Next Article in Journal
Strawberry and Drupe Fruit Wines Antioxidant Activity and Protective Effect Against Induced Oxidative Stress in Rat Synaptosomes
Previous Article in Journal
Analysis of Polyphenols from Polygala major Jacq
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 14
Issue 2
10.3390/antiox14020154
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Resveratrol Protects Photoreceptors in Mouse Models of Retinal Degeneration

by
Shujuan Li
,
Hongwei Ma
and
Xi-Qin Ding
*
Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73104, USA
*
Author to whom correspondence should be addressed.
Antioxidants 2025, 14(2), 154; https://doi.org/10.3390/antiox14020154
Submission received: 27 November 2024 / Revised: 22 January 2025 / Accepted: 24 January 2025 / Published: 28 January 2025
(This article belongs to the Special Issue Oxidative Stress in Ophthalmic Diseases)
Browse Figures
Versions Notes

Abstract

:
Photoreceptor/retinal degeneration is the major cause of blindness. Induced and inherited mouse models of retinal degeneration are valuable tools for investigating disease mechanisms and developing therapeutic interventions. This study investigated the potential of the antioxidant resveratrol to relieve photoreceptor degeneration using mouse models. Clinical studies have shown a potential association between thyroid hormone (TH) signaling and age-related retinal degeneration. Excessive TH signaling induces oxidative stress/damage and photoreceptor death in mice. C57BL/6 (rod-dominant) and Nrl−/− (cone-dominant) mice at postnatal day 30 (P30) received triiodothyronine (T3) via drinking water (20 µg/mL) with or without concomitant treatment with resveratrol via drinking water (120 µg/mL) for 30 days, followed by evaluation of photoreceptor degeneration, oxidative damage, and retinal stress responses. In experiments using Leber congenital amaurosis model mice, mother Rpe65−/− and Rpe65−/−/Nrl−/− mice received resveratrol via drinking water (120 µg/mL) for 20 days and 10–13 days, respectively, beginning on the day when the pups were at P5, and pups were then evaluated for cone degeneration. Treatment with resveratrol significantly diminished the photoreceptor degeneration induced by T3 and preserved photoreceptors in Rpe65-deficient mice, manifested as preserved retinal morphology/outer nuclear layer thickness, increased cone density, reduced photoreceptor oxidative stress/damage and apoptosis, reduced upregulation of genes involved in cell death/inflammatory responses, and reduced macroglial cell activation. These findings demonstrate the role of oxidative stress in photoreceptor degeneration, associated with TH signaling and Rpe65 deficiency, and support the therapeutic potential of resveratrol/antioxidants in the management of retinal degeneration.

1. Introduction

Rod and cone photoreceptors are specialized sensory neurons in the retina responsible for capturing visual information. Rods are responsible for dim light vision, whereas cones are responsible for bright light vision, color vision, and visual acuity. Progressive photoreceptor degeneration occurs in inherited retinal diseases, such as Leber congenital amaurosis (LCA), retinitis pigmentosa, and cone–rod dystrophies, and age-related retinal diseases, such as age-related macular degeneration and diabetic retinopathy. This degeneration ultimately leads to vision impairment and blindness. The highly heterogeneous nature of these diseases is a challenge for the development of therapeutic strategies, and there are currently no cures for retinal degeneration. Nevertheless, mouse models of induced or inherited retinal degeneration remain valuable tools for studying disease mechanisms and exploring therapeutic strategies.
Thyroid hormone (TH) signaling is known to regulate cell proliferation, differentiation, and metabolic homeostasis. Clinical studies have shown that abnormalities in TH signaling are linked to neurodegenerative conditions/dementia in the elderly, including Alzheimer’s disease [1,2,3] and age-related retinal disease [4,5,6,7,8,9,10,11,12,13]. Optical coherence tomography evaluations have further demonstrated macular thinning in patients with thyroid-associated ophthalmopathy [14,15]. In the retina, TH signaling plays a significant role in photoreceptor cell death and survival. Studies in mice have shown that excessive TH signaling, whether through triiodothyronine (T3) treatment or deletion of the T3-degrading enzyme DIO3, leads to retinal oxidative stress/damage and photoreceptor degeneration [16,17,18]. Moreover, transcriptomic analysis revealed that excessive TH signaling impairs mitochondrial bioenergetics and induces cellular stress in mouse photoreceptors [19]. In contrast, suppression of TH signaling reduced photoreceptor degeneration in mouse models of retinal degeneration, including the LCA model of Rpe65-deficient mice [16,20,21,22,23]. LCA is a severe autosomal recessive blinding disease that appears at birth or in the first few months of life and affects 2–3 out of 100,000 births [24]. The disease accounts for blindness in over 20% of children attending schools for the blind. There are about twenty-four genes that are associated with LCA. Among these, mutations in the RPE65 gene, which encodes the retinal pigment epithelium-specific isomerohydrolase RPE65, account for approximately 16% of all LCA cases (https://sph.uth.edu/retnet/).
Resveratrol is a natural polyphenolic compound abundant in grape juice, cereals, peanuts, pine, and berries [25,26] and possesses potent antioxidant properties [27,28]. This study aimed to determine the beneficial effects of resveratrol in mice of both induced and inherited retinal degeneration. Specifically, we examined the effects of resveratrol in mice treated with T3 and in an LCA model of Rpe65-deficient mice. We showed that treatment with resveratrol significantly mitigated T3-induced photoreceptor degeneration and preserved photoreceptors in Rpe65-deficient mice. This study demonstrated the role of oxidative stress/damage in retinal degeneration in the examined models, and the findings support the potential therapeutic application of resveratrol/antioxidants in the management of retinal degeneration.

2. Materials and Methods

2.1. Mice, Antibodies, and Reagents

The C57BL/6J mouse line was obtained from the Jackson Laboratory. The Nrl−/− mouse line [29] was provided by Dr. Anand Swaroop (Neurobiology Neurodegeneration & Repair Laboratory, NEI), and the Rpe65−/− mouse line [30] was provided by Dr. T. Michael Redmond (Laboratory of Retinal Cell and Molecular Biology, NEI). The Rpe65−/−/Nrl−/− line was generated by cross-breeding [21,30,31]. All mice were maintained under cyclic-light (12 h light–dark) conditions. Cage illumination was ~7 foot candles during the light cycle. All animal maintenance and experiments were approved by the local Institutional Animal Care and Use Committee (University of Oklahoma Health Sciences Center, protocol number: 23-038-EH) and conformed to the guidelines on the Care and Use of Animals of the Society for Neuroscience and the Association for Research in Vision and Ophthalmology (Rockville, MD, USA). Mice of both genders were used. The antibodies and reagents used in the experiments were listed in Table 1.

2.2. Treatment with T3 and Resveratrol

T3 for drinking water administration was prepared as described previously [32]. Ten milligrams of T3 (Sigma-Aldrich, St. Louis, MO, USA, Catalog#: T2877) was dissolved in 1.0 mL of 1.0 N NaOH, followed by dilution with tap water for a final working concentration of 20 µg/mL. For resveratrol drinking water preparation, 12 mg of resveratrol (Sigma-Aldrich, Catalog#: R5010) was dissolved in 200 μL of absolute ethanol, and then diluted in 100 mL tap water to a final working concentration of 120 µg/mL [33]. Water bottles were covered with aluminum foil to avoid light exposure, and the drinking water was replaced weekly. Postnatal day 30 (P30) C57BL/6 and Nrl−/− mice received T3 with or without concomitant treatment of resveratrol for 30 days. Control/untreated mice received vehicle for resveratrol (0.2% ethanol in drinking water). At the end of the treatments, the eyes/retinas of these mice were collected for analysis of photoreceptor viability/cell death and cellular stress responses. Due to the early onset and rapid degeneration in Rpe65-deficient mice, antioxidant treatment was initiated at a young age. Mother Rpe65−/− and Rpe65−/−/Nrl−/− mice received resveratrol via drinking water (120 µg/mL) or vehicle for 20 days and 10–13 days, respectively, beginning on the day when the pups were at P5. At the end of the treatments, eyes/retinas of pups were collected for analysis of photoreceptor viability/cell death and cellular stress responses.

2.3. Eye Preparation, Immunofluorescence Labeling, Confocal Microscopy, and Morphometric Analysis

Mouse retinal whole mounts or cross sections were prepared for immunofluorescence labeling and morphometric analysis as described previously [16,17,21]. For retinal whole-mount preparations, eyes were enucleated, marked at the superior (dorsal) pole with a green dye for orientation, then fixed in 4% paraformaldehyde (PFA) (Polysciences, Inc., Warrington, PA, USA) for 60 min at room temperature, followed by removal of the cornea and lens. The eyes were then fixed in 4% PFA for 4–6 h at room temperature, the retinas were isolated, and the superior portion was marked for orientation with a small cut. For retinal cross sections, the superior portion of the cornea was marked with green dye for dorsal orientation, and mouse eyes were enucleated and fixed in Prefer (Anatech Ltd., Battle Creek, MI, USA) for 25 min at room temperature. Fixed eyes were stored in 70% ethanol until processing for sections. Paraffin sections (5 µm thickness) passing vertically through the retina (along the vertical meridian passing through the optic nerve head) were prepared using a Leica microtome (Leica Biosystems, Nussloch, Germany).
Immunofluorescence labeling was performed as described previously [16,17,21]. In brief, retinal whole mounts were blocked with Hanks’ balanced salt solution containing 10% bovine serum albumin (BSA) (Sigma-Aldrich) and 0.5% Triton X-100 (Bio-Rad, Hercules, CA, USA) for 1 h at room temperature. Peanut-agglutinin (PNA) immunohistochemistry was achieved by biotinylated PNA labeling overnight at 4 °C and then streptavidin-Cy3 labeling at room temperature for 1 h. For immunofluorescence labeling on retinal sections, after deparaffinization and rehydration steps, antigen retrieval was conducted in 25 mM Tris (PH = 8.5) and 1 mM EDTA buffer [34] for 30 min in a 70.5 °C water bath. Primary antibody incubation was performed overnight at 4 °C, followed by incubation with Alexa FluorTM 555 goat anti-rabbit secondary antibody at room temperature for 2 h. Table 1 shows the dilutions of the antibodies used. Immunofluorescent signals were imaged using an Olympus FV1000 confocal laser scanning microscope (Olympus, Melville, NY, USA) with FluoView imaging software (Olympus). Evaluation of cone density on retinal whole mounts, evaluation of GFAP fluorescence density on retinal sections, and quantitative analysis of the number of p-γH2AX-positive cells were performed as described previously [17,35]. For retinal morphometric analysis, retinal cross sections stained with hematoxylin and eosin (H&E) were used to evaluate outer nuclear layer (ONL) thickness/rod survival, as described previously [17,36,37].

2.4. TUNEL Assay

Terminal deoxynucleotidyltransferase dUTP nick-end labeling (TUNEL) was performed on paraffin-embedded retinal sections, using an In Situ Cell-Death Fluorescein-Detection kit (Sigma-Aldrich, Catalog#: 11684795910), as described previously [38]. Immunofluorescence signals were imaged using an Olympus FV1000 confocal laser-scanning microscope. TUNEL-positive cells in the ONL passing through the optic nerve were counted and averaged from at least three sections per eye, from 3 to 11 mice per condition.

2.5. Retinal Protein Preparation, SDS-PAGE, and Western Blot Analysis

Retinal protein preparation, SDS-PAGE, and Western blot analysis were prepared as described previously [21,23,39]. Retinal tissues were homogenized in homogenization buffer (0.32 M sucrose, 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.4, and 3 mM EDTA containing protease and phosphatase inhibitors (Roche Applied Science, Indianapolis, IN, USA, Catalog #: 04693159001 and Catalog #: 04906837001, respectively)). The homogenates were centrifuged at 3000 rpm for 10 min at 4 °C, and the resulting supernatant was then centrifuged at 13,000 rpm for 35 min at 4 °C to separate cytosolic (supernatant) and membrane (pellet) fractions. The cytosolic fractions were used, and protein concentrations were measured with a protein assay kit from Bio-Rad Laboratories. Retinal protein samples were subjected to SDS-PAGE and transferred to PVDF membranes, which were subsequently blocked in 5% BSA for 1 h at room temperature. Immunoblots were incubated with primary antibody overnight at 4 °C. Table 1 shows dilutions of the antibodies used. After washing in Tris-buffered saline with 0.1% Tween 20, immunoblots were incubated with HRP-conjugated anti-rabbit or anti-mouse secondary antibody for 1 h at room temperature. SuperSignal® West Dura Extended Duration chemiluminescent substrate (Thermo Fisher Scientific, Carlsbad, CA, USA) was used to detect binding of the primary antibodies to their cognate antigens. Li-Cor Odyssey CLx Imager and Li-Cor software (Li-Cor Biosciences, Lincoln, NE, USA) were used for detection and densitometric analysis.

2.6. RNA Isolation and Quantitative Real-Time PCR

Total RNA preparation and reverse transcription were performed as described previously [36,37]. Briefly, retinas were lysed and RNA isolated using the PureLinkTM RNA kit (Thermo Fisher Scientific) as per the manufacturer’s instructions. cDNA was prepared using iScript Reverse Transcription Supermix (Bio-Rad), and the obtained cDNA was amplified using iTaq Universal SYBR® Green Supermix (Bio-Rad). The primer sets are listed in Table 2. The gene encoding the mouse hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1) was included as an internal control. The quantitative real-time PCR (qRT-PCR) assays were performed using a CFX connected Real-Time PCR Detection System (iCycler, Bio-Rad Laboratories, Hercules, CA, USA). All assessed genes were run in triplicate, and the relative gene expression was calculated based on the ΔΔCt method with conditions normalized to Hprt1.

2.7. Statistical Analysis

Results are expressed as means ± SEM of the number of mice or the number of assays. One-way ANOVA was used to test for significant differences within sets of data, and the unpaired Student’s t test was used to assess significance between two groups of data. Differences were considered statistically significant when p < 0.05. Data were analyzed and graphed using GraphPad Prism® software (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. Treatment with Resveratrol Mitigated T3-Induced Photoreceptor Cell Loss/Degeneration in C57BL/6 Mice

We first examined whether treatment with resveratrol will preserve photoreceptors. P30 C57BL/6 mice received T3 treatment (20 µg/mL in drinking water) without or with concomitant treatment of resveratrol (120 µg/mL in drinking water) for 30 days, followed by evaluation of rod and cone survival/degeneration. Retinal integrity/rod survival was evaluated by morphometric analysis on H&E-stained retinal sections. The analysis showed photoreceptor layer damage after T3 treatment, including reduced ONL thickness and a shortened outer segment (Figure 1A). Concomitant treatment with resveratrol significantly preserved retinal morphology and reduced photoreceptor/rod cell loss. The ONL thickness in the central retina was reduced by about 25% in mice after T3 treatment, and treatment with resveratrol prevented the cell loss and preserved ONL thickness (Figure 1A). Cone survival/degeneration was evaluated by PNA labeling on retinal whole mounts. Treatment with T3 reduced cone density by about 70% compared with untreated controls. Concomitant treatment with resveratrol significantly increased cone density compared with mice receiving T3 only (Figure 1B). We also evaluated the expression levels of the cone-specific protein cone arrestin (CAR) in the retina by immunoblotting. The expression level of CAR was significantly reduced after T3 treatment, and concomitant treatment with resveratrol increased the expression of CAR compared with mice receiving T3 only (Figure 1C). These data show that treatment with resveratrol mitigated T3-induced photoreceptor cell loss/degeneration.

3.2. Treatment with Resveratrol Reduced T3-Induced Photoreceptor Apoptosis in C57BL/6 and Nrl−/− Mice

We next examined the effects of resveratrol on T3-induced photoreceptor apoptosis. Both C57BL/6 and Nrl−/− mice were used. Mice lacking NRL, a rod-specific neural retina leucine zipper transcriptional factor, have a cone-dominant retina [29]. The use of Nrl−/− mice facilitates the evaluations of cones owing to the sparse number of cones in a mouse retina (cones represent only 3–5% of the total photoreceptor population in a murine retina). The detrimental effects of excessive TH signaling have also been shown in Nrl−/− mice [17]. P30 mice received T3 treatment (20 µg/mL in drinking water) without or with concomitant treatment of resveratrol (120 µg/mL in drinking water) for 30 days, followed by evaluation of photoreceptor apoptosis using TUNEL on retinal cross sections. The numbers of TUNEL-positive cells in T3-treated C57BL/6 and Nrl−/− mice were significantly increased compared with their respective untreated controls (Figure 2). Concomitant treatment with resveratrol greatly reduced T3-induced photoreceptor apoptosis (Figure 2).

3.3. Treatment with Resveratrol Reduced T3-Induced Oxidative Stress/Damage in C57BL/6 and Nrl−/− Mice

We further evaluated the effects of resveratrol on T3-induced oxidative stress/damage in the retina. P30 C57BL/6 and Nrl−/− mice received T3 treatment (20 µg/mL in drinking water) without or with concomitant treatment of resveratrol (120 µg/mL in drinking water) for 30 days and were then analyzed for oxidative damage using labeling of the DNA damage marker p-γH2AX on retinal cross sections. Treatment with T3 greatly increased the number of p-γH2AX-positive cells in C57BL/6 and Nrl−/− mice compared with their respective untreated controls (Figure 3). Concomitant treatment of resveratrol greatly diminished this increase in C57BL/6 mice (Figure 3A) and completely abolished the increase in Nrl−/− mice (Figure 3B) compared with mice that were treated with T3 only. These data show that treatment with resveratrol reduced T3-induced oxidative stress/damage in the retina.

3.4. Treatment with Resveratrol Inhibited T3-Induced Macroglial Cell Activation and Upregulation of Genes Involved in Cell Stress/Death and Inflammatory Responses in C57BL/6 and Nrl−/− Mice

Macroglial cells (Müller cells and astrocytes) activate in response to retinal stress insults via increased expression of glial fibrillary acidic protein (GFAP) [40], and treatment with T3 increases expression of GFAP [17]. In this work, we examined the effect of resveratrol on T3-induced macroglial cell activation. P30 C57BL/6 and Nrl−/− mice received T3 treatment (20 µg/mL in drinking water) without or with concomitant treatment with resveratrol (120 µg/mL in drinking water) for 30 days and were then analyzed for macroglial cell activation by GFAP labeling on retinal cross sections and by immunoblotting. The fluorescence density of GFAP was increased by about 3-fold in mice after T3 treatment (Figure 4A,B). Concomitant treatment with resveratrol greatly diminished the GFAP signal in C57BL/6 mice (Figure 4A) and completely abolished the increase in Nrl−/− mice (Figure 4B) compared with mice treated with T3 only. Consistent with the findings in GFAP labeling, immunoblotting of GFAP using retinal protein extracts showed that the level of GFAP was increased by 1-fold in the T3-treated mice compared with untreated controls, and treatment with resveratrol significantly diminished this elevation (Figure 4C). We also examined the effects of resveratrol on T3-induced upregulation of the genes involved in oxidative stress, cell death signaling, and inflammation. Several genes regulating oxidative stress (Gss, Ctsb, Ehd2), cell death signaling (Tnf1α, Tnfrsf9, Ripk1, Ripk3, Casp-8), and inflammation (Il-1α, Il-1β) were significantly upregulated in the retinas of mice after T3 treatment, whereas treatment with resveratrol inhibited these elevations (Figure 4D).

3.5. Treatment with Resveratrol Preserved Cones in Rpe65−/− and Rpe65−/−/Nrl−/− Mice

Rpe65−/− and Rpe65−/−/Nrl−/− mice display early-onset and rapid cone degeneration and have been commonly used as models for studies of LCA [30,31,41,42]. In this work, we examined the effects of resveratrol. Mother Rpe65−/− and Rpe65−/−/Nrl−/− mice received resveratrol (120 µg/mL in drinking water) or vehicle for 20 days and 10–13 days, respectively, beginning on the day when the pups were at P5, and pups were then evaluated for cone degeneration. Cone density evaluation on Rpe65−/− mice by PNA labeling showed a degeneration pattern similar to that reported previously [42,43], i.e., the ventral retina shows early-onset, fast cone degeneration (about 10% of the wild-type level remained at P30), whereas the peripheral dorsal retina was relatively less degenerated (about 50% of the wild-type level remained at P30). Treatment with resveratrol effectively preserved cones in both dorsal and ventral areas. Cone density was increased by about 20–30% in the dorsal area and about 2-fold in the ventral area, compared with untreated controls (Figure 5A). Immunoblotting analysis was performed using retinal protein extracts prepared from Rpe65−/−/Nrl−/− mice and showed that the level of CAR was greatly increased in resveratrol-treated mice compared with untreated controls (Figure 5B).

3.6. Treatment with Resveratrol Reduced Photoreceptor Apoptosis in Rpe65−/− and Rpe65−/−/Nrl−/− Mice

We then examined the effects of resveratrol on photoreceptor apoptosis in Rpe65-deficient mice.
Mother Rpe65−/− and Rpe65−/−/Nrl−/− mice received resveratrol (120 µg/mL in drinking) or vehicle for 20 days and 10–13 days, respectively, beginning on the day when the pups were at P5, and pups were then evaluated for photoreceptor apoptosis. The number of TUNEL-positive cells in Rpe65−/− and Rpe65−/−/Nrl−/− mice was significantly higher than that in their respective controls (Figure 6). Treatment with resveratrol reduced this number by about 50% in Rpe65−/− mice (Figure 6A) and about 45% in Rpe65−/−/Nrl−/− mice (Figure 6B) compared with their respective untreated controls.

3.7. Treatment with Resveratrol Inhibited Macroglial Cell Activation and Upregulation of Genes Involved in Cell Stress/Death and Inflammatory Responses in Rpe65−/− and Rpe65−/−/Nrl−/− Mice

We further examined the effects of resveratrol on the retinal stress response/macroglial cell activation in Rpe65-deficient mice. Mother Rpe65−/− and Rpe65−/−/Nrl−/− mice received resveratrol (120 µg/mL in drinking water) or vehicle for 20 days and 10–13 days, respectively, beginning on the day when the pups were at P5, and pups were then evaluated for GFAP expression by immunofluorescence labeling and immunoblotting. The fluorescence density of GFAP in Rpe65−/− and Rpe65−/−/Nrl−/− mice was greatly increased compared with their respective controls (Figure 7A,B). Treatment with resveratrol completely abolished the elevation in Rpe65−/− mice (Figure 7A) and greatly diminished the elevation in Rpe65−/−/Nrl−/− mice (Figure 7B) compared with their respective untreated controls. Consistent with the findings in GFAP labeling, immunoblotting of GFAP using retinal protein extracts showed that the level of GFAP was significantly increased in Rpe65−/− mice compared with wild-type (C57BL/6) controls, and treatment with resveratrol abolished this elevation (Figure 7C). We also examined the effects of resveratrol on the expression of genes involved in cell death, oxidative stress, and inflammation. Several genes regulating oxidative stress (Nox4, Ucp2, Gss, Ctsb, Ehd2), cell death (Tnfrsf1α, Ripk3, Casp-3, Casp-8), and inflammation (Nirp3, Il-6, Il-1β) were significantly elevated in Rpe65−/− and Rpe65−/−/Nrl−/− mice, whereas treatment with resveratrol inhibited these elevations (Figure 7D).

4. Discussion

4.1. Resveratrol Preserves Photoreceptors Against TH-Induced Degeneration

It has been well documented that excessive TH signaling induces rod and cone degeneration and cell death, accompanied by oxidative stress/damage [16,17,18,19]. In this work, we evaluated the effects of resveratrol to address the role of oxidative stress in TH-signaling-induced photoreceptor degeneration and explore its potential therapeutic benefits. Treatment with resveratrol led to rod and cone protection against T3-induced damage, as shown by increased ONL thickness, cone density, and expression of cone arrestin, a reduced number of TUNEL-positive cells and oxidative stress/damage, and inhibition of the upregulation of genes involved in the cellular stress response and death process. As TUNEL-positive cells were mainly detected in the ONL, where photoreceptors are localized, it is likely that the dying cells are photoreceptors. However, TUNEL and immunofluorescence double-labeling with a photoreceptor-specific marker would provide stronger evidence for photoreceptor death. These results support the role of oxidative stress in T3-induced photoreceptor degeneration. Similar results have been reported previously, showing that administration of N-acetyl cysteine (an antioxidant) reduces T3-induced cone degeneration and retinal stress [17]. Clinical studies have shown that abnormalities in TH signaling are linked to age-related retinal degeneration [4,5,6,7,8,9,10,11,12,13], and our findings support the beneficial role of resveratrol/antioxidants in the management of age-related retinal degeneration. It should be mentioned that, although the effects of resveratrol were observed, the dose-dependent effects merit further investigation to better establish the drug effects.
The protection profiles of the rods and cones were somewhat distinguished. ONL thickness, which mainly reflects rod number/integrity, was nearly completely rescued in mice after resveratrol treatment (Figure 1A), whereas cone density and the expression levels of cone arrestin were partially rescued (Figure 1B,C). This observation suggests that other factors in addition to oxidative stress play a role in T3-induced cone degeneration. A discrepancy in the effects of resveratrol on cell death/apoptosis and ONL thickness was noted. T3-induced cell death/apoptosis evaluated by TUNEL was partially suppressed by resveratrol, whereas T3-induced reduction in ONL thickness evaluated by H&E staining was nearly completely rescued after treatment with resveratrol. At this time, it is unclear how the nearly complete rescue of retinal morphology/ONL thickness with only partial rescue of cell death was achieved. This observation suggests that oxidative stress/damage may only partially contribute to the apoptotic cell death in these retinas. It is also likely that the apoptotic cell death was not the only trigger for the reduction in ONL thickness and other types of cell death mechanisms (such as necroptosis) may have contributed to the observed reduction and responded to resveratrol. Nevertheless, the involvement of various cell death processes/mechanisms in the models studied warrants further investigations.
Notably, no functional rescue was observed in this study. T3 treatment reduced retinal function, as shown by the reduced scotopic and photopic electroretinogram (ERG) responses, similar to previous reports [17]. Concomitant treatment with resveratrol did not significantly rescue the rod and cone light responses (data not shown). The partial rescue of the cell death/cone numbers seemed insufficient for functional rescue. The resveratrol treatment conditions (dose, duration, etc.) used appeared insufficient to rescue the T3-induced deterioration of photoreceptor function, including the expression levels of phototransduction components, and to rescue the T3-induced photoreceptor degeneration to a level that is sufficient for functional recovery. We would anticipate that higher doses of resveratrol may lead to functional protection, at least in part. Further studies with adjusted experimental conditions would provide additional insight.

4.2. Resveratrol Preserves Photoreceptors Against Rpe65 Deficiency

Mouse models of Rpe65 deficiency (Rpe65−/− and Rpe65−/−/Nrl−/− mice) display early-onset and rapid cone degeneration, and have been commonly used as models in studies of LCA [30,31,41,42]. The precise mechanism of cone degeneration in Rpe65 deficiency is not known so far. It is generally accepted that a deficiency in visual chromophores leads to cone opsin/protein mislocalization and cellular stress. We presumed that treatment with an antioxidant might relieve cone degeneration, at least in part, in Rpe65-deficient mice and examined the effects of resveratrol. As anticipated, treatment with resveratrol preserved cones in these mice, rescued cone arrestin expression, and reduced cell death/apoptosis. More significantly, several genes involved in oxidative stress were upregulated in Rpe65-deficient mice and treatment with resveratrol significantly reduced or abolished these upregulations. To our knowledge, this is the first report showing the protection of an antioxidant/resveratrol in Rpe65-deficient mice. The findings support the role of oxidative stress in Rpe65-deficient photoreceptor degeneration and the therapeutic value of resveratrol/antioxidants in the management of LCA. It should be mentioned that, although the effects of resveratrol were observed, the dose-dependent effects merit further investigation to better establish the drug effects.
The mechanism underlying oxidative stress in Rpe65 deficiency is yet to be determined. This could involve various factors/regulations. One of them might be associated with TH signaling, which plays a significant role in LCA cone degeneration. Inhibition of TH signaling by anti-thyroid treatment [16], targeting iodothyronine deiodinases [21,22,44], or targeting the TH receptor [23] preserved cones in Rpe65-deficient mice. Moreover, evaluation of the expression levels of TH signaling components in the retina, including iodothyronine deiodinases and TH receptors [21,23], suggests potential locally elevated TH signaling activity. Together with the beneficial effects of anti-TH signaling approaches, the findings from this study showing the beneficial effects of resveratrol suggest the potential contribution of TH signaling, at least in part, to oxidative stress in Rpe65-deficient retinas.

4.3. Resveratrol Reduces Retinal Stress Responses Induced by TH Signaling and Rpe65 Deficiency

Macroglial cells (Müller cells and astrocytes) are the principal glial cells in the retina that serve as sentinel/safeguard cells in response to insult/harmful stimuli. Their activation is characterized by increased expression of GFAP and formation of intermediate filaments [45]. Macroglial cell activation has been shown in a variety of animal models of retinal degeneration, including retinal detachment [46], retinal ischemia-reperfusion [47], Royal College of Surgeons rats [48], rd mice [49], and light-induced retinal degeneration [50,51]. The expression of GFAP, evaluated by immunolabeling on retinal sections and immunoblotting, was significantly increased in mice after T3 treatment, and treatment with resveratrol nearly completely reversed these elevations. These data are consistent with a previous report showing that treatment with NAC reversed T3-induced macroglial cell activation [17]. Our recent transcriptomic studies showed that there were approximately 180 differentially expressed genes in Müller glial cells and approximately 160 differentially expressed genes in astrocytes after T3 treatment [19]. It is likely that the activation of macroglial cells in response to T3 treatment resulted from both photoreceptor stress/degeneration and the direct action of T3 on these cells. Similarly, the observed reduction in GFAP labeling/macroglial cell activation in mice treated with resveratrol may result from both reduced photoreceptor stress/degeneration and the reduced stress responses of macroglial cells themselves per se. Similarly, Rpe65-deficient mice displayed profound activation of macroglial cells, and treatment with resveratrol nearly completely abolished the activation of these cells, supporting that antioxidants reduce retinal stress responses in these mice. The effect of resveratrol in reducing retinal stress responses was also supported by gene expression analysis. qRT-PCR data showed that a number of genes involved in oxidative stress responses, cell death signaling, and inflammatory responses were significantly upregulated in the retinas of mice treated with T3 and Rpe65-deficient mice. Treatment with resveratrol effectively inhibited or abolished these upregulations, supporting its role in mitigating retinal stress and inflammation.

4.4. The Benefits of Resveratrol in Animal Models of Retinal Diseases and the Potential Underlying Mechanisms

Previous studies have shown that resveratrol exerts potential benefits in animal models of retinal degeneration, including diabetic retinopathy [52,53], retinopathy of prematurity [54,55], a drug-induced rat model of retinitis pigmentosa [56], a light-induced retinal degeneration model [57], and glaucoma [28,58,59]. TH signaling has been shown to induce photoreceptor degeneration, and abnormal serum TH levels have been linked to retinal degeneration. This study demonstrates the beneficial effects of resveratrol, supporting the role of oxidative stress in TH-induced retinal degeneration. This work also demonstrates the beneficial role of resveratrol in mouse models of LCA with Rpe65 deficiency, supporting the role of oxidative stress in disease progression. To our knowledge, this is the first study to evaluate the role of resveratrol in inherited mouse models of retinal degeneration.
The benefits of resveratrol observed in various animal models are likely mediated by its anti-inflammatory, antioxidant, and anti-angiogenic properties, which protect retinal cells from damage and reduce abnormal blood vessel growth in the retina. The present study explored the potential mechanism of resveratrol’s action by examining alterations in gene expression. We found that several genes regulating oxidative stress, cellular necroptosis signaling, and inflammation were significantly upregulated in the retinas of mice after T3 treatment and in the retinas of Rpe65-deficient mice, whereas treatment with resveratrol inhibited these elevations. These observations are consistent with previous findings supporting resveratrol as an antioxidant and anti-inflammatory agent in the retina. At the molecular level, resveratrol induces the NAD+-dependent deacetylase Sirtuin 1, which regulates cellular processes related to longevity and stress resistance [60], inhibits mitogen-activated protein kinase, and increases phosphorylation of Akt1 [54,61], leading to the reduction in cellular stress and cellular protection.

4.5. Limitations of the Study

This study has several limitations. First, only one dose of resveratrol was administered. This could have contributed to the observed partial rescue of retinal morphology/cell death and lack of retinal functional improvement. In a dose–response study, we may identify an optimized dose condition that allows us to see an improved rescue of the retinal phenotype. We anticipate that higher doses of resveratrol may lead, at least in part, to functional rescue. Second, the longitudinal effects of resveratrol were not evaluated in this study. In addition, the evaluation of cell death could have been more thorough and informative. Cell death, evaluated by TUNEL labeling, was only performed on retinal sections. The evaluation would have benefited from the combination of sectional labeling with whole-mount labeling for markers that are particularly critical for understanding both the retinal layers and regions. Cell death evaluation would also have benefited from co-labeling with photoreceptor-specific markers.

5. Conclusions

In summary, the present study demonstrated the protective role of resveratrol against retinal degeneration induced by excessive TH signaling and Rpe65 deficiency in mice. Treatment with resveratrol preserved photoreceptors, reduced photoreceptor oxidative stress/damage, cell death/apoptosis, and upregulation of genes involved in cellular stress/death signaling and inflammatory responses, and suppressed the activation of Müller glial cells. These findings provide valuable insights into the role of oxidative stress/damage in TH-signaling-induced photoreceptor degeneration and Rpe65 deficiency and support the therapeutic significance of resveratrol/antioxidants in retinal degeneration management.

Author Contributions

S.L. and H.M. performed research and analyzed the data; S.L. and X.-Q.D. designed the research and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the National Eye Institute (R01EY033841 and P30EY021725), the Oklahoma Center for the Advancement of Science and Technology, and the Presbyterian Health Foundation.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data generated and analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

We thank the Imaging Core Facility and the Histology Core Facility of the Department of Cell Biology at OUHSC for technical assistance. We thank Charles Primeaux for technical assistance and Lilliana York for proofreading the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ceresini, G.; Lauretani, F.; Maggio, M.; Ceda, G.P.; Morganti, S.; Usberti, E.; Chezzi, C.; Valcavi, R.; Bandinelli, S.; Guralnik, J.M.; et al. Thyroid function abnormalities and cognitive impairment in elderly people: Results of the Invecchiare in Chianti study. J. Am. Geriatr. Soc. 2009, 57, 89–93. [Google Scholar] [CrossRef] [PubMed]
  2. Kalmijn, S.; Mehta, K.M.; Pols, H.A.; Hofman, A.; Drexhage, H.A.; Breteler, M.M. Subclinical hyperthyroidism and the risk of dementia. The Rotterdam study. Clin. Endocrinol. 2000, 53, 733–737. [Google Scholar] [CrossRef]
  3. de Jong, F.J.; Masaki, K.; Chen, H.; Remaley, A.T.; Breteler, M.M.; Petrovitch, H.; White, L.R.; Launer, L.J. Thyroid function, the risk of dementia and neuropathologic changes: The Honolulu-Asia aging study. Neurobiol. Aging 2009, 30, 600–606. [Google Scholar] [CrossRef] [PubMed]
  4. Chaker, L.; Buitendijk, G.H.; Dehghan, A.; Medici, M.; Hofman, A.; Vingerling, J.R.; Franco, O.H.; Klaver, C.C.; Peeters, R.P. Thyroid function and age-related macular degeneration: A prospective population-based cohort study--the Rotterdam Study. BMC Med. 2015, 13, 94. [Google Scholar] [CrossRef]
  5. Gopinath, B.; Liew, G.; Kifley, A.; Mitchell, P. Thyroid Dysfunction and Ten-Year Incidence of Age-Related Macular Degeneration. Investig. Ophthalmol. Vis. Sci. 2016, 57, 5273–5277. [Google Scholar] [CrossRef] [PubMed]
  6. Age-Related Eye Disease Study Research, G. Risk factors associated with age-related macular degeneration. A case-control study in the age-related eye disease study: Age-Related Eye Disease Study Report Number 3. Ophthalmology 2000, 107, 2224–2232. [Google Scholar]
  7. Lin, S.Y.; Hsu, W.H.; Lin, C.L.; Lin, C.C.; Lin, J.M.; Chang, Y.L.; Hsu, C.Y.; Kao, C.H. Evidence for an Association between Macular Degeneration and Thyroid Cancer in the Aged Population. Int. J. Environ. Res. Public Health 2018, 15, 902. [Google Scholar] [CrossRef]
  8. Chatziralli, I.; Mitropoulos, P.G.; Niakas, D.; Labiris, G. Thyroidopathy and Age-Related Macular Degeneration: Is There Any Correlation. Biomed. Hub. 2017, 2, 454706. [Google Scholar] [CrossRef] [PubMed]
  9. Hung, S.H.; Xirasagar, S.; Kuang, T.T.; Chang, W.W.; Cheng, Y.F.; Kuo, N.W.; Lin, H.C. Association of Age-Related Macular Degeneration with Prior Hyperthyroidism and Hypothyroidism: A Case-Control Study. J. Pers. Med. 2022, 12, 602. [Google Scholar] [CrossRef] [PubMed]
  10. Xu, Z.; Zhang, M.; Zhang, Q.; Xu, T.; Tao, L. Thyroid Disease Is Associated with Higher Age-Related Macular Degeneration Risk: Results from a Meta-Analysis of Epidemiologic Studies. Ophthalmic Res. 2021, 64, 696–703. [Google Scholar] [CrossRef]
  11. Farvardin, M.; Mousavi, S.E.; Zare, K.; Bazdar, S.; Farvardin, Z.; Johari, M. Thyroid Dysfunction as a Modifiable Risk Factor for Wet Type Age-Related Macular Degeneration: A Case-Control Study. J. Curr. Ophthalmol. 2021, 33, 449–452. [Google Scholar] [CrossRef] [PubMed]
  12. Li, X.; Li, H.; Cheng, J.; Wang, M.; Zhong, Y.; Shi, G.; Yu, A.Y. Causal Associations of Thyroid Function and Age-Related Macular Degeneration: A Two-Sample Mendelian Randomization Study. Am. J. Ophthalmol. 2022, 239, 108–114. [Google Scholar] [CrossRef]
  13. Abdelkader, M.; Abass, N. The Relation Between Age Related Macular Degeneration and Thyroid Disorders. Int. J. Ophthalmol. Vis. Sci. 2019, 4, 101–105. [Google Scholar] [CrossRef]
  14. Blum Meirovitch, S.; Leibovitch, I.; Kesler, A.; Varssano, D.; Rosenblatt, A.; Neudorfer, M. Retina and Nerve Fiber Layer Thickness in Eyes with Thyroid-Associated Ophthalmopathy. Isr. Med. Assoc. J. IMAJ 2017, 19, 277–281. [Google Scholar] [PubMed]
  15. Sayın, O.; Yeter, V.; Arıtürk, N. Optic Disc, Macula, and Retinal Nerve Fiber Layer Measurements Obtained by OCT in Thyroid-Associated Ophthalmopathy. J. Ophthalmol. 2016, 2016, 9452687. [Google Scholar] [CrossRef] [PubMed]
  16. Ma, H.; Thapa, A.; Morris, L.; Redmond, T.M.; Baehr, W.; Ding, X.Q. Suppressing thyroid hormone signaling preserves cone photoreceptors in mouse models of retinal degeneration. Proc. Natl. Acad. Sci. USA 2014, 111, 3602–3607. [Google Scholar] [CrossRef]
  17. Ma, H.; Yang, F.; York, L.R.; Li, S.; Ding, X.Q. Excessive Thyroid Hormone Signaling Induces Photoreceptor Degeneration in Mice. eNeuro 2023, 10, ENEURO.0058-23.2023. [Google Scholar] [CrossRef]
  18. Ng, L.; Lyubarsky, A.; Nikonov, S.S.; Ma, M.; Srinivas, M.; Kefas, B.; St Germain, D.L.; Hernandez, A.; Pugh, E.N., Jr.; Forrest, D. Type 3 deiodinase, a thyroid-hormone-inactivating enzyme, controls survival and maturation of cone photoreceptors. J. Neurosci. 2010, 30, 3347–3357. [Google Scholar] [CrossRef] [PubMed]
  19. Ma, H.; Stanford, D.; Freeman, W.M.; Ding, X.Q. Transcriptomic Analysis Reveals That Excessive Thyroid Hormone Signaling Impairs Phototransduction and Mitochondrial Bioenergetics and Induces Cellular Stress in Mouse Cone Photoreceptors. Int. J. Mol. Sci. 2024, 25, 7435. [Google Scholar] [CrossRef] [PubMed]
  20. Ng, L.; Liu, H.; St Germain, D.L.; Hernandez, A.; Forrest, D. Deletion of the Thyroid Hormone-Activating Type 2 Deiodinase Rescues Cone Photoreceptor Degeneration but Not Deafness in Mice Lacking Type 3 Deiodinase. Endocrinology 2017, 158, 1999–2010. [Google Scholar] [CrossRef] [PubMed]
  21. Yang, F.; Ma, H.; Belcher, J.; Butler, M.R.; Redmond, T.M.; Boye, S.L.; Hauswirth, W.W.; Ding, X.Q. Targeting iodothyronine deiodinases locally in the retina is a therapeutic strategy for retinal degeneration. FASEB J. 2016, 30, 4313–4325. [Google Scholar] [CrossRef] [PubMed]
  22. Yang, F.; Ma, H.; Boye, S.L.; Hauswirth, W.W.; Ding, X.Q. Overexpression of Type 3 Iodothyronine Deiodinase Reduces Cone Death in the Leber Congenital Amaurosis Model Mice. Adv. Exp. Med. Biol. 2018, 1074, 125–131. [Google Scholar] [CrossRef]
  23. Ma, H.; Yang, F.; Butler, M.R.; Belcher, J.; Redmond, T.M.; Placzek, A.T.; Scanlan, T.S.; Ding, X.Q. Inhibition of thyroid hormone receptor locally in the retina is a therapeutic strategy for retinal degeneration. FASEB J. 2017, 31, 3425–3438. [Google Scholar] [CrossRef] [PubMed]
  24. Koenekoop, R.K. An overview of Leber congenital amaurosis: A model to understand human retinal development. Surv. Ophthalmol. 2004, 49, 379–398. [Google Scholar] [CrossRef]
  25. Romero-Pérez, A.I.; Ibern-Gómez, M.; Lamuela-Raventós, R.M.; de La Torre-Boronat, M.C. Piceid, the major resveratrol derivative in grape juices. J. Agric. Food Chem. 1999, 47, 1533–1536. [Google Scholar] [CrossRef] [PubMed]
  26. Rao, Y.L.; Ganaraja, B.; Marathe, A.; Manjrekar, P.A.; Joy, T.; Ullal, S.; Pai, M.M.; Murlimanju, B.V. Comparison of malondialdehyde levels and superoxide dismutase activity in resveratrol and resveratrol/donepezil combination treatment groups in Alzheimer’s disease induced rat model. 3 Biotech 2021, 11, 329. [Google Scholar] [CrossRef]
  27. Li, H.; Xia, N.; Hasselwander, S.; Daiber, A. Resveratrol and Vascular Function. Int. J. Mol. Sci. 2019, 20, 2155. [Google Scholar] [CrossRef] [PubMed]
  28. Golmohammadi, M.; Meibodi, S.A.A.; Al-Hawary, S.I.S.; Gupta, J.; Sapaev, I.B.; Najm, M.A.A.; Alwave, M.; Nazifi, M.; Rahmani, M.; Zamanian, M.Y.; et al. Neuroprotective effects of resveratrol on retinal ganglion cells in glaucoma in rodents: A narrative review. Anim. Model. Exp. Med. 2024, 7, 195–207. [Google Scholar] [CrossRef] [PubMed]
  29. Mears, A.J.; Kondo, M.; Swain, P.K.; Takada, Y.; Bush, R.A.; Saunders, T.L.; Sieving, P.A.; Swaroop, A. Nrl is required for rod photoreceptor development. Nat. Genet. 2001, 29, 447–452. [Google Scholar] [CrossRef] [PubMed]
  30. Redmond, T.M.; Yu, S.; Lee, E.; Bok, D.; Hamasaki, D.; Chen, N.; Goletz, P.; Ma, J.X.; Crouch, R.K.; Pfeifer, K. Rpe65 is necessary for production of 11-cis-vitamin A in the retinal visual cycle. Nat. Genet. 1998, 20, 344–351. [Google Scholar] [CrossRef] [PubMed]
  31. Kunchithapautham, K.; Coughlin, B.; Crouch, R.K.; Rohrer, B. Cone outer segment morphology and cone function in the Rpe65−/− Nrl−/− mouse retina are amenable to retinoid replacement. Investig. Ophthalmol. Vis. Sci. 2009, 50, 4858–4864. [Google Scholar] [CrossRef] [PubMed]
  32. Hamidi, S.; Aliesky, H.; Chen, C.R.; Rapoport, B.; McLachlan, S.M. Variable suppression of serum thyroxine in female mice of different inbred strains by triiodothyronine administered in drinking water. Thyroid 2010, 20, 1157–1162. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, Z.; Wu, Z.; Li, J.; Marmalidou, A.; Zhang, R.; Yu, M. Protective effect of resveratrol against light-induced retinal degeneration in aged SAMP8 mice. Oncotarget 2017, 8, 65778–65788. [Google Scholar] [CrossRef]
  34. Syrbu, S.I.; Cohen, M.B. An enhanced antigen-retrieval protocol for immunohistochemical staining of formalin-fixed, paraffin-embedded tissues. Methods Mol. Biol. 2011, 717, 101–110. [Google Scholar] [CrossRef]
  35. Xu, J.; Morris, L.; Thapa, A.; Ma, H.; Michalakis, S.; Biel, M.; Baehr, W.; Peshenko, I.V.; Dizhoor, A.M.; Ding, X.Q. cGMP accumulation causes photoreceptor degeneration in CNG channel deficiency: Evidence of cGMP cytotoxicity independently of enhanced CNG channel function. J. Neurosci. 2013, 33, 14939–14948. [Google Scholar] [CrossRef] [PubMed]
  36. Ma, H.; Yang, F.; Ding, X.Q. Deficiency of thyroid hormone receptor protects retinal pigment epithelium and photoreceptors from cell death in a mouse model of age-related macular degeneration. Cell Death Dis. 2022, 13, 255. [Google Scholar] [CrossRef] [PubMed]
  37. Ma, H.; Yang, F.; Ding, X.Q. Inhibition of thyroid hormone signaling protects retinal pigment epithelium and photoreceptors from cell death in a mouse model of age-related macular degeneration. Cell Death Dis. 2020, 11, 24. [Google Scholar] [CrossRef] [PubMed]
  38. Thapa, A.; Morris, L.; Xu, J.; Ma, H.; Michalakis, S.; Biel, M.; Ding, X.Q. Endoplasmic reticulum stress-associated cone photoreceptor degeneration in cyclic nucleotide-gated channel deficiency. J. Biol. Chem. 2012, 287, 18018–18029. [Google Scholar] [CrossRef] [PubMed]
  39. Yang, F.; Ma, H.; Butler, M.R.; Ding, X.Q. Potential contribution of ryanodine receptor 2 upregulation to cGMP/PKG signaling-induced cone degeneration in cyclic nucleotide-gated channel deficiency. FASEB J. 2020, 34, 6335–6350. [Google Scholar] [CrossRef]
  40. Lupien, C.; Brenner, M.; Guérin, S.L.; Salesse, C. Expression of glial fibrillary acidic protein in primary cultures of human Müller cells. Exp. Eye Res. 2004, 79, 423–429. [Google Scholar] [CrossRef]
  41. Feathers, K.L.; Lyubarsky, A.L.; Khan, N.W.; Teofilo, K.; Swaroop, A.; Williams, D.S.; Pugh, E.N., Jr.; Thompson, D.A. Nrl-knockout mice deficient in Rpe65 fail to synthesize 11-cis retinal and cone outer segments. Investig. Ophthalmol. Vis. Sci. 2008, 49, 1126–1135. [Google Scholar] [CrossRef] [PubMed]
  42. Znoiko, S.L.; Rohrer, B.; Lu, K.; Lohr, H.R.; Crouch, R.K.; Ma, J.X. Downregulation of cone-specific gene expression and degeneration of cone photoreceptors in the Rpe65−/− mouse at early ages. Investig. Ophthalmol. Vis. Sci. 2005, 46, 1473–1479. [Google Scholar] [CrossRef]
  43. Chen, Y.; Moiseyev, G.; Takahashi, Y.; Ma, J.X. RPE65 gene delivery restores isomerohydrolase activity and prevents early cone loss in Rpe65−/− mice. Investig. Ophthalmol. Vis. Sci. 2006, 47, 1177–1184. [Google Scholar] [CrossRef]
  44. Yang, F.; Ma, H.; Butler, M.R.; Ding, X.Q. Deficiency of type 2 iodothyronine deiodinase reduces necroptosis activity and oxidative stress responses in retinas of Leber congenital amaurosis model mice. FASEB J. 2018, 32, fj201800484RR. [Google Scholar] [CrossRef] [PubMed]
  45. Graca, A.B.; Hippert, C.; Pearson, R.A. Müller Glia Reactivity and Development of Gliosis in Response to Pathological Conditions. Adv. Exp. Med. Biol. 2018, 1074, 303–308. [Google Scholar] [CrossRef] [PubMed]
  46. Lee, S.H.; Park, Y.S.; Paik, S.S.; Kim, I.B. Differential Response of Müller Cells and Microglia in a Mouse Retinal Detachment Model and Its Implications in Detached and Non-Detached Regions. Cells 2021, 10, 1972. [Google Scholar] [CrossRef]
  47. Wurm, A.; Iandiev, I.; Uhlmann, S.; Wiedemann, P.; Reichenbach, A.; Bringmann, A.; Pannicke, T. Effects of ischemia-reperfusion on physiological properties of Müller glial cells in the porcine retina. Investig. Ophthalmol. Vis. Sci. 2011, 52, 3360–3367. [Google Scholar] [CrossRef] [PubMed]
  48. Zhao, T.T.; Tian, C.Y.; Yin, Z.Q. Activation of Muller cells occurs during retinal degeneration in RCS rats. Adv. Exp. Med. Biol. 2010, 664, 575–583. [Google Scholar] [CrossRef] [PubMed]
  49. Chua, J.; Nivison-Smith, L.; Fletcher, E.L.; Trenholm, S.; Awatramani, G.B.; Kalloniatis, M. Early remodeling of Müller cells in the rd/rd mouse model of retinal dystrophy. J. Comp. Neurol. 2013, 521, 2439–2453. [Google Scholar] [CrossRef] [PubMed]
  50. Song, D.; Wilson, B.; Zhao, L.; Bhuyan, R.; Bandyopadhyay, M.; Lyubarsky, A.; Yu, C.; Li, Y.; Kanu, L.; Miwa, T.; et al. Retinal Pre-Conditioning by CD59a Knockout Protects against Light-Induced Photoreceptor Degeneration. PLoS ONE 2016, 11, e0166348. [Google Scholar] [CrossRef] [PubMed]
  51. Zhang, X.; Henneman, N.F.; Girardot, P.E.; Sellers, J.T.; Chrenek, M.A.; Li, Y.; Wang, J.; Brenner, C.; Nickerson, J.M.; Boatright, J.H. Systemic Treatment With Nicotinamide Riboside Is Protective in a Mouse Model of Light-Induced Retinal Degeneration. Investig. Ophthalmol. Vis. Sci. 2020, 61, 47. [Google Scholar] [CrossRef] [PubMed]
  52. Toro, M.D.; Nowomiejska, K.; Avitabile, T.; Rejdak, R.; Tripodi, S.; Porta, A.; Reibaldi, M.; Figus, M.; Posarelli, C.; Fiedorowicz, M. Effect of Resveratrol on In Vitro and In Vivo Models of Diabetic Retinophathy: A Systematic Review. Int. J. Mol. Sci. 2019, 20, 3503. [Google Scholar] [CrossRef] [PubMed]
  53. Popescu, M.; Bogdan, C.; Pintea, A.; Rugina, D.; Ionescu, C. Antiangiogenic cytokines as potential new therapeutic targets for resveratrol in diabetic retinopathy. Drug Des. Dev. Ther. 2018, 12, 1985–1996. [Google Scholar] [CrossRef] [PubMed]
  54. Bryl, A.; Falkowski, M.; Zorena, K.; Mrugacz, M. The Role of Resveratrol in Eye Diseases-A Review of the Literature. Nutrients 2022, 14, 2974. [Google Scholar] [CrossRef] [PubMed]
  55. Hu, W.H.; Zhang, X.Y.; Leung, K.W.; Duan, R.; Dong, T.T.; Qin, Q.W.; Tsim, K.W. Resveratrol, an Inhibitor Binding to VEGF, Restores the Pathology of Abnormal Angiogenesis in Retinopathy of Prematurity (ROP) in Mice: Application by Intravitreal and Topical Instillation. Int. J. Mol. Sci. 2022, 23, 6455. [Google Scholar] [CrossRef]
  56. Yan, W.; Sun, Y.; Wang, Y.; Liang, W.; Xia, Y.; Yan, W.; Chen, M.; Chen, T.; Li, D. The impacts of resveratrol on the retinal degeneration in a rat model of retinitis pigmentosa induced by alkylation: An in-vivo study. Anim. Cells Syst. 2023, 27, 138–148. [Google Scholar] [CrossRef] [PubMed]
  57. Kubota, S.; Kurihara, T.; Ebinuma, M.; Kubota, M.; Yuki, K.; Sasaki, M.; Noda, K.; Ozawa, Y.; Oike, Y.; Ishida, S.; et al. Resveratrol prevents light-induced retinal degeneration via suppressing activator protein-1 activation. Am. J. Pathol. 2010, 177, 1725–1731. [Google Scholar] [CrossRef] [PubMed]
  58. Sim, R.H.; Sirasanagandla, S.R.; Das, S.; Teoh, S.L. Treatment of Glaucoma with Natural Products and Their Mechanism of Action: An Update. Nutrients 2022, 14, 534. [Google Scholar] [CrossRef] [PubMed]
  59. Dziedziak, J.; Kasarello, K.; Cudnoch-Jedrzejewska, A. Dietary Antioxidants in Age-Related Macular Degeneration and Glaucoma. Antioxidants 2021, 10, 1743. [Google Scholar] [CrossRef]
  60. Yang, X.; Jiang, T.; Wang, Y.; Guo, L. The Role and Mechanism of SIRT1 in Resveratrol-regulated Osteoblast Autophagy in Osteoporosis Rats. Sci. Rep. 2019, 9, 18424. [Google Scholar] [CrossRef] [PubMed]
  61. Riba, A.; Deres, L.; Sumegi, B.; Toth, K.; Szabados, E.; Halmosi, R. Cardioprotective Effect of Resveratrol in a Postinfarction Heart Failure Model. Oxid. Med. Cell. Longev. 2017, 2017, 6819281. [Google Scholar] [CrossRef] [PubMed]
Antioxidants 14 00154 g001
Figure 1. Treatment with resveratrol reduced T3-induced photoreceptor cell loss/degeneration in C57BL/6 mice. (A) Shown are representative light microscopic images of H&E-stained retinal sections and corresponding quantitative analysis of ONL thickness. (B) Shown are representative confocal images of PNA labeling on retinal whole mounts and corresponding quantitative analysis. (C) Shown are representative immunoblotting images with corresponding quantitative analysis for cone arrestin (CAR). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; RPE, retinal pigment epithelial; RESV, resveratrol. Data are represented as means ± SEM for 6–9 mice per group (A,B) and of 6 assays using retinas prepared from 3–4 mice per group (C) (* p < 0.05, ** p < 0.01).
Figure 1. Treatment with resveratrol reduced T3-induced photoreceptor cell loss/degeneration in C57BL/6 mice. (A) Shown are representative light microscopic images of H&E-stained retinal sections and corresponding quantitative analysis of ONL thickness. (B) Shown are representative confocal images of PNA labeling on retinal whole mounts and corresponding quantitative analysis. (C) Shown are representative immunoblotting images with corresponding quantitative analysis for cone arrestin (CAR). GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; RPE, retinal pigment epithelial; RESV, resveratrol. Data are represented as means ± SEM for 6–9 mice per group (A,B) and of 6 assays using retinas prepared from 3–4 mice per group (C) (* p < 0.05, ** p < 0.01).
Antioxidants 14 00154 g001
Antioxidants 14 00154 g002
Figure 2. Treatment with resveratrol reduced T3-induced photoreceptor apoptosis in C57BL/6 and Nrl−/− mice. Shown are representative confocal images of TUNEL labeling on retinal sections prepared from C57BL/6 mice (A) and Nrl−/− mice (B) and corresponding quantitative analysis of TUNEL-positive cells. ONL, outer nuclear layer; INL, inner nuclear layer; RESV, resveratrol. Data are represented as means ± SEM for 7–11 mice per group (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 2. Treatment with resveratrol reduced T3-induced photoreceptor apoptosis in C57BL/6 and Nrl−/− mice. Shown are representative confocal images of TUNEL labeling on retinal sections prepared from C57BL/6 mice (A) and Nrl−/− mice (B) and corresponding quantitative analysis of TUNEL-positive cells. ONL, outer nuclear layer; INL, inner nuclear layer; RESV, resveratrol. Data are represented as means ± SEM for 7–11 mice per group (* p < 0.05, ** p < 0.01, *** p < 0.001).
Antioxidants 14 00154 g002
Antioxidants 14 00154 g003
Figure 3. Treatment with resveratrol reduced T3-induced oxidative stress/damage in the retinas of C57BL/6 and Nrl−/− mice. Shown are representative confocal images of p-γH2AX immunolabeling on retinal sections and corresponding quantitative analysis in C57BL/6 mice (A) and Nrl−/− mice (B). ONL, outer nuclear layer; INL, inner nuclear layer; RESV, resveratrol. Data are represented as means ± SEM of 8–11 mice per group (* p < 0.05, *** p < 0.001).
Figure 3. Treatment with resveratrol reduced T3-induced oxidative stress/damage in the retinas of C57BL/6 and Nrl−/− mice. Shown are representative confocal images of p-γH2AX immunolabeling on retinal sections and corresponding quantitative analysis in C57BL/6 mice (A) and Nrl−/− mice (B). ONL, outer nuclear layer; INL, inner nuclear layer; RESV, resveratrol. Data are represented as means ± SEM of 8–11 mice per group (* p < 0.05, *** p < 0.001).
Antioxidants 14 00154 g003
Antioxidants 14 00154 g004
Figure 4. Treatment with resveratrol inhibited T3-induced macroglial cell activation in C57BL/6 and Nrl−/− mice. (A,B) Shown are representative confocal images of GFAP labeling on retinal sections prepared from C57BL/6 mice (A) and Nrl−/− mice (B) and corresponding quantitative analysis of fluorescence density. (C) Shown are representative images of GFAP immunoblotting using retinas prepared from C57BL/6 mice and corresponding quantitative analysis. (D) Shown are qRT-PCR results for expression levels of genes involved in oxidative stress, cell death, and inflammatory response. ONL, outer nuclear layer; INL, inner nuclear layer; GCL, ganglion cell layer; RESV, resveratrol. Data are represented as means ± SEM for 8–11 mice per group (A,B) and of 6 assays using retinas prepared from 3–4 mice per group (C,D) (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 4. Treatment with resveratrol inhibited T3-induced macroglial cell activation in C57BL/6 and Nrl−/− mice. (A,B) Shown are representative confocal images of GFAP labeling on retinal sections prepared from C57BL/6 mice (A) and Nrl−/− mice (B) and corresponding quantitative analysis of fluorescence density. (C) Shown are representative images of GFAP immunoblotting using retinas prepared from C57BL/6 mice and corresponding quantitative analysis. (D) Shown are qRT-PCR results for expression levels of genes involved in oxidative stress, cell death, and inflammatory response. ONL, outer nuclear layer; INL, inner nuclear layer; GCL, ganglion cell layer; RESV, resveratrol. Data are represented as means ± SEM for 8–11 mice per group (A,B) and of 6 assays using retinas prepared from 3–4 mice per group (C,D) (* p < 0.05, ** p < 0.01, *** p < 0.001).
Antioxidants 14 00154 g004
Antioxidants 14 00154 g005
Figure 5. Treatment with resveratrol preserved cones in Rpe65−/− mice and Rpe65−/−/Nrl−/− mice. (A) Shown are representative confocal images of PNA labeling on retinal whole mounts prepared from Rpe65−/− mice and corresponding quantitative analysis. (B) Shown are the results of immunoblotting with corresponding quantitative analysis for CAR, using retinas prepared from Rpe65−/−/Nrl−/− mice. RESV, resveratrol; CAR, cone arrestin. Data are represented as means ± SEM for 9–10 mice per group (A) and of 6 assays using retinas prepared from 4–5 mice per group (B) (*** p < 0.001).
Figure 5. Treatment with resveratrol preserved cones in Rpe65−/− mice and Rpe65−/−/Nrl−/− mice. (A) Shown are representative confocal images of PNA labeling on retinal whole mounts prepared from Rpe65−/− mice and corresponding quantitative analysis. (B) Shown are the results of immunoblotting with corresponding quantitative analysis for CAR, using retinas prepared from Rpe65−/−/Nrl−/− mice. RESV, resveratrol; CAR, cone arrestin. Data are represented as means ± SEM for 9–10 mice per group (A) and of 6 assays using retinas prepared from 4–5 mice per group (B) (*** p < 0.001).
Antioxidants 14 00154 g005
Antioxidants 14 00154 g006
Figure 6. Treatment with resveratrol reduced photoreceptor apoptosis in Rpe65−/− mice and Rpe65−/−/Nrl−/− mice. Shown are representative confocal images of TUNEL labeling on retinal sections prepared from Rpe65−/− mice (A) and Rpe65−/−/Nrl−/− mice (B) and corresponding quantitative analysis. ONL, outer nuclear layer; INL, inner nuclear layer; RESV, resveratrol. Data are represented as means ± SEM of 3–10 mice per group (* p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 6. Treatment with resveratrol reduced photoreceptor apoptosis in Rpe65−/− mice and Rpe65−/−/Nrl−/− mice. Shown are representative confocal images of TUNEL labeling on retinal sections prepared from Rpe65−/− mice (A) and Rpe65−/−/Nrl−/− mice (B) and corresponding quantitative analysis. ONL, outer nuclear layer; INL, inner nuclear layer; RESV, resveratrol. Data are represented as means ± SEM of 3–10 mice per group (* p < 0.05, ** p < 0.01, *** p < 0.001).
Antioxidants 14 00154 g006
Antioxidants 14 00154 g007
Figure 7. Treatment with resveratrol inhibited macroglial cell activation in Rpe65−/− mice and Rpe65−/−/Nrl−/− mice. (A,B) Shown are representative confocal images of GFAP labeling on retinal sections prepared from Rpe65−/− mice (A) and Rpe65−/−/Nrl−/− mice (B) and corresponding quantitative analysis of fluorescence density. (C) Shown are the results of immunoblotting of GFAP using retinas prepared from Rpe65−/− mice with corresponding quantitative analysis. (D) Shown are the qRT-PCR results for expression levels of genes involved in oxidative stress, cell death, and the inflammatory response. ONL, outer nuclear layer; INL, inner nuclear layer; GCL, ganglion cell layer; RESV, resveratrol; Data are represented as means ± SEM for 3–10 mice per group (A,B) and of 6 assays using retinas prepared from 3–7 mice per group (C,D) * p < 0.05, ** p < 0.01, *** p < 0.001).
Figure 7. Treatment with resveratrol inhibited macroglial cell activation in Rpe65−/− mice and Rpe65−/−/Nrl−/− mice. (A,B) Shown are representative confocal images of GFAP labeling on retinal sections prepared from Rpe65−/− mice (A) and Rpe65−/−/Nrl−/− mice (B) and corresponding quantitative analysis of fluorescence density. (C) Shown are the results of immunoblotting of GFAP using retinas prepared from Rpe65−/− mice with corresponding quantitative analysis. (D) Shown are the qRT-PCR results for expression levels of genes involved in oxidative stress, cell death, and the inflammatory response. ONL, outer nuclear layer; INL, inner nuclear layer; GCL, ganglion cell layer; RESV, resveratrol; Data are represented as means ± SEM for 3–10 mice per group (A,B) and of 6 assays using retinas prepared from 3–7 mice per group (C,D) * p < 0.05, ** p < 0.01, *** p < 0.001).
Antioxidants 14 00154 g007
Table 1. Antibodies and other reagents used in this study.
Table 1. Antibodies and other reagents used in this study.
Antibodies/ReagentVendorCatalog #Dilutions Used in IF or IB
3,3′,5-Triiodo-L-thyronine Sigma-Aldrich T2877
Resveratrol Sigma-Aldrich R5010
DAPI (4,6-Diamidino-2-phenylindole)Millipore SigmaD95421:2000 (IF)
Biotinylated PNAVector LabsB-10751:200 (IF)
anti-γH2AX (p Ser139)NovusNB100-22801:200 (IF)
anti-GFAPDAKOZ03341:500 (IF)
anti-GFAPDAKOZ03341:500 (IB)
anti-β-actinAbcamAb62761:2000 (IF)
anti-CAR EMD Millipore AB15282 1:500 (IB)
HRP-anti-rabbit SeraCare 5220-0336 1:10,000 (IF)
HRP-anti-mouse SeraCare 5220-0341 1:10,000 (IF)
Alexa Fluor® 555 goat
anti-rabbit IgG		ThermoFisher ScientificA214281:500 (IF)
Streptavidin-Cy3ThermoFisher ScientificSA10101:500 (IF)
Table 2. Primers used in this study.
Table 2. Primers used in this study.
GeneAccession NumberForward PrimerReverse Primer
Hprt1NM_013556GCAAACTTTGCTTTCCCTGGTTCAAGGGCATATCCAACAACA
Ripk1NM_009068GGAAGGATAATCGTGGAGGCAAGGAAGCCACACCAAGATC
Ripk3NM_019955TCTTTACTGAGACTCCCGGTAGTTCCCAATCTGCACTTCAG
Tnf1αNM_013693CTTCTGTCTACTGAACTTCGGGCAGGCTTGTCACTCGAATTTTG
Tnfrsf1aNM_011609CTCTGCTCTACGAATCACTCTGCACAGCATACAGAATCGCAAG
Tnfrsf9NM_011612CCTGTGATAACTGTCAGCCTGTCTTGAACCTGAAATAGCCTGC
GssNM_008180GATCCTGTCCAATAACCCCAGGCACGCTGGTCAAATATGTTC
CtsbNM_007798AGACCTGCTTACTTGCTGTGGGAGGGATGGTGTATGGTAAG
Ehd2NM_153068AGCTCAACGACCTAGTGAAACTCGCAAAGATGACAGGCAG
Gpx4NM_008162GCAATGAGGCAAAACTGACGCTTGATTACTTCCTGGCTCCTG
Nox4NM_015760TCCAAGCTCATTTCCCACAGCGGAGTTCCATTACATCAGAGG
Ucp2NM_011671GCATTGGCCTCTACGACTCAAGCGGACCTTTACCACATC
Ncf1NM_010876TCATCCTTCAGACCTATCGGGACCTCGCTTTGTCTTCATCTG
Nlrp3NM_145827CTCCAACCATTCTCTGACCAGACAGATTGAAGTAAGGCCGG
Il1αNM_010554TGCAGTCCATAACCCATGATCACAAACTTCTGCCTGACGAG
Il1βNM_008361ACGGACCCCAAAAGATGAAGTTCTCCACAGCCACAATGAG
Il6NM_031168CAAAGCCAGAGTCCTTCAGAGGTCCTTAGCCACTCCTTCTG
Dio3NM_172119GTGGTCGGAGAAGGTGAAGTGCACAAGAAATCTAAAAGCCAG
Casp3NM_009810GACTGATGAGGAGATGGCTTGTGCAAAGGGACTGGATGAAC
Casp7NM_007611CCCACTTATCTGTACCGCATGGGTTTTGGAAGCACTTGAAGAG
Casp8NM_009812AACTTCCTAGACTGCAACCGTCTCAATTCCAACTCGCTCAC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, S.; Ma, H.; Ding, X.-Q. Resveratrol Protects Photoreceptors in Mouse Models of Retinal Degeneration. Antioxidants 2025, 14, 154. https://doi.org/10.3390/antiox14020154

AMA Style

Li S, Ma H, Ding X-Q. Resveratrol Protects Photoreceptors in Mouse Models of Retinal Degeneration. Antioxidants. 2025; 14(2):154. https://doi.org/10.3390/antiox14020154

Chicago/Turabian Style

Li, Shujuan, Hongwei Ma, and Xi-Qin Ding. 2025. "Resveratrol Protects Photoreceptors in Mouse Models of Retinal Degeneration" Antioxidants 14, no. 2: 154. https://doi.org/10.3390/antiox14020154

APA Style

Li, S., Ma, H., & Ding, X.-Q. (2025). Resveratrol Protects Photoreceptors in Mouse Models of Retinal Degeneration. Antioxidants, 14(2), 154. https://doi.org/10.3390/antiox14020154

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop