Next Article in Journal
The Effect of Preventing Oxidative Stress and Its Mechanisms in the Extract from Sonchus brachyotus DC. Based on the Nrf2-Keap1-ARE Signaling Pathway
Next Article in Special Issue
Partial Replacement of Synthetic Vitamin E by Polyphenols in Post-Weaning Piglets
Previous Article in Journal
The Applications and Mechanisms of Superoxide Dismutase in Medicine, Food, and Cosmetics
Previous Article in Special Issue
Effect of Dietary Supplementation with a Mixture of Natural Antioxidants on Milk Yield, Composition, Oxidation Stability and Udder Health in Dairy Ewes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 12
Issue 9
10.3390/antiox12091676
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion

by
Eleni Dalaka
,
Ioannis Politis
and
Georgios Theodorou
*
Laboratory of Animal Breeding and Husbandry, Department of Animal Science, Agricultural University of Athens, 11855 Athens, Greece
*
Author to whom correspondence should be addressed.
Antioxidants 2023, 12(9), 1676; https://doi.org/10.3390/antiox12091676
Submission received: 11 July 2023 / Revised: 22 August 2023 / Accepted: 25 August 2023 / Published: 27 August 2023
(This article belongs to the Special Issue Novel Antioxidants for Animal Nutrition)
Browse Figures
Versions Notes

Abstract

:
Whey-derived peptides have been associated with different biological properties, but most peptides are usually further hydrolyzed during the digestive process. In the present study, the antioxidant capacity of 48 samples of sweet whey (SW) derived from cheeses obtained from small-scale cheese plants made with bovine, ovine, caprine or a mixture of ovine/caprine milk was assessed using both cell-free and cell-based assays. SW digestates (SW-Ds) and a fraction (<3 kDa; SW-D-P3) thereof were obtained after in vitro digestion and subsequent ultrafiltration. Antioxidant properties using four different assays were evaluated before and after digestion. Our data showed higher values (p < 0.05) for ORAC, ABTS, FRAP and P-FRAP after in vitro digestion (SW-Ds and SW-D-P3) when compared with the corresponding values before digestion. In the non-digested SW, ORAC values were higher (p < 0.05) for the bovine SW compared with all the other samples. In contrast, the ABTS assay indicated a higher antioxidant activity for the ovine SW both before digestion and for SW-D-P3 compared with the bovine SW. The fraction SW-D-P3 of the ovine SW, using HT29 cells and H2O2 as an oxidizing agent, increased (p < 0.05) the cellular antioxidant activity. Furthermore, the same fraction of the ovine/caprine mixed SW increased, through the NF-κB pathway, the expression of SOD1 and CAT, genes implicated in the oxidative response in macrophage-like THP-1 cells. These findings indicate that SW, and particularly bovine and ovine SW, could be a candidate source for physical antioxidants in human and animal nutrition.

1. Introduction

Sweet whey (SW), a by-product of the cheese-making process, is considered a pollutant, and its estimated annual production is about 200 million tons [1]. Considering the huge volumes of SW produced and the increasing consumer demand for more sustainable food production, constant efforts are being made to evaluate biologically relevant properties of whey [2].
The demand for functional foods has been growing continuously due to their nutritional value, health-promoting properties and their potential to reduce the risk of several diseases [3,4]. Whey proteins are a source of bioactive peptides with a range of biological properties including antihypertensive, antimicrobial, antidiabetic as well as antioxidant activity. Specifically, whey proteins and their derivatives are characterized as potent antioxidants by modulating a range of redox biomarkers and reactive oxygen species [5,6]. The antioxidant activity of whey protein peptides has been attributed to the synergistic action of sulfhydryl groups, free radical scavenging by specific amino acids and chelation of iron [7,8]. It should be noted that although there is a plethora of studies reporting milk whey antioxidant activity, most of them use as a source WPC and WPI of bovine origin and not fresh SW, while no comparative data with SW from small ruminants’ milk are available.
During the last few years, much research has been dedicated to the processing and generation of bioactive peptides from food products [9]. Bioactive peptides are defined as components with biological activities over and above their nutritional value [10]. Furthermore, as it is known, whey proteins can release bioactive peptides by proteolysis in order to exert enhanced functions [11]. Polypeptides are degraded amongst other ways, by brush-border or cellular peptidases, whereas peptides with low molecular weight may remain intact and exert their activity at the tissue level [12].
Several recent studies have focused on cell-based assays as a more appropriate technique that serves as an intermediate between in vitro biochemical assays and in vivo clinical trials in animals or humans. Wolfe et al. developed a quantitative cellular antioxidant activity (CAA) assay based on human hepatocarcinoma HepG2 cells for quantifying the antioxidant activity of phytochemicals, food extracts and dietary supplements [13]. Liver cells, however, cannot be considered the ideal in vitro model for measuring the efficacy of dietary antioxidants. On the other hand, many studies mention a good correlation between the in vitro absorption in intestinal (Caco-2 and/or HT29) cellular models and in vivo intestinal absorption; hence, they are being widely used as effective tools for predicting the human intestinal absorption of food compounds and drugs [14,15,16]. For this reason, Wan et al. developed a Caco-2 CAA assay for the quantitative evaluation of antioxidants [17]. This was further validated by Kellett et al. who reported more robust results for CAA in a Caco-2 cell model compared to HepG2 cells and who verified that epithelial cell lines, known to be good models of the intestinal barrier, are more appropriate cell models to determine the antioxidant activity for phenolic antioxidants [18]. Many studies mention a good correlation between the in vitro absorption in intestinal (Caco-2 and/or HT29) cellular models and in vivo intestinal absorption; hence, they are being widely used as effective tools for predicting human intestinal absorption of food compounds and drugs [14,15,16].
The enzymatic hydrolysis of whey protein concentrate (WPC) and whey protein isolate (WPI) can produce antioxidant peptides, and hence, functional additives based on them could be produced. An advantageous approach for both dairy industries and livestock farmers should be the utilization of natural compounds, such as SW and its derivatives. Therefore, it is imperative to evaluate SW for its antioxidant capacity in vitro for the potential future increase of their use in animal nutrition [6,19].
The overproduction of ROS leads to oxidative stress and promotes inflammation by the NFE2L2 (NFE2 Like BZIP Transcription Factor 2) antioxidant pathway [20]. NFE2L2 is well recognized for its critical role in the response to oxidative stress and its binding to antioxidant responsive elements (AREs) and the subsequent regulation of their expression [21,22,23]. Enzymes such as catalase (CAT) and superoxide dismutase 1 (SOD1) are used as markers to reflect the antioxidant status of the cell [24]. More specifically, CAT and SOD1 represent the indirect antioxidant activity that reflects the removal of ROS. SOD1 decomposes superoxide anion to H2O2, which CAT then converts into water and oxygen [25], and the expression of both enzymes is regulated by AREs, which have been previously activated by NFE2L2 [26]. Another pathway that has been proposed as an alternative to NFE2L2 is that of the transcription nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). The expression of antioxidant enzymes, among them CAT and SOD1, might also be regulated by the NF-κB pathway [27].
The aim of this study was to evaluate the antioxidant capacity of commercial SW from ovine, bovine, caprine and a mix of ovine/caprine milk origin using the harmonized static in vitro digestion protocol INFOGEST 2.0 [28]. The oxygen radical antioxidant capacity (ORAC), 2,2′-azinobis (3-ethylbenzothiazoline-6-sulfonic acid) radical scavenging assay (ABTS), ferric reducing antioxidant power (FRAP) and potassium ferricyanide reducing antioxidant power (P-FRAP) of SW before and after digestion were examined. Moreover, the effect of treatment with SW-D-P3 on CAA in HT29 cells and gene expression quantification of CAT, SOD and NFE2L2 in THP-1 cells, following induced oxidative stress by H2O2 and LPS, respectively, was assessed.

2. Materials and Methods

2.1. Chemicals and Reagents

The chemicals and enzymes used were all of high purity or an analytical reagent grade. Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid), 2,2′-azobis(2-methyl-propionamidine) dihydrochloride (AAPH), 2,4,6-tri (2-pyridyl)-s-triazine (TPTZ), fluorescein sodium salt (FL), ferric chloride (FeCl3), potassium ferricyanide (K3Fe(CN)6), trichloroacetic acid (TCA) and 2′,7′-Dichlorofluorescein diacetate (DCFH-DA), hydrogen peroxide (H2O2—35% in water), 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS), sodium persulfate, acetic acid (glacial), butylated hydroxytoluene (BHT), pepsin from porcine gastric mucosa (≥2.500 units/mg protein), porcine pancreatin (4 × USP, United States Pharmacopeia) bile extract porcine, phorbol 12-myristate 13-acetate (PMA) and lipopolysaccharides from Escherichia coli O111:B4 (LPS) were all purchased from Sigma-Aldrich (Saint Louis, MO, USA). The Amicon Ultra-4 Centrifugal Filter Devices (3kDa) and Millex-GP 33mm PES 0.22 um were from Merck Millipore (Burlington, MA, USA). The 96-well transparent flat-bottom plates were purchased from Kisker Biotech (Steinfurt, Germany), while the 96-well cell culture transparent flat-bottom plates were purchased from SPL Life Sciences (Pocheon, South Korea). 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) was obtained from Cayman Chemical (Michigan, MI, USA). DMEM, RPMI 1640, L-glutamine, sodium pyruvate, non-essential amino acids and penicillin-streptomycin were purchased from Biosera (Cholet, France). Fetal bovine serum (FBS) was purchased from Gibco ThermoFisher Scientific (Waltham, MA, USA). Phosphate-buffered saline (PBS) and the PrimeScript RT reagent kit (Perfect Real Time) were purchased from Takara Bio (Shiga, Japan). NucleoZOL was obtained from Macherey-Nagel (Düren, Germany). DNase I (RNase-Free) was purchased from New England Biolabs (Ipswich, MA, USA). The FastGene 2× IC Green qPCR Universal Mix was purchased from Nippon Genetics (Tokyo, Japan).

