Scholar] [CrossRef] [PubMed]
- Al-Okbi, S.Y.; Amin, M.A.; Mohamed, A.E.; Edris, A.E.; Sharaf, O.M.; Mabrok, H.B.; Ramadan, A.A. Basil Essential Oil and Its Nanoemulsion Mitigate Non-Alcoholic Steatohepatitis in Rat Model with Special Reference to Gut Microbiota. J. Oleo Sci. 2020, 69, 913–927. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.X.; Deng, X.R.; Zhang, C.H.; Yuan, H.J. Gut microbiota and metabolic syndrome. Chin. Med. J. 2020, 133, 808. [Google Scholar] [CrossRef] [PubMed]
- Thomas, M.S.; Blesso, C.N.; Calle, M.C.; Chun, O.K.; Puglisi, M.; Fernandez, M.L. Dietary Influences on Gut Microbiota with a Focus on Metabolic Syndrome. Metab. Syndr. Relat. Disord. 2022, 20, 429–439. [Google Scholar] [CrossRef] [PubMed]
- Crudele, L.; Gadaleta, R.M.; Cariello, M.; Moschetta, A. Gut microbiota in the pathogenesis and therapeutic approaches of diabetes. EBioMedicine 2023, 97, 104821. [Google Scholar] [CrossRef]
- Hemmati, M.; Kashanipoor, S.; Mazaheri, P.; Alibabaei, F.; Babaeizad, A.; Asli, S.; Eslami, M. Importance of gut microbiota metabolites in the development of cardiovascular diseases (CVD). Life Sci. 2023, 329, 121947. [Google Scholar] [CrossRef]
- Mohamed, D.A.; El-Sayed, H.S.; Abd El-Gawad, M.A.M.; Abdelgayed, S.S.; Hamed, I.M.; Mohamed, R.S. Characterization of stirred yoghurt enriched with probiotics and beetroot and its therapeutic potential in experimental type 2 diabetes. Acta Sci. Pol. Technol. Aliment. 2021, 20, 429–448. [Google Scholar] [PubMed]
- Al-Okbi, S.Y.; Mohamed, D.A.; Hamed, T.E.S.; Abd El Khalek, A.B.; Mohammed, S.E. Role of probiotic mixture with and without green tea extract in prevention of hepatorenal syndrome in rat model. Pak. J. Biol. Sci. 2019, 22, 21–27. [Google Scholar]
- Cavallari, J.F.; Schertzer, J.D. Intestinal microbiota contributes to energy balance, metabolic inflammation, and insulin resistance in obesity. J. Obes. Metab. Syndr. 2017, 26, 161. [Google Scholar] [CrossRef] [PubMed]
- Amabebe, E.; Robert, F.O.; Agbalalah, T.; Orubu, E.S. Microbial dysbiosis-induced obesity: Role of gut microbiota in homoeostasis of energy metabolism. Br. J. Nutr. 2020, 123, 1127–1137. [Google Scholar] [CrossRef] [PubMed]
- Bourrat, P. Have causal claims about the gut microbiome been over-hyped? BioEssays 2018, 40, e1800178. [Google Scholar] [CrossRef] [PubMed]
- Walter, J.; Armet, A.M.; Finlay, B.B.; Shanahan, F. Establishing or exaggerating causality for the gut microbiome: Lessons from human microbiota-associated rodents. Cell 2020, 180, 221–232. [Google Scholar] [CrossRef] [PubMed]
- Malesza, I.J.; Malesza, M.; Walkowiak, J.; Mussin, N.; Walkowiak, D.; Aringazina, R.; Mądry, E. High-fat, western-style diet, systemic inflammation, and gut microbiota: A narrative review. Cells 2021, 10, 3164. [Google Scholar] [CrossRef] [PubMed]
- Deshpande, N.G.; Saxena, J.; Pesaresi, T.G.; Carrell, C.D.; Ashby, G.B.; Liao, M.K.; Freeman, L.R. High fat diet alters gut microbiota but not spatial working memory in early middle-aged Sprague Dawley rats. PLoS ONE 2019, 14, e0217553. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.D.; Hallenius, F.F.; Lin, X.; Nyman, M.; Prykhodko, O. Monobutyrin and monovalerin affect brain short-chain fatty acid profiles and tight-junction protein expression in apoe-knockout rats fed high-fat diets. Nutrients 2020, 12, 1202. [Google Scholar] [CrossRef] [PubMed]
- Olsthoorn, L.; Vreeken D and Kiliaan, A.J. Gut Microbiome, Inflammation, and Cerebrovascular Function: Link Between Obesity and Cognition. Front. Neurosci. 2021, 15, 761456. [Google Scholar] [CrossRef] [PubMed]
- Asghar, A.; Sheikh, N. Role of immune cells in obesity induced low grade inflammation and insulin resistance. Cell. Immunol. 2017, 315, 18–26. [Google Scholar] [CrossRef] [PubMed]
- Guillemot-Legris, O.; Muccioli, G.G. Obesity-induced neuroinflammation: Beyond the hypothalamus. Trends Neurosci. 2017, 40, 237–253. [Google Scholar] [CrossRef] [PubMed]
- Rhea, E.M.; Salameh, T.S.; Logsdon, A.F.; Hanson, A.J.; Erickson, M.A.; Banks, W.A. Blood-Brain Barriers in Obesity. AAPS J. 2017, 19, 921–930. [Google Scholar] [CrossRef] [PubMed]
- Martinelli, I.; Tayebati, S.K.; Roy, P.; Micioni Di Bonaventura, M.V.; Moruzzi, M.; Cifani, C.; Amenta, F.; Tomassoni, D. Obesity-Related Brain Cholinergic System Impairment in High-Fat-Diet-Fed Rats. Nutrients 2022, 14, 1243. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Yu, Y.; Qin, Y.; Zhou, Y.; Tang, R.; Wang, Q.; Li, X.; Wang, H.; Weston-Green, K.; Huang, X.F.; et al. Alterations to the microbiota-colon-brain axis in high-fat-diet-induced obese mice compared to diet resistant mice. J. Nutr. Biochem. 2019, 65, 54–65. [Google Scholar] [CrossRef] [PubMed]
- AOAC. Official Methods of Analysis of the Association of Official Analytical Chemists, 22nd ed.; AOAC: Washington, DC, USA, 2023. [Google Scholar]
- Mohamed, D.A.; Mohamed, R.S.; Fouda, K. Anti-inflammatory potential of chia seeds oil and mucilage against adjuvant induced arthritis in obese and non-obese rats. J. Basic Clin. Physiol. Pharmacol. 2020, 31, 20190236. [Google Scholar] [CrossRef] [PubMed]
- Ramadan, N.S.; El-Sayed, N.H.; El-Toumy, S.A.; Mohamed, D.A.; Abdel Aziz, Z.; Marzouk, M.S.; Esatbeyoglu, T.; Farag, M.A.; Shimizu, K. Anti-Obesity Evaluation of Averrhoacarambola, L. Leaves and Assessment of Its Polyphenols as Potential α-Glucosidase Inhibitors. Molecules 2022, 27, 5159. [Google Scholar] [CrossRef] [PubMed]
- Satoh, K. Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin. Chim. Acta 1978, 20, 37–43. [Google Scholar]
- Aebi, H. Catalase in vitro. Methods Enzymol. 1984, 105, 121–126. [Google Scholar] [CrossRef] [PubMed]
- Trinder, P. Determination of glucose in blood using glucose oxidase with an alternative oxygen acceptor. Ann. Clin. Biochem. 1969, 6, 24. [Google Scholar] [CrossRef]
- Cacho, J.; Sevillano, J.; de Castro, J.; Herrera, E.; Ramos, M.P. Validation of simple indexes to assess insulin sensitivity during pregnancy in Wistar and Sprague-Dawley rats. Am. J. Physiol. Endocrinol. Metab. 2008, 295, E1269–E1276. [Google Scholar] [CrossRef] [PubMed]
- Bartles, H.; Bohmer, M.; Heierli, C. Serum creatinine determination without protein precipitation. Clin. Chim. Acta 1972, 37, 193–197. [Google Scholar] [CrossRef]
- Fawcett, J.K.; Scott, J.E. A rapid and precise method for the determination of urea. J. Clin. Pathol. 1960, 13, 156–159. [Google Scholar] [CrossRef] [PubMed]
- Reitman, S.; Frankel, S. Colorimetric methods for aspartate and alanine aminotransferase. Am. J. Clin. Pathol. 1957, 28, 55–60. [Google Scholar]
- Guo, X.; Xia, X.; Tang, R.; Zhou, J.; Zhao, H.; Wang, K. Development of a real-time PCR method for Firmicutes and Bacteroidetesin feces and its application to quantify intestinal population of obese and lean pigs. Lett. Appl. Microbiol. 2008, 47, 367–373. [Google Scholar] [CrossRef] [PubMed]
- Haarmon, M.; Knol, J. Quantitative real-time PCR analysis of fecal Lactobacillus species in infants receiving prebiotic infant formula. Appl. Environ. Microbiol. 2006, 72, 2359–2365. [Google Scholar] [CrossRef] [PubMed]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [PubMed]
- Luszczki, J.J.; Wojcik-Cwikla, J.; Andres, M.M.; Czuczwar, S.J. Pharmacological and behavioral characteristics of interactions between vigabatrin and conventional antiepileptic drugs in pentylenetetrazole induced seizures in mice: An isobolographic analysis. Neuropsychopharmacology 2005, 30, 958–973. [Google Scholar] [CrossRef] [PubMed]
- D’Hooge, R.; De Deyn, P.P. Applications of the Morris water maze in the study of learning and memory. Brain Res. Rev. 2001, 36, 60–90. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, D.; El-Shamarka, M.; Abdelgayed, S.; Mohamed, R. Protective effect of dietary supplements against streptozotocin induced Alzheimer’s disease in mice. J. Herbmed Pharmacol. 2021, 10, 426–435. [Google Scholar] [CrossRef]
- Mohamed, D.; Fouda, K.; Mabrok, H.; El-Shamarka, M.; Hamed, I. Sourdough bread as Nutritional Intervention Tool for Improvement of Cognitive Dysfunction in Diabetic Rats. BMC Nutr. 2024, 10, 53. [Google Scholar] [CrossRef] [PubMed]
- Concepción-Zavaleta, M.J.; Quiroz-Aldave, J.E.; Durand-Vásquez, M.D.C.; Gamarra-Osorio, E.R.; Valencia de la Cruz, J.D.C.; Barrueto-Callirgos, C.M.; Puelles-León, S.L.; Alvarado-León, E.d.J.; Leiva-Cabrera, F.; Zavaleta-Gutiérrez, F.E.; et al. A comprehensive review of genetic causes of obesity. World J. Pediatr. 2024, 20, 26–39. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.; Sun, T.; Li, Y.; Zhang, D.; Zhou, J.; Su, X. Modulation of the gut microbiota by krill oil in mice fed a high-sugar high-fat diet. Front. Microbiol. 2017, 8, 905. [Google Scholar] [CrossRef] [PubMed]
- Sclafani, A. Animal models of obesity: Classification and characterization. Int. J. Obes. 1984, 8, 491–508. [Google Scholar] [PubMed]
- Torres-Rovira, L.; Astiz, S.; Caro, A.; Lopez-Bote, C.; Ovilo, C.; Pallares, P.; Perez-Solana, M.L.; Sanchez-Sanchez, R.; Gonzalez-Bulnes, A. Diet-induced swine model with obesity/leptin resistance for the study of metabolic syndrome and type 2 diabetes. Sci. World J. 2012, 2012, 510149. [Google Scholar] [CrossRef] [PubMed]
- Ventura, L.L.; Fortes, N.C.; Santiago, H.C.; Caliari, M.V.; Gomes, M.A.; Oliveira, D.R. Obesity-induced diet leads to weight gain, systemic metabolic alterations, adipose tissue inflammation, hepatic steatosis, and oxidative stress in gerbils (Meriones unguiculatus). PeerJ 2017, 5, e2967. [Google Scholar] [CrossRef] [PubMed]
- Zhu, T.; Zhao, J.; Zhuo, S.; Hu, Z.; Ouyang, S.; Wunier; Yu, S.; Chen, Y.; Li, Y.; Le, Y. High Fat Diet and High Cholesterol Diet Reduce Hepatic Vitamin D-25-Hydroxylase Expression and Serum 25-Hydroxyvitamin D3 Level through Elevating Circulating Cholesterol, Glucose, and Insulin Levels. Mol. Nutr. Food Res. 2021, 65, 2100220. [Google Scholar] [CrossRef] [PubMed]
- Magri-Tomaz, L.; Melbouci, L.; Mercier, J.; Ou, Y.; Auclair, N.; Lira, F.S.; Lavoie, J.M.; St-Pierre, D.H. Two weeks of high-fat feeding disturb lipid and cholesterol molecular markers. Cell Biochem. Funct. 2018, 36, 387–393. [Google Scholar] [CrossRef] [PubMed]
- de María Márquez Álvarez, C.; Gómez-Crisóstomo, N.P.; De la Cruz-Hernández, E.N.; Zazueta, C.; Aguilar-Gamas, C.F.; Martínez-Abundis, E. Differential disruption on glucose and insulin metabolism in two rat models of diet-induced obesity, based on carbohydrates or lipids. Mol. Cell. Biochem. 2023, 478, 2481–2488. [Google Scholar] [CrossRef] [PubMed]
- Stanhope, K.L.; Havel, P.J. Mechanisms by which dietary sugars influence lipid metabolism, circulating lipids and lipoproteins, and cardiovascular risk. In Dietary Sugars and Health; Goran, M.I., Tappy, L., Lê, K., Eds.; CRC Press Taylor & Francis Group: Boca Raton, FL, USA, 2015; p. 265. [Google Scholar]
- Shimi, G.; Sohouli, M.H.; Ghorbani, A.; Shakery, A.; Zand, H. The interplay between obesity, immunosenescence, and insulin resistance. Immun. Ageing 2024, 21, 13. [Google Scholar] [CrossRef] [PubMed]
- Nawai, F.; Syauqy, A.; Pramono, A. Correlation of lipid profile, glucose, and body composition on insulin resistance in overweight and obese subjects. AcTion Aceh Nutr. J. 2024, 9, 141–149. [Google Scholar] [CrossRef]
- Cui, D.Y.; Zhang, C.; Chen, Y.; Qian, G.Z.; Zheng, W.X.; Zhang, Z.H.; Zhang, Y.; Zhu, P. Associations between non-insulin-based insulin resistance indices and heart failure prevalence in overweight/obesity adults without diabetes mellitus: Evidence from the NHANES 2001–2018. Lipids Health Dis. 2024, 23, 123. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Hu, L.; Li, X.; Yuan, Z.; He, J.; Liu, D.; Yang, G.; Yuan, L. Effect of C-reactive protein deficiency on insulin resistance reversal in rats with polycystic ovary syndrome through augmented leptin action. Diabetol. Metab. Syndr. 2023, 15, 180. [Google Scholar] [CrossRef] [PubMed]
- Sudhakar, M.; Silambanan, S.; Chandran, A.S.; Prabhakaran, A.A.; Ramakrishnan, R. C-Reactive Protein (CRP) and Leptin Receptor in Obesity: Binding of Monomeric CRP to Leptin Receptor. Front. Immunol. 2018, 9, 1167. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Bao, W.; Liu, J.; Ouyang, Y.Y.; Wang, D.; Rong, S.; Xiao, X.; Shan, Z.L.; Zhang, Y.; Yao, P.; et al. Inflammatory markers and risk of type 2 diabetes: A systematic review and meta-analysis. Diabetes Care 2013, 36, 166–175. [Google Scholar] [CrossRef] [PubMed]
- Searpace, P.L.; Zhang, Y. Leptin resistance: A predisposing factor for diet induced obesity. Am. J. Physiol. Integr. Comp. Physiol. 2009, 296, R493–R500. [Google Scholar] [CrossRef] [PubMed]
- Hribal, M.L.; Fiorentino, T.V.; Sesti, G. Role of C reactive protein (CRP) in leptin resistance. Curr. Pharm. Des. 2014, 20, 609–615. [Google Scholar] [CrossRef] [PubMed]
- Patel, R.; Palit, S.P.; Rathwa, N.; Ramachandran, A.V.; Begum, R. Genetic variants of tumor necrosis factor-α and its levels: A correlation with dyslipidemia and type 2 diabetes susceptibility. Clin. Nutr. 2019, 38, 1414–1422. [Google Scholar] [CrossRef] [PubMed]
- Church, J.S.; Renzelman, M.L.; Schwartzer, J.J. Ten-week high fat and high sugar diets in mice alter gut-brain axis cytokines in a sex-dependent manner. J. Nutr. Biochem. 2022, 100, 108903. [Google Scholar] [CrossRef] [PubMed]
- Weiner, J.; Dommel, S.; Gebhardt, C.; Hanschkow, M.; Popkova, Y.; Krause, K.; Klöting, N.; Blüher, M.; Schiller, J.; Heiker, J.T. Differential expression of immunoregulatory cytokines in adipose tissue and liver in response to high fat and high sugar diets in female mice. Front. Nutr. 2023, 10, 1275160. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.X.; He, Q.; Zhou, Y.; Xu, J.Y.; Zhang, Z.; Chen, C.L.; Wu, Y.-H.; Chen, Y.; Qin, L.-Q.; Li, Y.-H. Protective effect and mechanism of lactoferrin combined with hypoxia against high-fat diet induced obesity and non-alcoholic fatty liver disease in mice. Int. J. Biol. Macromol. 2023, 227, 839–850. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Nie, S.P.; Zhu, K.X.; Ding, Q.; Li, C.; Xiong, T.; Xie, M.Y. Lactobacillus plantarum NCU116 improves liver function, oxidative stress and lipid metabolism in rats with high fat diet induced non-alcoholic fatty liver disease. Food Funct. 2014, 5, 3216–3223. [Google Scholar] [CrossRef] [PubMed]
- Duan, M.; Wang, Y.; Zhang, Q.; Zou, R.; Guo, M.; Zheng, H. Characteristics of gut microbiota in people with obesity. PLoS ONE 2021, 16, e0255446. [Google Scholar] [CrossRef] [PubMed]
- Tilg, H.; Moschen, A.R. Gut microbiome, obesity, and metabolic syndrome. In Metabolic Syndrome: A Comprehensive Textbook; Springer International Publishing: Cham, Switzerland, 2024; pp. 373–384. [Google Scholar]
- Santos-Marcos, J.A.; Perez-Jimenez, F.; Camargo, A. The role of diet and intestinal microbiota in the development of metabolic syndrome. J. Nutr. Biochem. 2019, 70, 1–27. [Google Scholar] [CrossRef] [PubMed]
- Kusnadi, Y.; Saleh, M.I.; Ali, Z.; Hermansyah, H.; Murti, K.; Hafy, Z.; Yuristo, N.E. Firmicutes/Bacteroidetes Ratio of Gut Microbiota and Its Relationships with Clinical Parameters of Type 2 Diabetes Mellitus: A Systematic Review. Maced. J. Med. Sci. 2023, 11, 67–72. [Google Scholar] [CrossRef]
- Zhou, H.; Liu, K.; Liu, W.; Wu, M.; Wang, Y.; Lv, Y.; Meng, H. Diets enriched in sugar, refined, or whole grain differentially influence plasma cholesterol concentrations and cholesterol metabolism pathways with concurrent changes in bile acid profile and gut microbiota composition in ApoE-/-Mice. J. Agric. Food Chem. 2023, 71, 9738–9752. [Google Scholar] [CrossRef] [PubMed]
- Magne, F.; Gotteland, M.; Gauthier, L.; Zazueta, A.; Pesoa, S.; Navarrete, P.; Balamurugan, R. The Firmicutes/Bacteroidetes ratio: A relevant marker of gut dysbiosis in obese patients? Nutrients 2020, 12, 1474. [Google Scholar] [CrossRef] [PubMed]
- Crovesy, L.; Masterson, D.; Rosado, E.L. Profile of the gut microbiota of adults with obesity: A systematic review. Eur. J. Clin. Nutr. 2020, 74, 1251–1262. [Google Scholar] [CrossRef] [PubMed]
- Salazar-Jaramillo, L.; de la Cuesta-Zuluaga, J.; Chica, L.A.; Cadavid, M.; Ley, R.E.; Reyes, A.; Escobar, J.S. Gut microbiome diversity within Clostridia is negatively associated with human obesity. mSystems 2024, e00627-24. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Xu, Y.; Wu, P.; Zhou, H.; Lasanajak, Y.; Fang, Y.; Tang, L.; Ye, L.; Li, X.; Cai, Z.; et al. Transplantation of fecal microbiota rich in short chain fatty acids and butyric acid treat cerebral ischemic stroke by regulating gut microbiota. Pharmacol. Res. 2019, 148, 104403. [Google Scholar] [CrossRef] [PubMed]
- Gao, R.; Zhu, C.; Li, H.; Yin, M.; Pan, C.; Huang, L.; Kong, C.; Wang, X.; Zhang, Y.; Qu, S.; et al. Dysbiosis signatures of gut microbiota along the sequence from healthy, young patients to those with overweight and obesity. Obesity 2018, 26, 351–361. [Google Scholar] [CrossRef] [PubMed]
- Serena, C.; Ceperuelo-Mallafré, V.; Keiran, N.; Queipo-Ortuño, M.I.; Bernal, R.; Gomez-Huelgas, R.; Urpi-Sarda, M.; Sabater, M.; Pérez-Brocal, V.; Andrés-Lacueva, C.; et al. Elevated circulating levels of succinate in human obesity are linked to specific gut microbiota. ISME J. 2018, 12, 1642–1657. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Mazcorro, J.F.; Mills, D.A.; Murphy, K.; Noratto, G. Effect of barley supplementation on the fecal microbiota, caecal biochemistry, and key biomarkers of obesity and inflammation in obese db/db mice. Eur. J. Nutr. 2018, 57, 2513–2528. [Google Scholar] [CrossRef] [PubMed]
- Larsen, J.M. The immune response to Prevotella bacteria in chronic inflammatory disease. Immunology 2017, 151, 363–374. [Google Scholar] [CrossRef] [PubMed]
- Companys, J.; Gosalbes, M.J.; Pla-Pagà, L.; Calderón-Pérez, L.; Llauradó, E.; Pedret, A.; Valls, R.M.; Jiménez-Hernández, N.; Sandoval-Ramirez, B.A.; Del Bas, J.M.; et al. Gut Microbiota Profile and Its Association with Clinical Variables and Dietary Intake in Overweight/Obese and Lean Subjects: A Cross-Sectional Study. Nutrients 2021, 13, 2032. [Google Scholar] [CrossRef] [PubMed]
- Alili, R.; Belda, E.; Fabre, O.; Pelloux, V.; Giordano, N.; Legrand, R.; Bel Lassen, P.; Swartz, T.D.; Zucker, J.-D.; Clément, K. Characterization of the Gut Microbiota in Individuals with Overweight or Obesity during a Real-World Weight Loss Dietary Program: A Focus on the Bacteroides 2 Enterotype. Biomedicines 2022, 10, 16. [Google Scholar] [CrossRef] [PubMed]
- Rios-Covian, D.; Arboleya, S.; Hernandez-Barranco, A.M.; Alvarez-Buylla, J.R.; Ruas-Madiedo, P.; Gueimonde, M.; de los Reyes-Gavilan, C.G. Interactions between Bifidobacterium and Bacteroides species in co-fermentations are affected by carbon sources, including exopolysaccharides produced by bifidobacteria. Appl. Environ. Microbiol. 2013, 79, 7518–7524. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Hu, J.; Geng, F.; Nie, S. Bacteroides utilization for dietary polysaccharides and their beneficial effects on gut health. Food Sci. Hum. Wellness 2022, 11, 1101–1110. [Google Scholar] [CrossRef]
- Tamanai-Shacoori, Z.; Smida, I.; Bousarghin, L.; Loreal, O.; Meuric, V.; Fong, S.B.; Bonnaure-Mallet, M.; Jolivet-Gougeon, A. Roseburia spp.: A marker of health? Future Microbiol. 2017, 12, 157–170. [Google Scholar] [CrossRef] [PubMed]
- Leite, G.; Barlow, G.M.; Rashid, M.; Hosseini, A.; Cohrs, D.; Parodi, G.; Morales, W.; Weitsman, S.; Rezaie, A.; Pimentel, M.; et al. Characterization of the Small Bowel Microbiome Reveals Different Profiles in Human Subjects who are Overweight or have Obesity. Am. J. Gastroenterol. 2024, 119, 1141–1153. [Google Scholar] [CrossRef] [PubMed]
- Tian, X.Y.; Xing, J.W.; Zheng, Q.Q.; Gao, P.F. 919 syrup alleviates postpartum depression by modulating the structure and metabolism of gut microbes and affecting the function of the hippocampal GABA/glutamate system. Front. Cell. Infect. Microbiol. 2021, 11, 694443. [Google Scholar] [CrossRef] [PubMed]
- Franke, T.; Deppenmeier, U. Physiology and central carbon metabolism of the gut bacterium Prevotella copri. Mol. Microbiol. 2018, 109, 528–540. [Google Scholar] [CrossRef] [PubMed]
- Muscogiuri, G.; Cantone, E.; Cassarano, S.; Tuccinardi, D.; Barrea, L.; Savastano, S.; Colao, A. Gut microbiota: A new path to treat obesity. Int. J. Obes. Suppl. 2019, 9, 10–19. [Google Scholar] [CrossRef] [PubMed]
- Ishioh, M.; Nozu, T.; Okumura, T. Brain Neuropeptides, Neuroinflammation, and Irritable Bowel Syndrome. Digestion 2024, 105, 34–39. [Google Scholar] [CrossRef] [PubMed]
- Lainez, N.M.; Jonak, C.R.; Nair, M.G.; Ethell, I.M.; Wilson, E.H.; Carson, M.J.; Coss, D. Diet-induced obesity elicits macrophage infiltration and reduction in spine density in the hypothalami of male but not female mice. Front. Immunol. 2018, 9, 1992. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Yoo, Y.; Han, J.; Park, Y.J. Altered expression of inflammation-associated genes in the hypothalamus of obesity mouse models. Nutr. Res. 2019, 70, 40–49. [Google Scholar] [CrossRef] [PubMed]
- Szegletes, T.; Mallender, W.D.; Thomas, P.J.; Rosenberry, T.L. Substrate binding to the peripheral site of acetylcholinesterase initiates enzymatic catalysis. Substrate inhibition arises as a secondary effect. Biochemistry 1999, 38, 122–133. [Google Scholar] [CrossRef] [PubMed]
- Kaizer, R.R.; da Silva, A.C.; Morsch, V.M.; Corrêa, M.C.; Schetinger, M.R. Diet-induced changes in AChE activity after long-term exposure. Neurochem. Res. 2004, 29, 2251–2255. [Google Scholar] [CrossRef] [PubMed]
- Saiyasit, N.; Chunchai, T.; Prus, D.; Suparan, K.; Pittayapong, P.; Apaijai, N.; Pratchayasakul, W.; Sripetchwandee, J.; Chattipakorn, N.; Chattipakorn, S.C. Gut dysbiosis develops before metabolic disturbance and cognitive decline in high-fat diet-induced obese condition. Nutrition 2020, 69, 110576. [Google Scholar] [CrossRef] [PubMed]
- Stilling, R.M.; van de Wouw, M.; Clarke, G.; Stanton, C.; Dinan, T.G.; Cryan, J.F. The neuropharmacology of butyrate: The bread and butter of the microbiota-gut-brain axis? Neurochem. Int. 2016, 99, 110–132. [Google Scholar] [CrossRef] [PubMed]
- Bruce-Keller, A.J.; Salbaum, J.M.; Luo, M.; Blanchard, E.T.; Taylor, C.M.; Welsh, D.A.; Berthoud, H.R. Obese-type gut microbiota induce neurobehavioral changes in the absence of obesity. Biol. Psychiatry 2015, 77, 607–615. [Google Scholar] [CrossRef] [PubMed]
- Gates, N.J.; Vernooij, R.W.; Di Nisio, M.; Karim, S.; March, E.; Martinez, G.; Rutjes, A.W. Computerised cognitive training for preventing dementia in people with mild cognitive impairment. Cochrane Database Syst. Rev. 2019, 3, CD012279. [Google Scholar] [CrossRef] [PubMed]
- Trecroci, A.; Cavaggioni, L.; Rossi, A.; Moriondo, A.; Merati, G.; Nobari, H.; Ardigò, L.P.; Formenti, D. Effects of speed, agility and quickness training programme on cognitive and physical performance in preadolescent soccer players. PLoS ONE 2022, 17, e0277683. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Li, Y.; Cai, L.; Wang, Y. Effects of physical activity interventions on cognitive performance of overweight or obese children and adolescents: A systematic review and meta-analysis. Pediatr. Res. 2021, 89, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Tait, J.L.; Collyer, T.A.; Gall, S.L.; Venn, A.J.; Dwyer, T.; Fraser, B.J.; Moran, C.; Srikanth, V.K.; Callisaya, M.L. Associations of midlife fitness and obesity profiles with cognitive function. Eur. J. Sport Sci. 2024, 24, 587–596. [Google Scholar] [CrossRef]
Balanced Diet | High-Fat Diet | High-Fat/High-Sucrose Diet | |
---|---|---|---|
Macro- and micronutrients | |||
Protein | 10 | 10 | 10 |
Fat | 10 | 35 | 35 |
Carbohydrate | 70.5 | 50.5 | 50.5 |
AIN Mineral mix | 3.5 | 3.5 | 3.5 |
AIN Vitamin mix | 1 | 1 | 1 |
Cellulose | 5 | - | - |
Ingredients | |||
* Casein | 12 | 12 | 12 |
Corn oil | 10 | - | - |
Beef tallow | - | 35 | 35 |
Sucrose | 22.83 | 22.83 | 22.83 |
Starch | 45.67 | 25.67 | 25.67 |
Additional supplement | - | - | 30% (w/v) sucrose water |
** Total Calories (kCal/g) | 4.20 | ** 5.57 | 5.57 + 1.2 Kcal/mL from sucrose water |
Primer Name | Primer Sequence 5′-3′ | Annealing Temperature | Amplicon Size (bp) | Reference |
---|---|---|---|---|
BactF BactR | CATGTGGTTTAATTCGATGAT AGCTGACGACAACCATGCAG | 60 °C 60 °C | 126 | [56] |
FirmF FirmR | ATGTGGTTTAATTCGAAGCA AGCTGACGACAACCATGCAC | 60 °C 60 °C | 126 | [56] |
Parameters | NC | HF | HFHS |
---|---|---|---|
Initial Weight (kg) | 117.00 a ± 1.71 | 116.83 a ± 4.61 | 117.17 a ± 1.78 |
Final Weight (kg) | 231.33 a ± 11.76 | 378.33 b ± 4.94 | 381.77 b ± 7.92 |
Body Weight Gain (g) | 114.33 a ± 11.61 | 261.50 b ± 7.73 | 264.50 b ± 8.56 |
BMI (g/cm2) | 0.427 a ± 0.024 | 0.683 b ± 0.012 | 0.688 b ± 0.011 |
Total Food Intake (g) | 900.00 a ± 5.77 | 945.83 b ± 5.23 | 955.83 b ± 6.11 |
Food Efficiency Ratio | 0.13 a ± 0.01 | 0.276 b ± 0.008 | 0.277 b ± 0.008 |
Water Intake/Sucrose Water Intake (mL/day) | 41.2 a ± 0.735 | 41.5 a ± 0.769 | 40.6 a ± 0.873 |
Parameters | NC | HF | HFHS |
---|---|---|---|
Insulin (µg/L) | 6.47 a ± 0.09 | 12.50 b ± 0.25 | 13.37 b ± 0.43 |
Glucose (mg/dL) | 70.49 a ± 1.72 | 109.74 b ± 2.76 | 114.67 b ± 3.13 |
IR | 1.13 a ± 0.04 | 3.38 b ± 0.09 | 3.79 b ± 0.18 |
Oxidative stress status | |||
MDA (nmol/mL) | 5.97 a ± 0.10 | 16.50 b ± 0.43 | 17.67 b ± 0.76 |
CAT (U/L) | 609.35 a ± 10.46 | 312.05 b ± 6.94 | 290.83 b ± 4.55 |
Inflammatory markers | |||
TNFα (pg/mL) | 13.72 a ± 0.16 | 29.00 b ± 0.73 | 30.50 b ± 0.56 |
CRP (ng/mL) | 2.77 a ± 0.07 | 5.33 b ± 0.09 | 5.97 b ± 0.12 |
Leptin (ng/mL) | 12.83 a ± 0.32 | 26.60 b ± 0.42 | 30.36 c ± 0.60 |
Lipid profile | |||
TCh (mg/dL) | 72.15 a ± 2.03 | 144.61 b ± 3.08 | 168.33 c ± 3.78 |
TG (mg/dL) | 69.40 a ± 1.39 | 117.77 b ± 2.97 | 134.17 b ± 3.07 |
HDL | 43.00 a ± 0.52 | 27.17 b ± 0.60 | 26.50 b ± 0.76 |
LDL | 18.83 a ± 0.48 | 87.50 b ± 2.14 | 112.67 c ± 3.84 |
TCh/HDL | 1.68 a ± 0.04 | 5.35 b ± 0.22 | 6.38 c ± 0.24 |
Oxi LDL (pg/mL) | 26.45 a ± 0.56 | 44.23 b ± 1.07 | 47.51 c ± 0.89 |
Liver and kidney functions | |||
AST (IU/L) | 40.23 a ± 0.79 | 53.33 b ± 1.54 | 59.67 c ± 1.31 |
ALT (IU/L) | 19.38 a ± 0.44 | 28.17 b ± 0.79 | 31.67 c ± 1.28 |
Urea (mg/dL) | 24.73 a ± 0.57 | 34.33 b ± 0.80 | 36.33 b± 0.67 |
Creatinine (mg/dL) | 0.64 a ± 0.01 | 0.86 b ± 0.03 | 0.94 b ± 0.02 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mabrok, H.B.; Ramadan, A.A.; Hamed, I.M.; Mohamed, D.A. Obesity as Inducer of Cognitive Function Decline via Dysbiosis of Gut Microbiota in Rats. Brain Sci. 2024, 14, 807. https://doi.org/10.3390/brainsci14080807
Mabrok HB, Ramadan AA, Hamed IM, Mohamed DA. Obesity as Inducer of Cognitive Function Decline via Dysbiosis of Gut Microbiota in Rats. Brain Sciences. 2024; 14(8):807. https://doi.org/10.3390/brainsci14080807
Chicago/Turabian StyleMabrok, Hoda B., Asmaa A. Ramadan, Ibrahim M. Hamed, and Doha A. Mohamed. 2024. "Obesity as Inducer of Cognitive Function Decline via Dysbiosis of Gut Microbiota in Rats" Brain Sciences 14, no. 8: 807. https://doi.org/10.3390/brainsci14080807
APA StyleMabrok, H. B., Ramadan, A. A., Hamed, I. M., & Mohamed, D. A. (2024). Obesity as Inducer of Cognitive Function Decline via Dysbiosis of Gut Microbiota in Rats. Brain Sciences, 14(8), 807. https://doi.org/10.3390/brainsci14080807