2.2. Collection and Preparation of Samples

Sweet whey samples were obtained from several small-scale cheese plants in Greece. Cheeses were produced from bovine, ovine, caprine and a mixture of ovine/caprine milk. An equal number (12 each) of SW from each milk animal origin (bovine, ovine, caprine and a mix of ovine/caprine) was used. The ratio of ovine/caprine ranged from 80/20 to 70/30 in all samples used in this study. Freeze-drying of liquid sweet whey was carried out to remove water and other solvents, and then protein content of all 48 samples was determined by the Kjeldahl method [29]. Afterwards, all samples were resuspended in deionized water at the same protein concentration of 3% (v/v) before use in subsequent analyses.

2.3. In Vitro Digestion Protocol

The digestion procedure of the samples was modified using the protocol reported by the amended and improved digestion method INFOGEST 2.0 [28,29] with slight modifications. Electrolyte stock solutions of digestive fluids, including the simulated salivary fluid (SSF), simulated gastric fluid (SGF) and simulated intestinal fluid (SIF), were prepared, and the pH of the electrolyte stock solutions were adjusted with HCl (5 M) and NaOH (6 M). Enzyme and bile salt solutions were freshly prepared prior to use.

2.3.1. Simulated Oral Digestion

Briefly, 5 mL of each sample (30 mg protein/mL) was mixed with 4 mL of pre-warmed SSF followed by the addition of 25 μL of CaCl2 (0.3 M) and 0.975 mL of distilled water and NaOH (1 M) to reach a pH of 7. The oral solution was placed in a water bath at 37 °C and incubated with shaking for 2 min without the addition of α-salivary amylase.

2.3.2. Simulated Gastric Digestion

A total of 10 mL of the above oral bolus was mixed with 8 mL of pre-warmed SGF, 1 mL of porcine pepsin solution (2000 U/mL), 5 μL of CaCl2 (0.3 M) and 0.995 mL of distilled water with HCl (5 M) to achieve a pH of 3. The final mixture was incubated for 2 h at 37 °C in a rotator at 300 rpm.

2.3.3. Simulated Intestinal Digestion

A total of 20 mL of the gastric chyme was mixed with 8 mL of pre-warmed SIF, 5 mL of pancreatin (100 U/mL), 2.87 mL of bile extract (5 mM), 40 μL of CaCl2 (0.3 M) and 4.09 mL of distilled water with NaOH. The final pH of each mixture was adjusted to 7 to simulate the physiological intestinal digestion environment. Then, the final mixture was incubated for 2 h at 37 °C in a rotator at 300 rpm.

2.3.4. Digestates’ Fractionation

SW digestates (SW-Ds) were immediately placed in a water bath for heat shock (85 °C, 10 min) to stop enzymatic activities and were then directly placed on ice. Undigested proteins were precipitated by centrifugation at 1200× g for 5 min. Then, aliquots of the digestates were filtered through a 0.22 μm polyvinylidene fluoride (PVDF) syringe filter. In order to remove high molecular weight peptides from SW-Ds and obtain the SW-D-P3 fraction, a membrane filter (Ultracel® low binding regenerated cellulose) with an MWCO of 3 kDa was used (Amicon Ultra-4 Centrifugal Filter Devices). The SW-D samples were centrifuged at 4000× g for 90 min in a swinging-bucket rotor, following the manufacturer’s instructions. The SW-Ds and SW-D-P3 were then stored at −20 °C until needed for further analysis. Moreover, four replicates of blank digests were also prepared. Specifically, digests without SW (replaced with water) but with all required enzymes, electrolytes and bile salts were performed. The corresponding fractions after in vitro digestion were named BL-D for blank digest and BL-D-P3 for the fraction of digestate with peptides with a molecular weight below 3 kDa.

2.4. Biochemical Assays

2.4.1. Oxygen Radical Antioxidant Capacity (ORAC)

The ORAC method used with FL was first described by Ou et al. [30], and the improved method of Zulueta and colleagues [31,32] was used. Firstly, the SW, SW-Ds and SW-D-P3 were dissolved and diluted 1:30 in PBS (75 mM, pH 7.4) so as to be transparent and to avoid interferences. A total of 20 μL of each sample was added to a well in a 96-well microplate with 120 μL FL (117 nM in 75 mM PBS, pH 7.4). After incubation with shaking at 37 °C for 15 min, 60 μL AAPH (40 mM) was also added to each well. Fluorescence was read immediately every 2 min for a total of 80 min at 485 nm/535 nm (excitation/emission). The automated ORAC assay was carried out on a VICTOR 2030 multilabel counter (Perkin Elmer, Waltham, MA, USA), and a standard curve of Trolox was constructed with a final concentration range of 3.125–50 μM in 75 mM of PBS and a pH of 7.4. The antioxidant capacity was expressed as μmol Trolox Equivalents (TEs)/g protein based on the area under curve (AUC) for the fluorescence decay vs. time. SW before and after in vitro digestion were measured in triplicate, and the experiment was performed three independent times.

2.4.2. 2,2′-Azinobis (3-Ethylbenzothiazoline-6-Sulfonic Acid) Radical Scavenging Assay (ABTS)

The ABTS radical scavenging activity of the SW samples, before and after digestion, was measured according to the procedure of Ozgen et al. [33]. Firstly, 7 mM of an ABTS solution was mixed with 2.45 mM of a sodium persulfate solution in equal volumes, followed by incubation for 12–16 h at room temperature in the dark to generate ABTS radicals. After that, the above ABTS•+ solution was diluted with a sodium acetate buffer (20 mM, pH 4.5) until the absorbance provided nearly 0.7 at 734 nm. Then, 20 μL (3 mg protein/mL) of the sample and 230 μL of the ABTS•+ solution was mixed and incubated for 60 min at room temperature [4]. A standard curve of the antioxidant (Trolox) was constructed for a concentration range of 3.75–100 μM. The absorbance was measured at 734 nm using a 96-well Inifinite M200 Pro plate reader (Männedorf, Switzerland). The ABTS radical scavenging activity (%) was calculated as an ABTS radical scavenging activity (%) = [(Ac − As)/Ac] × 100 where Ac represents the absorbance of the control and As represents the absorbance of the samples after the reaction [34]. The SW samples before and after in vitro digestion were measured in triplicate, and the experiment was performed three independent times. The results are expressed as μmol TEs/g protein.

2.4.3. Ferric Reducing Antioxidant Power (FRAP)

The reducing activity of SW, SW-Ds and SW-D-P3 was determined according to the method of Benzie et al. [35] with appropriate modifications for 96-well microplates [36,37]. Firstly, the SW was suitably diluted at 1:3 and SW-Ds and SW-D-P3 at 1:2, respectively. A ferric-tripyridyltriazine (FeIII-TPTZ) complex solution was prepared with 0.3 M sodium acetate with glacial acetic acid (pH 3,6), 20 mM FeCl3 and 10 mM TPTZ (in 40 mM HCl) at a ratio of 10:1:1 (v/v/v) and was heated to 37 °C for 1 h. All stock solutions were prepared daily and kept in the dark. Consequently, 280 μL of the FeIII-TPTZ solution was transferred to each well with 20 μL of the sample in a 96-well microplate, and the absorbance was read at 590 nm using the Epoch 2 microplate spectrophotometer (Biotek, Winooski, VT, USA). Trolox as standard (concentration range 0.18–5.88 μM) and methanol as blank were also added to each plate. Results are expressed as μmol TEs/g protein. Samples were measured in triplicate, and the experiment was performed three independent times.

2.4.4. Potassium Ferricyanide Reducing Power (P-FRAP)

The reducing power assay was performed according to the method described by Oyaizu [38] and Liang et al. [39] with some modifications. Briefly, the SW, SW-Ds and SW-D-P3 were appropriately diluted with water (1:6 for all samples) so that the final absorbance of 700 nm fell within the range of the calibration curve. Then, 50 μL of the sample solution were mixed with 50 μL of 0.2 M of PBS (pH 6.6) and 50 μL of a fresh (prepared daily) K3Fe(CN)6 (1% w/v) solution. The microplate was incubated for 20 min at 50 °C under agitation. Then, 50 μL of TCA (10% w/v) with 10 μL of FeCl3 (0.1% w/v) were added, and the incubation was continued for an additional 10 min at 50 °C under agitation. The absorbance at 700 nm was measured, and a curve with a BHT was constructed (0–100 μM). Results are expressed as μmol BHT equivalents/g protein [40]. The reducing power assay measures the ability of a compound to reduce ferric ion (Fe3+) to ferrous ion (Fe2+) through electron or hydrogen donation [41]. Samples were measured in triplicate, and the experiment was performed three independent times.

2.5. Cellular Assays

2.5.1. Cell Culture and Cell Viability of HT29

Cells of the human colon adenocarcinoma cell line HT29 were cultured in DMEM supplemented with 100 U/mL of penicillin, 100 μg/mL of streptomycin, 10 U/mL of L-glutamine, 100 μM of non-essential amino acids, 1 mM of sodium pyruvate and 10% (v/v) FBS. Cells were incubated at 37 °C in humidified air containing 5% CO2. Firstly, the effects of H2O2 on cell survival were measured using the MTT assay. The HT29 cells were seeded in 96-well plates at a concentration of 0.5 × 105 cells per well. After 24 h of culturing, the cells were treated with different concentrations of H2O2 (0–2 mM) at 37 °C. The following day, the cells were washed twice with PBS, incubated for an additional 2–3 h at 37 °C with MTT (0.5 mg/mL). Then, the supernatants were removed and 100 μL of DMSO was added. The absorbance was quantified at a 570 nm wavelength (Tecan Infinite® M200 PRO). Results are expressed as a percentage of the untreated control cells (without H2O2). Each point represents the mean of two experiments with each individual treatment being run in quadruplicate. Furthermore, different concentrations (0.75–6 mg protein/mL) of the SW-D-P3 fraction in the presence of 0,5 mM of H2O2 were evaluated for their cytotoxic effects in HT29 by the MTT assay.

2.5.2. Cellular Antioxidant Activity (CAA) Assay

CAA indicates the overall oxidative status by monitoring the decomposition of DCFH-DA in the cells and its oxidation by reactive oxygen species (ROS) into the fluorescent DCF [42,43]. Intracellular reactive oxygen species (ROS) levels were determined in the HT29 cells as described by Piccolomini et al. [43] and adapted by Feng et al. [44] with some modifications. Cells were seeded at 0.5 × 105 cells/well in 96-well plates for 24 h. Cells were washed with PBS and treated with 50 μL of BL-D-P3 or SW-D-P3 (6 mg protein/mL in DMEM) together with 50 μL of H2O2 (0.5 mM in DMEM) for 24 h. Afterwards, the cells were washed twice with PBS and treated with 100 μL of DCFH-DA (10 μM in PBS containing 0.2% methanol) for 30 min. Fluorescence at 485 nm/535 nm was recorded at 37 °C every 2 min for a total of 80 min using the VICTOR 2030 multilabel counter (Perkin Elmer, Waltham, MA, USA). CAA was measured in triplicate, and the experiment was performed three independent times. The results are expressed as a % of ROS generation to the untreated cells (without H2O2).

2.5.3. Cell Culture and Differentiation of THP-1

Cells of the human acute monocytic leukemia cell line THP-1 were maintained in RPMI 1640 supplemented with 10% (v/v) FBS, 10 U/mL of L-glutamine, 1 mM of sodium pyruvate, 100 U/mL of penicillin, 100 μg/mL of streptomycin and 100 μM of non-essential amino acids in a humidified incubator at 37 °C and 5% CO2. To induce differentiation into macrophage-like ones, monocytes were placed into 12-well plates at a cell density of 0.8 × 106 cells/mL and incubated with 100 ng/mL of PMA for 48 h [45,46,47,48]. Then, the PMA-contained medium was removed, and cells were washed with PBS and subsequently incubated for 24 h in the supplemented PMA-free RPMI-1640. After the resting phase, macrophages were incubated for 24 h in the presence of 100 ng/mL of lipopolysaccharide (LPS) and SW-D-P3 (3 mg protein/mL) or BL-D-P3 for 24 h. Each sample was tested in triplicate.

2.5.4. Quantification of mRNA Transcripts Using Real Time-PCR (qPCR)

Total RNA extraction of the attached THP-1 cells was performed using the Nucleozol reagent according to the manufacturer’s instructions. RNA samples were treated with DNase for the removal of the remaining DNA, and pure RNA was recovered by ethanol precipitation. The quantity and purity of RNA was calculated using a spectrophotometer (Q5000, Quawell Technology Inc., San Jose, CA, USA). Reverse transcription was performed from 500 ng of the total RNA with the PrimeScript RT reagent kit following the protocol of the manufacturer. A Real-Time thermal cycler (SaCycle–96, Sacace Biotechnologies, Como, Italy) was used for the qPCR using the FastGene 2× IC Green qPCR Universal Mix. Primers for target genes (SOD1, CAT, NFE2L2, NFKB1 and RELA) and housekeeping genes (RPS18, HPRT1, RPL37A and B2M) were designed across intron/exon boundaries with an annealing temperature of 60 °C. Each cDNA sample was tested in duplicate. The relative gene expression was calculated using the 2−ΔΔCt method. Primer details are listed in Table 1.

2.6. Statistical Analysis

The experimental results are reported as means ± the standard error of means (SEMs) of at least two biological replicates. All data were tested for normality using the Kolmogorov–Smirnov test and transformed in logarithmic or normalized form [49] where necessary until the data were normally distributed. Subsequently all data generated were compared using one-way ANOVA followed by Duncan’s post hoc test. Differences between means were considered significant at p < 0.05. The statistical analysis was performed using the SPSS for Windows statistical package program, version 22.0.0. Graphs were generated using the GraphPad Prism 8 program.

3. Results and Discussion

To evaluate whether gastrointestinal digestion affects the antioxidant activity of SW, the standardized INFOGEST static in vitro digestion model was applied. The antioxidant properties of SW, SW-Ds and SW-D-P3 were evaluated using a variety of methodological approaches. Due to the differences in the principle and mechanism of action of the different methods of antioxidant capacity evaluation, the use of only one antioxidant analysis can barely clarify the actual antioxidant status of samples [50]. Consequently, four different biochemical antioxidant methods are employed towards this aim, which can roughly be classified into two types, namely, assays based on hydrogen atom transfer (HAT) reactions and those based on single electron transfer (SET) [51]. HAT assays, such as ORAC, measure the ability of an antioxidant to inactivate a free radical (ROO·) by releasing a hydrogen atom in kinetic time. In contrast, assays that are dominated by SET-based reaction mechanisms, such as the end-point ABTS, measure the release of an electron to the (ROO·), converting it into an anion (ROO−) [52,53]. The latter causes a color change in the solution, indicating the concentration of the antioxidant. Thus, it was crucial to use at least one assay of each type in order to more completely evaluate the total antioxidant activity of a complex substrate such as SW. In addition, the cellular antioxidant activity of the SW-D-P3 fractions was evaluated using CAA in the HT29 intestinal cell line and expression of oxidative stress-related genes in the THP-1 monocytic cell line.

3.1. Assessment of Antioxidant Activity of SW before and after In Vitro Digestion Using ORAC, ABTS, FRAP and P-FRAP Biochemical Assays

The data shown in Table 2 indicate that the antioxidant activity of the samples after in vitro digestion was greatly increased, regardless of the biochemical method used. In all four assays, the antioxidant activity of SW was significantly increased SW-D>SW-D-P3>SW (p < 0.05). The digestive process had a positive effect on the antioxidant capacity of SW, represented by significant increases of around 2–4 fold on the ABTS, FRAP and P-FRAP assays after in vitro digestion, while an even greater augmentation was observed by the ORAC-FL assay (Table 2). In line with our results, there are other studies that report a significantly increased antioxidant activity of WPI after digestion, regardless of the assay used [37,54]. In addition, Garcia-Casas et al. [55] demonstrated that the bioaccessible fraction (corresponding to the SW-D samples of our study) of a SW-based beverage digestate exhibited an augmented antioxidant activity based on ABTS and FRAP. Since antioxidant compounds can use different mechanisms of action and each of the methods used evaluates their effect in a unique way, their evaluation of said compounds is complementary to each other. Namely, ABTS, FRAP and P-FRAP belong to the single-electron transfer (SET) assays while ORAC-FL belongs to the hydrogen atom transfer (HAT) assays. Interestingly, from our data in Table 2, the ORAC values showed a much-enhanced antioxidant activity for the SW samples after digestion, with an 8-fold increase, from 20.5 to 167.2 μmol TEs/g protein. Although Clausen et al. observed that the ORAC assay was more sensitive than ABTS in evaluating the scavenging of the peroxyl radicals of bovine whey proteins, it should be noted that this observation was made for intact whey proteins rather than fermented ones [56].
In Table 2, the values of P-FRAP show a significant increase (p < 0.05) of antioxidant activity after simulated gastrointestinal digestion (7.51 for SW to 26.9 μmol BHT eqv/g protein for SW-Ds). The results of the increased P-FRAP values after gastrointestinal digestion are in accordance with a previous study by Shaukat et al. on buffalo milk-processed cheddar cheese [57].
The overall observed increase in antioxidant capacity after digestion could be attributed to the release of peptides and free amino acids by the simulated gastrointestinal digestion [11]. Moreover, since SW results from a fermentation procedure, this could further enhance the release of antioxidant bioactive peptides [58].
Peptides released during an enzymatic hydrolysis process have considerable variability in size and structural characteristics [59], with peptides of relatively low molecular weight tending to display a relatively high antioxidant capacity [60,61]. Besides gastrointestinal digestion, such fragments can be also produced technologically using a broad range of exogenously supplied enzymes such as alcalase, chymotrypsin and flavourzyme [11,62]. From the data in Table 2, it is evident that the SW-D-P3 fraction accounts for the majority (65 to 85%) of the antioxidant capacity of the SW-Ds, regardless of the assay used. This indicates that the peptides with antioxidant activity are predominantly of lower molecular weight. Consistent with our results, Athira et al. reported that the antioxidant activity of WPC alcalase hydrolysed permeate (3 kDa) was augmented compared to WPC [63]. Similarly, another study indicated that the peptides between 0.1 to 2.8 kDa of WPI alcalase hydrolysate displayed the strongest radical scavenging activity [64]. Furthermore, O’Keeffe and Fitzgerald showed a greater antioxidant activity of WPC hydrolysate fractions with low molecular mass peptides (<5 kDa and <1 kDa) than WPC as measured by ORAC [65]. Also, a recent study of Ballatore et al. reported the highest antioxidant activity for the <3 kDa fraction obtained from trypsin-hydrolyzed WPC [19].

Effect of Milk Animal Origin

The antioxidant activities with the ORAC and ABTS assays for bovine, ovine, caprine and a mix of ovine and caprine of SW, SW-Ds and SW-D-P3 are shown in Figure 1, panels a and b, respectively. The ORAC values of antioxidant activity were highest for bovine SW (26.0 μmol TEs/g protein) compared with the other three groups (p < 0.05), whereas after in vitro digestion (SW-Ds and SW-D-P3), no significant differences were observed (p > 0.05). In contrast, the ABTS values of ovine SW were higher, compared to their bovine counterparts, both before (23.2 μmol TEs/g protein) and after in vitro digestion (49.0 μmol TEs/g protein for the SW-Ds). There were no statistically significant differences (p > 0.05) in the FRAP and P-FRAP values between the SW samples derived from cheeses made from the four different milk sources (Figure 1c,d, respectively).

3.2. Assessment of Cellular Antioxidant Activity of SW-D-P3

Food digestates are known to be cytotoxic to HT29 cells [66]. Thus, the HT29 cells were first exposed for 24 h to a range of concentrations of SW-D-P3 (0.75–6 mg protein/mL) to assess their cytotoxic effect. The MTT assay indicated that none of the concentration was cytotoxic. It was inferred that the concentration of the samples used in our study would not influence the activity of HT29 cells and thus would not affect the result of CAA. Therefore, the CAA assay was performed on the SW-D-P3 of a maximum concentration of 6 mg protein/mL. This concentration is in the range used in a previous study. In more detail, Kleekayai et al. evaluated the ROS generation in stressed HepG2 cells treated with hydrolysates of WPC at concentrations ranging from 0 to 10 mg/mL [67]. The highest concentration (10 mg/mL) exhibited the most potent cellular ROS generation reducing activity in the intracellular ROS generation in AAPH-stressed cells. Other studies reported a dose–response augmentation of CAA with the supplementation of whey proteins in different cell lines and are presented thoroughly in a review by Corrochano et al. [6].
The cell cytotoxicity of the oxidative stress inducer, H2O2, was also pre-evaluated at concentrations ranging from 0–2 mM in order to investigate their potential toxic effects on HT29 cells (Supplementary Data, Figure S1). A toxic effect yielding <80% cell viability was found at levels >1 mM. Due to the similar effects observed for H2O2 at concentrations below 1 mM, a concentration of 0.5 mM of H2O2 was selected to represent the oxidative stress inducer. Previous studies have reported the same range of H2O2 used as an oxidative stress inducer (0.25–0.7 mM) to evaluate the protective effect of food compounds [43,44,68,69]. Several studies have linked low-molecular size peptides with an improved antioxidant activity [64,70,71]. From our results in biochemical assays, it was concluded that the SW-D-P3 fraction was the one responsible for the majority of the antioxidant activity of digested SW. Therefore, in the present work, the HT29 epithelial cell line was used as a cellular model for the estimation of ROS% inhibition by SW-D-P3. The results presented in Figure 2 show that cell treatment with 6 mg protein/mL of SW-D-P3 significantly reduced radical formation in H2O2-treated cells, regardless of the SW milk origin, compared to the BL-D-P3 (p < 0.05). Furthermore, cell treatment with ovine SW-D-P3 significantly reduced the radical formation cells compared to the H2O2-treated group (p < 0.05), with a decrease of 14.97%, while the levels of radical formation for the cells treated with ovine and bovine SW-D-P3 did not differ significantly with those of the cells not treated with H2O2 (p > 0.05).
The results from previous studies regarding CAA determination in food and feed components after in vitro digestion using cell-based assays in various cell lines are scarce and are predominantly focused on non-dairy products. More specifically, CAA was found to be higher in digested whole grains compared to the free fraction in the HepG2 cell line [72]. Moreover, chickpea protein hydrolysate inhibited DCFH oxidation in a dose–response manner, and an increased CAA unit was noticed at higher hydrolysate protein concentrations [73]. A previous study by Zhang et al. [74] reported a decrease in ROS% generation in Caco-2 cells treated with soy protein hydrolysate compared to the H2O2 group. In another study [75], the digested and fractionated eggshell membrane (ESM) hydrolysate were evaluated in Caco-2 cells with AAPH used as a radical generator. In detail, the CAA of the digested ESM hydrolysate fraction with molecular weight of <5 kDa was higher compared with fractions of 5–10 kDa and >10 kDa. To the best of our knowledge, there are only two studies reporting CAA in eukaryotic cells in dairy-associated compounds after in vitro digestion. In the first one by Corrochano et al. [76], b-LG and a-LA, after in vitro digestion, effectively inhibited ROS and stimulated antioxidant enzymes in HT29 cells, while the same whey proteins were unable to reduce induced ROS formation in Caco-2 cells. Moreover, it should be noted that contrary to our results, they did not observe such an effect in WPI digestates. On the other hand, the second of these studies is in agreement with our results, as a better cellular antioxidant activity of digested WPI using the Caco-2 cell line was reported in response to H2O2 [77]. Interestingly, using a non-eukaryotic cell model, Ibrahim et al. reported a protective effect of camel milk protein hydrolysates (casein and whey hydrolysates separately) on yeast cells against H2O2-induced oxidative stress [78].

3.3. Effect of SW-D-P3 on Expression of Antioxidant Genes

In the present study, the relative gene expression of NFE2L2, SOD1 and CAT, essential components of antioxidant signaling pathways, was measured in response to treatment with SW-D-P3 in LPS-challenged THP-1-derived macrophages. Additionally, the expression of NFKB1 and RELA encoding the two main subunits of the NF-κB transcription factor was also quantified. The CAT expression was found to be higher in SW-D-P3-treated cells when compared to BL-D-P3, regardless of milk animal origin. This increase, however, was attenuated in the mixed and ovine samples when compared to the bovine and caprine ones (p < 0.05; Figure 3c). The SOD1 expression in turn was higher (p < 0.05; Figure 3b) only in the mixed samples when compared with BL-D-P3 and with the ovine and bovine samples but not with the caprine ones. On the other hand, no statistically significant differences were observed between the samples or with the BL-D-P3 regarding the NFE2L2 expression (p > 0.05; Figure 3a). Finally, the NFKB1 and RELA expressions (p < 0.05; Figure 3d,e, respectively) were found to be higher in the bovine and mixed SW-D-P3 compared to BL-D-P3.
In line with our results, Xu et al. also reported that treatment with WPC increases the enzymatic activity of SOD1 and CAT, while, at the same time, no significant differences were found in the NFE2L2 expression in the myoblast cell line C2C12 following H2O2 oxidative stress [79]. Kerasioti et al. reported similar findings for the effect of WPC on SOD1 and CAT enzymatic activities and protein levels and NFE2L2 protein levels in the same cell line without the use of an oxidative agent, while using the same experimental parameter treatment with WPC resulted also in the increase of NFE2L2 protein levels in EA.hy926 endothelial cells [80]. In another study, HepG2 cells were treated with various concentrations of a glucose–WPC conjugate for 24 h followed by t-BHP oxidative stress to evaluate the role of NFE2L2 in the maintenance of the cellular redox status, reporting a dose-dependent increase of NFE2L2 mRNA levels [81]. Furthermore, both the glutathione and catalase antioxidant systems are activated by WPC hydrolysate supplementation in human umbilical vein endothelial cells (HUVECs), resulting in an increase in cellular glutathione and CAT activity, albeit without the use of an oxidative stress factor [65]. Moreover, Corrochano et al. reported lower mRNA levels of CAT and SOD1 in Caco-2 cells after a 4 h exposure to gastrointestinal digested samples of WPI when compared to the digestion control (equivalent to the BL-D-P3 of the present study), though, once more, no oxidative stress factor was used [76].
Based on the data produced by the present study, the induction of the expression of SOD1 and CAT by SW-D-P3 seems to be independent of the NFE2L2 pathway and is rather directed by NF-κB. The NF-κB pathway has been implicated in the regulation of many antioxidant and pro-oxidant targets [27]. More specifically, NF-κB is identified as a positive regulator of SOD1 [82]. On the other hand, the role of NF-κB in regulation of the CAT expression is rather unclear as there are contradicting results supporting its role both as a negative [83] and as a positive [84] regulator of CAT. Our findings regarding the effect of SW-D-P3 in LPS-activated THP-1 support the latter and furthermore confirm the role of NF-κB in the induction of the SOD1 expression, although further experimentation is needed to clarify the precise mechanism of their regulation. Corrochano et al. quantified mRNA transcripts of the antioxidant genes SOD1 and CAT in intestinal cells that had been treated with 2.5 mg/mL of gastrointestinal bovine whey proteins (corresponding to the SW-Ds in our study) [76]. A recent study by Ishikawa evaluated some genes (e.g., IL6 and IL10) implicated in inflammation and immunosuppression in THP-1 cells stressed with LPS and treated with 5 mg/mL of a whey protein hydrolysate [85].
Human or animal intervention trials with diets including whey products are the best way to assess their potential antioxidant benefit. However, only a small number of studies have evaluated the antioxidant effect of whey proteins/peptides using in vivo models. Ebaid et al. observed that dietary supplementation with whey proteins enhances the normal inflammatory responses during wound healing in diabetic mice by restoring the levels of oxidative stress [86]. Furthermore, Athira et al. reported the ameliorative potential of whey protein hydrolysates against paracetamol-induced oxidative stress in mice, compared with mice without whey protein administration. A significant increase in liver CAT and SOD levels and a reduction of the concentrations of oxidative biomarkers, such as alkaline phosphatase and creatinine, was observed [87].
In general, to consider the physiological benefits of sweet whey, it is important to know that whey proteins do not reach the intestine in their intact form. Sousa et al. compared the total protein digestibility of WPI between in vitro and in vivo situations which resulted in a good correlation, with a tendency toward an overestimation for the in vitro approach [88]. The antioxidant capacity in commercial whey products, which are commonly used as food ingredients especially in the sports nutrition sector, is well known [6,89]. To the best of our knowledge, this is the first report in which SW from small-scale cheese plants is used as a raw material for evaluating antioxidant capacity before and after in vitro digestion. The protection produced by SW against in vitro-induced oxidative stress (biochemical and cellular assays) with different methodologies reveals that SW could be used in animal/human nutrition. As with all in vitro and cell culture experiments, there remains a possibility that these results may not translate to in vivo situations. Also, to address the limitations concerning the suitable concentration related to the clinical efficacy of SW, its physiological efficacy is necessary to be investigated in vivo, either in animal nutrition and/or human clinical trials.

4. Conclusions

In this research, SW of different milk origins was digested using a standardized static in vitro digestion method for mimicking monogastric gastrointestinal digestion. The samples were evaluated by multiple assays to test antioxidant activity, since a single assay is not sufficient to test all relevant factors affecting antioxidant capacity. All antioxidant properties of the SW-Ds were significantly higher than those of the intact SW. Of special interest was the evaluation of the antioxidant activity of SW-D-P3 directly in mammalian cell lines. Intestinal cell lines are the models proposed to better assess the in vitro antioxidant potential of a dietary compound. However, there is only a relatively small number of studies that employ cell culture models to assess the antioxidant potential of food and feed components. In conclusion, the present study showed that SW-D-P3 exerts an antioxidant effect both in epithelial and derived activated macrophage cell lines. Furthermore, a slightly better antioxidant capacity seems to be associated with bovine and ovine when compared to caprine SW. A validation of the observed differences could be achieved by in vivo animal studies or human clinical trials. Further investigation is also deemed necessary in order to determine the peptides’ sequences from SW with potential antioxidant activity in vivo.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antiox12091676/s1, Figure S1: Effect of different concentrations of oxidative stress inducer, hydrogen peroxide (H2O2), on HT29 cell viability.

Author Contributions

Conceptualization, G.T. and E.D.; methodology and investigation, E.D.; writing—original draft preparation, E.D.; writing—review and editing, G.T.; supervision, G.T.; project administration, G.T.; funding acquisition, I.P., G.T. and E.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was co-financed by Greece and the European Union (European Social Fund- ESF) through the Operational Programme “Human Resources Development, Education and Lifelong Learning” in the context of the project “Strengthening Human Resources Research Potential via Doctorate Research” (MIS 5000432), implemented by the State Scholarships Foundation (IKΥ). The results of this study are part of a research project (MIS 5033108) funded by the Operational Program of the Region of Epirus co-financed by Greece and the European Union—European Regional Development Fund (ERDF).

Institutional Review Board Statement

Ethical approval was not required for this work, as the study did not involve human or animal participants or samples.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The THP-1 cell line was kindly provided by Kletsas Dimitrios from the National Centre of Scientific Research Demokritos (Athens, Greece). We would like to thank Sofia Mavrikou for kindly providing us with the HT29 cell line and giving us access to the Tecan Infinite M200 Pro plate reader (Laboratory of Cell Technology, Agricultural University of Athens). We would also like to thank Maria Kapsokefalou for giving us access to the instruments (Epoch 2 microplate spectrophotometer and VICTOR 2030 multilabel counter) of the Laboratory of Food Chemistry and Analysis (Agricultural University of Athens). Finally, we would like to thank all the small cheese plants for providing us with sweet whey samples.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Bintsis, T.; Papademas, P. Sustainable Approaches in Whey Cheese Production: A Review. Dairy 2023, 4, 249–270. [Google Scholar]
  2. Barba, F.J. An integrated approach for the valorization of cheese whey. Foods 2021, 10, 564. [Google Scholar] [CrossRef] [PubMed]
  3. Aspri, M.; Leni, G.; Galaverna, G.; Papademas, P. Bioactive properties of fermented donkey milk, before and after in vitro simulated gastrointestinal digestion. Food Chem. 2018, 268, 476–484. [Google Scholar] [CrossRef] [PubMed]
  4. Akan, E. An evaluation of the in vitro antioxidant and antidiabetic potentials of camel and donkey milk peptides released from casein and whey proteins. J. Food Sci. Technol. 2021, 58, 3743–3751. [Google Scholar] [CrossRef]
  5. Kleekayai, T.; O’neill, A.; Clarke, S.; Holmes, N.; O’sullivan, B.; Fitzgerald, R.J. Contribution of Hydrolysis and Drying Conditions to Whey Protein Hydrolysate Characteristics and In Vitro Antioxidative Properties. Antioxidants 2022, 11, 399. [Google Scholar] [CrossRef]
  6. Corrochano, A.R.; Buckin, V.; Kelly, P.M.; Giblin, L. Invited review: Whey proteins as antioxidants and promoters of cellular antioxidant pathways. J. Dairy Sci. 2018, 101, 4747–4761. [Google Scholar] [CrossRef] [PubMed]
  7. Tong, L.M.; Sasaki, S.; McClements, D.J.; Decker, E.A. Antioxidant activity of whey in a salmon oil emulsion. J. Food Sci. 2000, 65, 1325–1329. [Google Scholar] [CrossRef]
  8. Tong, L.M.; Sasaki, S.; McClements, D.J.; Decker, E.A. Mechanisms of the antioxidant activity of a high molecular weight fraction of whey. J. Agric. Food Chem. 2000, 48, 1473–1478. [Google Scholar] [CrossRef]
  9. Carrasco-Castilla, J.; Hernández-Álvarez, A.J.; Jiménez-Martínez, C.; Jacinto-Hernández, C.; Alaiz, M.; Girón-Calle, J.; Vioque, J.; Dávila-Ortiz, G. Antioxidant and metal chelating activities of peptide fractions from phaseolin and bean protein hydrolysates. Food Chem. 2012, 135, 1789–1795. [Google Scholar] [CrossRef]
  10. Hayes, M.; Ross, R.P.; Fitzgerald, G.F.; Stanton, C. Putting microbes to work: Diary fermentation, cell factories and bioactive peptides. Part I: Overview. Biotechnol. J. 2007, 2, 426–434. [Google Scholar] [CrossRef]
  11. Bustamante, S.Z.; González, J.G.; Sforza, S.; Tedeschi, T. Bioactivity and peptide profile of whey protein hydrolysates obtained from Colombian double-cream cheese production and their products after gastrointestinal digestion. LWT 2021, 145, 111334. [Google Scholar] [CrossRef]
  12. Guo, Y.; Jiang, X.; Xiong, B.; Zhang, T.; Zeng, X.; Wu, Z.; Sun, Y.; Pan, D. Production and transepithelial transportation of angiotensin-I-converting enzyme (ACE)-inhibitory peptides from whey protein hydrolyzed by immobilized Lactobacillus helveticus proteinase. J. Dairy Sci. 2019, 102, 961–975. [Google Scholar] [CrossRef]
  13. Wolfe, K.L.; Rui, H.L. Cellular antioxidant activity (CAA) assay for assessing antioxidants, foods, and dietary supplements. J. Agric. Food Chem. 2007, 55, 8896–8907. [Google Scholar] [CrossRef]
  14. Faller, A.L.K.; Fialho, E.; Liu, R.H. Cellular antioxidant activity of Feijoada whole meal coupled with an in vitro digestion. J. Agric. Food Chem. 2012, 60, 4826–4832. [Google Scholar] [CrossRef]
  15. Bothon, F.T.D.; Debiton, E.; Avlessi, F.; Forestier, C.; Teulade, J.C.; Sohounhloue, D.K.C. In vitro biological effects of two anti-diabetic medicinal plants used in Benin as folk medicine. BMC Complement. Altern. Med. 2013, 13, 51. [Google Scholar] [CrossRef]
  16. Girard-Lalancette, K.; Pichette, A.; Legault, J. Sensitive cell-based assay using DCFH oxidation for the determination of pro- and antioxidant properties of compounds and mixtures: Analysis of fruit and vegetable juices. Food Chem. 2009, 115, 720–726. [Google Scholar] [CrossRef]
  17. Wan, H.; Liu, D.; Yu, X.; Sun, H.; Li, Y. A Caco-2 cell-based quantitative antioxidant activity assay for antioxidants. Food Chem. 2015, 175, 601–608. [Google Scholar] [CrossRef]
  18. Kellett, M.E.; Greenspan, P.; Pegg, R.B. Modification of the cellular antioxidant activity (CAA) assay to study phenolic antioxidants in a Caco-2 cell line. Food Chem. 2018, 244, 359–363. [Google Scholar] [CrossRef] [PubMed]
  19. Ballatore, M.B.; Bettiol, M.D.R.; Vanden Braber, N.L.; Aminahuel, C.A.; Rossi, Y.E.; Petroselli, G.; Erra-Balsells, R.; Cavaglieri, L.R.; Montenegro, M.A. Antioxidant and cytoprotective effect of peptides produced by hydrolysis of whey protein concentrate with trypsin. Food Chem. 2020, 319, 126472. [Google Scholar] [CrossRef]
  20. Nam, M.H.; Son, W.R.; Yang, S.Y.; Lee, Y.S.; Lee, K.W. Chebulic acid inhibits advanced glycation end products-mediated vascular dysfunction by suppressing ROS via the ERK/Nrf2 pathway. J. Funct. Foods 2017, 36, 150–161. [Google Scholar] [CrossRef]
  21. Clementi, M.E.; Lazzarino, G.; Sampaolese, B.; Brancato, A.; Tringali, G. DHA protects PC12 cells against oxidative stress and apoptotic signals through the activation of the NFE2L2/HO-1 axis. Int. J. Mol. Med. 2019, 43, 2523–2531. [Google Scholar] [CrossRef]
  22. Zhao, D.; Jiang, Y.; Sun, J.; Li, H.; Huang, M.; Sun, X.; Zhao, M. Elucidation of The Anti-Inflammatory Effect of Vanillin In Lps-Activated THP-1 Cells. Nutrition 2019, 84, 1920–1928. [Google Scholar] [CrossRef]
  23. Saw, C.L.; Wu, Q.; Kong, A.N.T. Anti-cancer and potential chemopreventive actions of ginseng by activating Nrf2 (NFE2L2) anti-oxidative stress/anti-inflammatory pathways. Chin. Med. 2010, 5, 37. [Google Scholar] [CrossRef] [PubMed]
  24. Dias, K.A.; da Conceição, A.R.; Pereira, S.M.S.; Oliveira, L.A.; da Silva Rodrigues, J.V.; Dias, R.S.; de Paula, S.O.; Natali, A.J.; da Matta, S.L.P.; Gonçalves, R.V.; et al. Curcumin-Added Whey Protein Positively Modulates Skeletal Muscle Inflammation and Oxidative Damage after Exhaustive Exercise. Nutrients 2022, 14, 4905. [Google Scholar] [CrossRef]
  25. Jung, K.A.; Kwak, M.K. The Nrf2 system as a potential target for the development of indirect antioxidants. Molecules 2010, 15, 7266–7291. [Google Scholar] [CrossRef] [PubMed]
  26. Treml, J.; Večeřová, P.; Herczogová, P.; Šmejkal, K. Direct and indirect antioxidant effects of selected plant phenolics in cell-based assays. Molecules 2021, 26, 2534. [Google Scholar] [CrossRef]
  27. Morgan, M.J.; Liu, Z.-G. Crosstalk of reactive oxygen species and NF-κB signaling NF-κB. Nat. Publ. Gr. 2011, 21, 103–115. [Google Scholar] [CrossRef]
  28. Brodkorb, A.; Egger, L.; Alminger, M.; Alvito, P.; Assunção, R.; Ballance, S.; Bohn, T.; Bourlieu-Lacanal, C.; Boutrou, R.; Carrière, F.; et al. INFOGEST static in vitro simulation of gastrointestinal food digestion. Nat. Protoc. 2019, 14, 991–1014. [Google Scholar] [CrossRef]
  29. Minekus, M.; Alminger, M.; Alvito, P.; Ballance, S.; Bohn, T.; Bourlieu, C.; Carrière, F.; Boutrou, R.; Corredig, M.; Dupont, D.; et al. A standardised static in vitro digestion method suitable for food-an international consensus. Food Funct. 2014, 5, 1113–1124. [Google Scholar] [CrossRef]
  30. Ou, B.; Hampsch-Woodill, M.; Prior, R.L. Development and validation of an improved oxygen radical absorbance capacity assay using fluorescein as the fluorescent probe. J. Agric. Food Chem. 2001, 49, 4619–4626. [Google Scholar] [CrossRef]
  31. Zulueta, A.; Maurizi, A.; Frígola, A.; Esteve, M.J.; Coli, R.; Burini, G. Antioxidant capacity of cow milk, whey and deproteinized milk. Int. Dairy J. 2009, 19, 380–385. [Google Scholar] [CrossRef]
  32. Zulueta, A.; Esteve, M.J.; Frígola, A. ORAC and TEAC assays comparison to measure the antioxidant capacity of food products. Food Chem. 2009, 114, 310–316. [Google Scholar] [CrossRef]
  33. Ozgen, M.; Reese, R.N.; Tulio, A.Z.; Scheerens, J.C.; Miller, A.R. Modified 2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) method to measure antioxidant capacity of selected small fruits and comparison to ferric reducing antioxidant power (FRAP) and 2,2′-diphenyl-1- picrylhydrazyl (DPPH) methods. J. Agric. Food Chem. 2006, 54, 1151–1157. [Google Scholar] [CrossRef] [PubMed]
  34. Feng, Y.; Yuan, D.; Cao, C.; Kong, B.; Sun, F.; Xia, X.; Liu, Q. Changes of in vitro digestion rate and antioxidant activity of digestion products of ethanol-modified whey protein isolates. Food Hydrocoll. 2022, 131, 107756. [Google Scholar] [CrossRef]
  35. Benzie, I.F.F.; Strain, J.J. The Ferric Reducing Ability of Plasma (FRAP) as a Measure of “Antioxidant Power”: The FRAP Assay. Anal. Biochem. 1996, 239, 70–76. [Google Scholar] [CrossRef]
  36. González-Centeno, M.R.; Jourdes, M.; Femenia, A.; Simal, S.; Rosselló, C.; Teissedre, P.L. Proanthocyanidin composition and antioxidant potential of the stem winemaking byproducts from 10 different grape varieties (Vitis vinifera L.). J. Agric. Food Chem. 2012, 60, 11850–11858. [Google Scholar]
  37. Corrochano, A.R.; Sariçay, Y.; Arranz, E.; Kelly, P.M.; Buckin, V.; Giblin, L. Comparison of antioxidant activities of bovine whey proteins before and after simulated gastrointestinal digestion. J. Dairy Sci. 2019, 102, 54–67. [Google Scholar] [CrossRef]
  38. Oyaizu, M. Studies on Products of Browning Reaction Antioxidative Activities of Products of Browning Reaction Prepared from Glucosamine. Jpn. J. Nutr. Diet. 1986, 44, 307–315. [Google Scholar] [CrossRef]
  39. Liang, T.; Yue, W.; Li, Q. Comparison of the phenolic content and antioxidant activities of apocynum venetum l. (Luo-Bu-Ma) and two of its alternative species. Int. J. Mol. Sci. 2010, 11, 4452–4464. [Google Scholar] [CrossRef]
  40. Sánchez-Velázquez, O.A.; Mulero, M.; Cuevas-Rodríguez, E.O.; Mondor, M.; Arcand, Y.; Hernández-Álvarez, A.J. In vitro gastrointestinal digestion impact on stability, bioaccessibility and antioxidant activity of polyphenols from wild and commercial blackberries (Rubus spp.). Food Funct. 2021, 12, 7358–7378. [Google Scholar] [CrossRef] [PubMed]
  41. Armstrong, D. Advanced Protocols in Oxidative Stress III; Elsevier: Amsterdam, The Netherlands, 2014; pp. 1–477. [Google Scholar] [CrossRef]
  42. Lind, K.F.; Hansen, E.; Østerud, B.; Eilertsen, K.E.; Bayer, A.; Engqvist, M.; Leszczak, K.; Jørgensen, T.; Andersen, J.H. Antioxidant and Anti-Inflammatory Activities of Barettin. Mar. Drugs 2013, 11, 2655–2666. [Google Scholar] [CrossRef] [PubMed]
  43. Piccolomini, A.F.; Iskandar, M.M.; Lands, L.C.; Kubow, S. High hydrostatic pressure pre-treatment of whey proteins enhances whey protein hydrolysate inhibition of oxidative stress and IL-8 secretion in intestinal epithelial cells. Food Nutr. Res. 2012, 56, 17549. [Google Scholar] [CrossRef]
  44. Feng, L.; Peng, F.; Wang, X.; Li, M.; Lei, H.; Xu, H. Identification and characterization of antioxidative peptides derived from simulated in vitro gastrointestinal digestion of walnut meal proteins. Food Res. Int. 2019, 116, 518–526. [Google Scholar] [CrossRef] [PubMed]
  45. Chanput, W.; Mes, J.; Vreeburg, R.A.M.M.; Savelkoul, F.J.; Wichers, H.J.; Savelkoul, H.F.J.; Wichers, H.J. Transcription profiles of LPS-stimulated THP-1 monocytes and macrophages: A tool to study inflammation modulating effects of food-derived compounds. Food Funct. 2010, 1, 254–261. [Google Scholar] [CrossRef] [PubMed]
  46. Chanput, W.; Mes, J.J.; Wichers, H.J. International Immunopharmacology THP-1 cell line: An in vitro cell model for immune modulation approach. Int. Immunopharmacol. 2014, 23, 37–45. [Google Scholar] [CrossRef]
  47. Baxter, E.W.; Graham, A.E.; Re, N.A.; Carr, I.M.; Robinson, J.I.; Mackie, S.L.; Morgan, A.W. Standardized protocols for differentiation of THP-1 cells to macrophages with distinct M(IFNγ+LPS), M(IL-4) and M(IL-10) phenotypes. J. Immunol. Methods 2019, 478, 112721. [Google Scholar] [CrossRef]
  48. Daigneault, M.; Preston, J.A.; Marriott, H.M.; Whyte, M.K.B.; Dockrell, D.H. The identification of markers of macrophage differentiation in PMA-stimulated THP-1 cells and monocyte-derived macrophages. PLoS ONE 2010, 5, e8668. [Google Scholar] [CrossRef]
  49. Templeton, G.F.; Templeton, G.F. A two-step approach for transforming continuous variables to normal: Implications and recommendations for IS research. Commun. Assoc. Inf. Syst. 2011, 28, 41–58. [Google Scholar] [CrossRef]
  50. Cho, S.J. Changes in the antioxidant properties of rice bran protein isolate upon simulated gastrointestinal digestion. LWT 2020, 126, 109206. [Google Scholar] [CrossRef]
  51. Huang, D.; Prior, R.L. The Chemistry behind Antioxidant Capacity Assays. Agric. Food Chem. 2005, 53, 841–1856. [Google Scholar] [CrossRef]
  52. Di Meo, F.; Lemaur, V.; Cornil, J.; Lazzaroni, R.; Duroux, J.L.; Olivier, Y.; Trouillas, P. Free radical scavenging by natural polyphenols: Atom versus electron transfer. J. Phys. Chem. A 2013, 117, 2082–2092. [Google Scholar] [CrossRef]
  53. Zou, T.B.; He, T.P.; Li, H.B.; Tang, H.W.; Xia, E.Q. The structure-activity relationship of the antioxidant peptides from natural proteins. Molecules 2016, 21, 72. [Google Scholar] [CrossRef]
  54. Giromini, C.; Lovegrove, J.A.; Givens, D.I.; Rebucci, R.; Pinotti, L.; Maffioli, E.; Tedeschi, G.; Sundaram, T.S.; Baldi, A. In vitro-digested milk proteins: Evaluation of angiotensin-1-converting enzyme inhibitory and antioxidant activities, peptidomic profile, and mucin gene expression in HT29-MTX cells. J. Dairy Sci. 2019, 102, 10760–10771. [Google Scholar] [CrossRef] [PubMed]
  55. García-Casas, V.E.; Seiquer, I.; Pardo, Z.; Haro, A.; Recio, I.; Olías, R. Antioxidant Potential of the Sweet Whey-Based Beverage Colada after the Digestive Process and Relationships with the Lipid and Protein Fractions. Antioxidants 2022, 11, 1827. [Google Scholar] [CrossRef]
  56. Clausen, M.R.; Skibsted, L.H.; Stagsted, J. Characterization of major radical scavenger species in bovine milk through size exclusion chromatography and functional assays. J. Agric. Food Chem. 2009, 57, 2912–2919. [Google Scholar] [CrossRef] [PubMed]
  57. Shaukat, A.; Nadeem, M.; Qureshi, T.M.; Kanwal, R.; Sultan, M.; Kashongwe, O.B.; Shamshiri, R.R.; Murtaza, M.A. Effect of in vitro digestion on the antioxidant and angiotensin-converting enzyme inhibitory potential of Buffalo milk processed cheddar cheese. Foods 2021, 10, 1661. [Google Scholar] [CrossRef]
  58. Stobiecka, M.; Król, J.; Brodziak, A. Antioxidant Activity of Milk and Dairy Products. Animals 2022, 12, 245. [Google Scholar] [CrossRef]
  59. Vogelsang-O’dwyer, M.; Sahin, A.W.; Bot, F.; O’mahony, J.A.; Bez, J.; Arendt, E.K.; Zannini, E. Enzymatic hydrolysis of lentil protein concentrate for modification of physicochemical and techno-functional properties. Eur. Food Res. Technol. 2023, 249, 573–586. [Google Scholar] [CrossRef]
  60. Salami, M.; Moosavi-Movahedi, A.A.; Ehsani, M.R.; Yousefi, R.; Haertlé, T.; Chobert, J.M.; Razavi, S.H.; Henrich, R.; Balalaie, S.; Ebadi, S.A.; et al. Improvement of the antimicrobial and antioxidant activities of camel and bovine whey proteins by limited proteolysis. J. Agric. Food Chem. 2010, 58, 3297–3302. [Google Scholar] [CrossRef] [PubMed]
  61. Peña-Ramos, E.A.; Xiong, Y.L.; Arteaga, G.E. Fractionation and characterisation for antioxidant activity of hydrolysed whey protein. J. Sci. Food Agric. 2004, 84, 1908–1918. [Google Scholar] [CrossRef]
  62. Tavano, O.L. Protein hydrolysis using proteases: An important tool for food biotechnology. J. Mol. Catal. B Enzym. 2013, 90, 1–11. [Google Scholar] [CrossRef]
  63. Athira, S.; Mann, B.; Saini, P.; Sharma, R.; Kumar, R.; Singh, A.K. Production and characterisation of whey protein hydrolysate having antioxidant activity from cheese whey. J. Sci. Food Agric. 2015, 95, 2908–2915. [Google Scholar] [CrossRef] [PubMed]
  64. Peng, X.; Kong, B.; Xia, X.; Liu, Q. Reducing and radical-scavenging activities of whey protein hydrolysates prepared with Alcalase. Int. Dairy J. 2010, 20, 360–365. [Google Scholar] [CrossRef]
  65. O’Keeffe, M.B.; FitzGerald, R.J. Antioxidant effects of enzymatic hydrolysates of whey protein concentrate on cultured human endothelial cells. Int. Dairy J. 2014, 36, 128–135. [Google Scholar] [CrossRef]
  66. Le Maux, S.; Bouhallab, S.; Giblin, L.; Brodkorb, A.; Croguennec, T. Complexes between linoleate and native or aggregated β-lactoglobulin: Interaction parameters and in vitro cytotoxic effect. Food Chem. 2013, 141, 2305–2313. [Google Scholar] [CrossRef]
  67. Kleekayai, T.; Le Gouic, A.V.; Deracinois, B.; Cudennec, B.; FitzGerald, R.J. In vitro characterisation of the antioxidative properties of whey protein hydrolysates generated under pH- And non pH-controlled conditions. Foods 2020, 9, 582. [Google Scholar] [CrossRef] [PubMed]
  68. García Fillería, S.; Tironi, V. Intracellular antioxidant activity and intestinal absorption of amaranth peptides released using simulated gastrointestinal digestion with Caco-2 TC7 cells. Food Biosci. 2021, 41, 101086. [Google Scholar] [CrossRef]
  69. García-Nebot, M.J.; Recio, I.; Hernández-Ledesma, B. Antioxidant activity and protective effects of peptide lunasin against oxidative stress in intestinal Caco-2 cells. Food Chem. Toxicol. 2014, 65, 155–161. [Google Scholar] [CrossRef]
  70. Chen, M.; Li, B. The effect of molecular weights on the survivability of casein-derived antioxidant peptides after the simulated gastrointestinal digestion. Innov. Food Sci. Emerg. Technol. 2012, 16, 341–348. [Google Scholar] [CrossRef]
  71. Kong, B.; Peng, X.; Xiong, Y.L.; Zhao, X. Protection of lung fibroblast MRC-5 cells against hydrogen peroxide-induced oxidative damage by 0.1–2.8 kDa antioxidative peptides isolated from whey protein hydrolysate. Food Chem. 2012, 135, 540–547. [Google Scholar] [CrossRef]
  72. Gong, E.S.; Gao, N.; Li, T.; Chen, H.; Wang, Y.; Si, X.; Tian, J.; Shu, C.; Luo, S.; Zhang, J.; et al. Effect of in Vitro Digestion on Phytochemical Profiles and Cellular Antioxidant Activity of Whole Grains. J. Agric. Food Chem. 2019, 67, 7016–7024. [Google Scholar] [CrossRef]
  73. Torres-Fuentes, C.; Contreras, M.D.M.; Recio, I.; Alaiz, M.; Vioque, J. Identification and characterization of antioxidant peptides from chickpea protein hydrolysates. Food Chem. 2015, 180, 194–202. [Google Scholar] [CrossRef] [PubMed]
  74. Zhang, Q.; Tong, X.; Qi, B.; Wang, Z.; Li, Y.; Sui, X.; Jiang, L. Changes in antioxidant activity of Alcalase-hydrolyzed soybean hydrolysate under simulated gastrointestinal digestion and transepithelial transport. J. Funct. Foods 2018, 42, 298–305. [Google Scholar] [CrossRef]
  75. Shi, Y.; Kovacs-Nolan, J.; Jiang, B.; Tsao, R.; Mine, Y. Antioxidant activity of enzymatic hydrolysates from eggshell membrane proteins and its protective capacity in human intestinal epithelial Caco-2 cells. J. Funct. Foods 2014, 10, 35–45. [Google Scholar] [CrossRef]
  76. Corrochano, A.R.; Arranz, E.; De Noni, I.; Stuknytė, M.; Ferraretto, A.; Kelly, P.M.; Buckin, V.; Giblin, L. Intestinal health benefits of bovine whey proteins after simulated gastrointestinal digestion. J. Funct. Foods 2018, 49, 526–535. [Google Scholar] [CrossRef]
  77. Ma, Y.; Xu, J.; Guo, R.; Teng, G.; Chen, Y.; Xu, X. In vitro gastrointestinal model for the elderly: Effect of high hydrostatic pressure on protein structures and antioxidant activities of whey protein isolate. Food Biosci. 2023, 52, 102452. [Google Scholar] [CrossRef]
  78. Ibrahim, H.R.; Isono, H.; Miyata, T. Potential antioxidant bioactive peptides from camel milk proteins. Anim. Nutr. 2018, 4, 273–280. [Google Scholar] [CrossRef] [PubMed]
  79. Xu, R.; Liu, N.; Xu, X.; Kong, B. Antioxidative effects of whey protein on peroxide-induced cytotoxicity. J. Dairy Sci. 2011, 94, 3739–3746. [Google Scholar] [CrossRef]
  80. Kerasioti, E.; Stagos, D.; Tzimi, A.; Kouretas, D. Increase in antioxidant activity by sheep/goat whey protein through nuclear factor-like 2 (Nrf2) is cell type dependent. Food Chem. Toxicol. 2016, 97, 47–56. [Google Scholar] [CrossRef] [PubMed]
  81. Pyo, M.C.; Yang, S.Y.; Chun, S.H.; Oh, N.S.; Lee, K.W. Protective Effects of Maillard Reaction Products of Whey Protein Concentrate against Oxidative Stress through an Nrf2-Dependent Pathway in HepG2 Cells. Biol. Pharm. Bull. 2016, 39, 1437–1447. [Google Scholar] [CrossRef]
  82. Rojo, A.I.; Salinas, M.; Martín, D.; Perona, R.; Cuadrado, A. Regulation of Cu/Zn-Superoxide Dismutase Expression via the Phosphatidylinositol 3 Kinase/Akt Pathway and Nuclear Factor-κB. J. Neurosci. 2004, 24, 7324–7334. [Google Scholar] [CrossRef] [PubMed]
  83. Schreiber, J.; Jenner, R.G.; Murray, H.L.; Gerber, G.K.; Gifford, D.K.; Young, R.A. Coordinated binding of NF-kappaB family members in the response of human cells to lipopolysaccharide. Proc. Natl. Acad. Sci. USA 2006, 103, 5899–5904. [Google Scholar] [CrossRef]
  84. Zhou, L.Z.H.; Johnson, A.P.; Rando, T.A. NF kappa B and AP-1 mediate transcriptional responses to oxidative stress in skeletal muscle cells. Free Radic. Biol. Med. 2001, 31, 1405–1416. [Google Scholar] [CrossRef] [PubMed]
  85. Ishikawa, F.; Matsubara, T.; Koyama, T.; Iwamoto, H.; Miyaji, K. Whey protein hydrolysate mitigates both inflammation and endotoxin tolerance in THP-1 human monocytic leukemia cells. Immunity Inflamm. Dis. 2022, 10, e737. [Google Scholar] [CrossRef] [PubMed]
  86. Ebaid, H.; Salem, A.; Sayed, A.; Metwalli, A. Whey protein enhances normal inflammatory responses during cutaneous wound healing in diabetic rats. Lipids Health Dis. 2011, 10, 235. [Google Scholar] [CrossRef] [PubMed]
  87. Athira, S.; Mann, B.; Sharma, R.; Kumar, R. Ameliorative potential of whey protein hydrolysate against paracetamol-induced oxidative stress. J. Dairy Sci. 2013, 96, 1431–1437. [Google Scholar] [CrossRef]
  88. Sousa, R.; Recio, I.; Heimo, D.; Dubois, S.; Moughan, P.J.; Hodgkinson, S.M.; Portmann, R.; Egger, L. In vitro digestibility of dietary proteins and in vitro DIAAS analytical workflow based on the INFOGEST static protocol and its validation with in vivo data. Food Chem. 2023, 404, 134720. [Google Scholar] [CrossRef] [PubMed]
  89. Manninen, A.H. Protein hydrolysates in sports nutrition. Nutr. Metab. 2009, 6, 38. [Google Scholar] [CrossRef]
Antioxidants 12 01676 g001
Figure 1. Antioxidant activity of sweet whey before (SW) and after in vitro digestion (digested SW (SW-Ds) and digested fraction below 3 kDa (SW-D-P3)) assessed with (a) oxygen radical absorbance capacity assay, expressed as μmol of TEs per gram of protein; (b) 2,2′-Azinobis (3- ethylbenzothiazoline-6-sulfonic acid), expressed as μmol of TE per gram of protein; (c) ferric reducing antioxidant power assay, expressed as μmol of TE per gram of protein; and (d) potassium ferricyanide reducing power, expressed as μmol of BHA per gram of protein. Results represent the mean of 3 experimental repetitions ± SEM (n = 12). Columns with different letters within the same panel are significantly different (p < 0.05).
Figure 1. Antioxidant activity of sweet whey before (SW) and after in vitro digestion (digested SW (SW-Ds) and digested fraction below 3 kDa (SW-D-P3)) assessed with (a) oxygen radical absorbance capacity assay, expressed as μmol of TEs per gram of protein; (b) 2,2′-Azinobis (3- ethylbenzothiazoline-6-sulfonic acid), expressed as μmol of TE per gram of protein; (c) ferric reducing antioxidant power assay, expressed as μmol of TE per gram of protein; and (d) potassium ferricyanide reducing power, expressed as μmol of BHA per gram of protein. Results represent the mean of 3 experimental repetitions ± SEM (n = 12). Columns with different letters within the same panel are significantly different (p < 0.05).
Antioxidants 12 01676 g001
Antioxidants 12 01676 g002
Figure 2. Reactive oxygen species (ROS)% generation in HT29 cells (seeded at 5 × 104 cells/well) after 24 h exposure to sweet whey after gastrointestinal digestion with peptides below 3 kDa (SW-D-P3) at a concentration of 6 mg protein/mL. Non-treated cells = cells without H2O2, H2O2-treated = cells treated with 0.5 mM of H2O2, caprine, ovine, bovine and a mix of caprine/ovine = SW-D-P3 and blank = BL-D-P3, all treated with 0.5 mM H2O2. Cell treatment was performed in triplicate on three different days, and the values reported are mean ± SEM. Columns with different letters are significantly different (p < 0.05).
Figure 2. Reactive oxygen species (ROS)% generation in HT29 cells (seeded at 5 × 104 cells/well) after 24 h exposure to sweet whey after gastrointestinal digestion with peptides below 3 kDa (SW-D-P3) at a concentration of 6 mg protein/mL. Non-treated cells = cells without H2O2, H2O2-treated = cells treated with 0.5 mM of H2O2, caprine, ovine, bovine and a mix of caprine/ovine = SW-D-P3 and blank = BL-D-P3, all treated with 0.5 mM H2O2. Cell treatment was performed in triplicate on three different days, and the values reported are mean ± SEM. Columns with different letters are significantly different (p < 0.05).
Antioxidants 12 01676 g002
Antioxidants 12 01676 g003
Figure 3. Effect of SW-D-P3 on LPS-induced mRNA expression in THP-1 cells. THP-1 cells were pretreated with PMA for 48 h (100 ng/mL), a 24 h rest and then were treated with LPS (100 ng/mL) with or without the presence of 3 mg protein/mL of SW-D-P3 (caprine, ovine, mix and bovine) or BL-D-P3 (blank) for 24 h. The expression levels of (a) NFE2L2, (b) SOD1, (c) CAT, (d) NFKB1 and (e) RELA were measured using real-time PCR and were normalized to four housekeeping genes (B2M, RPL37A, RPS18 and HPRT1). Data are represented as mean ± SEM of three independent determinations (n = 3). Columns with different letters within the same panel are significantly different (p < 0.05); ns = not significant (p > 0.05).
Figure 3. Effect of SW-D-P3 on LPS-induced mRNA expression in THP-1 cells. THP-1 cells were pretreated with PMA for 48 h (100 ng/mL), a 24 h rest and then were treated with LPS (100 ng/mL) with or without the presence of 3 mg protein/mL of SW-D-P3 (caprine, ovine, mix and bovine) or BL-D-P3 (blank) for 24 h. The expression levels of (a) NFE2L2, (b) SOD1, (c) CAT, (d) NFKB1 and (e) RELA were measured using real-time PCR and were normalized to four housekeeping genes (B2M, RPL37A, RPS18 and HPRT1). Data are represented as mean ± SEM of three independent determinations (n = 3). Columns with different letters within the same panel are significantly different (p < 0.05); ns = not significant (p > 0.05).
Antioxidants 12 01676 g003
Table 1. Oligonucleotide primer sequences, amplicon size and reaction efficiency in qPCR.
Table 1. Oligonucleotide primer sequences, amplicon size and reaction efficiency in qPCR.
Gene
(Accesion Number)		Primer
Direction		Sequence (5′-3′)Amplicon SizeReaction
Efficiency
SOD1
(NM_000454)		ForwardCGAGCAGAAGGAAAGTAATGG19495
ReverseCCAAGTCTCCAACATGCC
CAT
(NM_001752)		ForwardTGCCTATCCTGACACTCACC13792
ReverseGAGCACCACCCTGATTGTC
NFE2L2
(NM_001145412)		ForwardGATCTGCCAACTACTCCCA12190
ReverseGCCGAAGAAACCTCATTGTC
NFKB1
(NM_001165412)		ForwardGCACAAGGAGACATGAAACAG18997
ReverseCCCAGAGACCTCATAGTTGTC
RELA
(NM_001145138)		ForwardGGACTACGACCTGAATGCTG228105
ReverseACCTCAATGTCCTCTTTCTGC
RPS18
(NM_022551)		ForwardCTGAGGATGAGGTGGAACG24098
ReverseCAGTGGTCTTGGTGTGCT
HPRT1
(NM_000194)		ForwardCTTTGCTTTCCTTGGTCAGG11199
ReverseCAAATCCAACAAAGTCTGGCT
RPL37A
(NM_000998)		ForwardAGTACACTTGCTCTTTCTGTGG119106
ReverseGGAAGTGGTATTGTACGTCCAG
B2M
(NM_004048)		ForwardGCTATCCAGCGTACTCCA285103
ReverseCTTAACTATCTTGGGCTGTGAC
Table 2. Antioxidant activity by ABTS (2,2′-azinobis (3-ethylbenzothiazoline-6-sulfonic acid)), ORAC-FL (Oxygen Radical Absorbance Capacity-Fluorescence), FRAP (ferric reducing antioxidant power) and P-FRAP (potassium ferricyanide reducing power) of sweet whey before (SW) and after in vitro digestion (SW-Ds and SW-D-P3) regardless of milk origin.
Table 2. Antioxidant activity by ABTS (2,2′-azinobis (3-ethylbenzothiazoline-6-sulfonic acid)), ORAC-FL (Oxygen Radical Absorbance Capacity-Fluorescence), FRAP (ferric reducing antioxidant power) and P-FRAP (potassium ferricyanide reducing power) of sweet whey before (SW) and after in vitro digestion (SW-Ds and SW-D-P3) regardless of milk origin.
Method (Units)SWSW-DsSW-D-P3
ABTS
(μmol TEs/g protein)		20.3 ± 0.8 a46.2 ± 0.8 c38.7 ± 0.6 b
ORAC-FL
(μmol TEs/g protein)		20.5 ± 1.0 a167.2 ± 4.8 c122.3 ± 3.9 b
FRAP
(μmol TEs/g protein)		10.9 ± 0.5 a31.4 ± 1.3 c21.3 ± 0.6 b
P-FRAP
(μmol BHT eqv/g protein)		7.5 ± 0.3 a26.9 ± 0.8 c18.7 ± 0.6 b
Values are means ± SEM (n = 48). Mean values in each row with different letters are significantly different (one-way ANOVA and Duncan test, p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dalaka, E.; Politis, I.; Theodorou, G. Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion. Antioxidants 2023, 12, 1676. https://doi.org/10.3390/antiox12091676

AMA Style

Dalaka E, Politis I, Theodorou G. Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion. Antioxidants. 2023; 12(9):1676. https://doi.org/10.3390/antiox12091676

Chicago/Turabian Style

Dalaka, Eleni, Ioannis Politis, and Georgios Theodorou. 2023. "Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion" Antioxidants 12, no. 9: 1676. https://doi.org/10.3390/antiox12091676

APA Style

Dalaka, E., Politis, I., & Theodorou, G. (2023). Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion. Antioxidants, 12(9), 1676. https://doi.org/10.3390/antiox12091676

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop