Next Article in Journal
The Optimal Concentration of KH2PO4 Enhances Nutrient Uptake and Flower Production in Rose Plants via Enhanced Root Growth
Next Article in Special Issue
New Intrinsically Thermostable Xylanase Improves Broilers’ Growth Performance, Organ Weights, and Affects Intestinal Viscosity and pH
Previous Article in Journal
Analysis of Air Pollutant Emissions for Mechanized Rice Cultivation in Korea
Previous Article in Special Issue
Growth of Pancreas and Intestinal Enzyme Activities in Growing Goats: Influence of a Low-Protein Diet
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 11
Issue 12
10.3390/agriculture11121209
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile

by
Piera Iommelli
1,
Federico Infascelli
1,
Nadia Musco
1,*,
Micaela Grossi
1,
Maria Ferrara
1,
Fiorella Sarubbi
2,
Biagio D’Aniello
3,
Pietro Lombardi
1,† and
Raffaella Tudisco
1,†
1
Department of Veterinary Medicine and Animal Production, University of Napoli Federico II, 80100 Napoli, Italy
2
Institute for the Animal Production System in the Mediterranean Environment, National Research Council, 80055 Portici, Italy
3
Department of Biology, University of Napoli Federico II, 80100 Napoli, Italy
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agriculture 2021, 11(12), 1209; https://doi.org/10.3390/agriculture11121209
Submission received: 8 November 2021 / Revised: 26 November 2021 / Accepted: 28 November 2021 / Published: 1 December 2021
(This article belongs to the Special Issue Improvement and Innovation in the Nutritional Quality and Technologies of Animal Feed)
Review Reports Versions Notes

Abstract

:
Research on diet effects on buffalo meat quality may be critical to assess its possible consumption benefits in human nutrition. This study investigated, in growing buffalo bulls, the effects of two diets differing in total fat content and fatty acid profile on the activity and gene expression of Stearoyl-CoA Desaturase (SCD) in the adipose tissue and on meat quality. Twenty buffalo bulls, 6 months old, were randomly assigned to the two dietary treatments until slaughtering (about 400 kg body weight). No significant difference between the groups was observed for chemical composition, fatty acid profile and CLAs content of Longissimus thoracis as well as for the SCD gene expression. Such results seem to be in contrast with similar studies performed on other ruminant species, but confirm that important differences occur between buffalo and bovine species, such as the lower content in fat of buffalo meat. Our results also confirm that specific studies should be performed on buffalo, also in terms of the metabolic pathways activated by different diets.

1. Introduction

Compared to the other domesticated ruminants, the water buffalo (Bubalus bubalis) shows specific traits for digestive physiology [1,2,3] and milk quality [4,5,6]. In recent years, interest in buffalo meat has progressively increased due to its nutritional characteristics, mainly regarding the fatty acids profile, which appeared able to play a positive role in human health [7]. Particular attention has been focused on conjugated linoleic acids (CLAs) due to their anti-carcinogenic activity, their positive effects on diabetic patients and on the proper function of the immune and cardiovascular systems [8,9]. CLAs have two origins [10]: (1) through the bio-hydrogenation of some unsaturated fatty acids in the rumen, and (2) through the endogenous synthesis starting from trans-vaccenic acid (trans11 C18:1, TVA-intermediate product of linoleic and α-linolenic bio-hydrogenation) by a ∆9-desaturase, the Stearoyl CoA Desaturase (SCD). According to Griinari et al. [11], the contribution of endogenous synthesis to the total content of CLAs in milk (through TVA desaturation by ∆9-desaturase in the mammary gland) should be almost 64%, while Lock and Garnsworthy [12] and Piperova et al. [13] estimated an incidence higher than 80% and 90%, respectively. According to Kay et al. [14], endogenous synthesis should be up to 100%, and such a hypothesis was supported by the observation that the concentration of CLAs in the blood was very low [15]. Gillis et al. [16] reported that around 86% of the cis-9, trans-11 CLA in the bovine intramuscular fat comes from the TVA desaturation. Concerning other ruminants, little is known on the proportion of rumen and endogenous origin of CLAs. High CLAs levels in lamb meat were associated with high TVA levels [17], suggesting the endogenous synthesis plays a fundamental role also in small ruminants. The ∆9-desaturase, in addition to producing cis-9, trans-11 CLA, also plays a part in producing trans-7, cis-9 and cis-9, trans-13 CLA, as identified by Yurawecz et al. [18]. The Stearoyl-CoA desaturase (SCD) is a multi-enzymes complex including NADH-cytochrome-b5 reductase, cytochrome b5, acil-CoA synthase and ∆9-desaturase. The SCD gene encodes a protein of 359 amino acid residues, located in the endoplasmic reticulum, that catalyzes the ∆-9 desaturation, introducing a cis double bound, of a spectrum of fatty acyl-CoA substrates, mainly from myristic (C14) to nonadecylic (C19) acid between carbon 9 and 10. The products of this reaction are important components of phospholipids and triglycerides mainly involved in cell membrane fluidity. In ruminants’ mammary glands and adipose tissue, SCD acts on the rumen biohydrogenation of trans-11 C18:1 (TVA, transvaccenic acid), an intermediate product of polyunsaturated fatty acids (PUFA) [11], to synthesize the CLAs. Up to 80% of CLAs in the food is represented by the cis-9, trans-11 CLA (rumenic acid), which derives from linoleic acid [19]. In ruminants, the SCD gene generates a 5-kilobyte (KB) transcript that was characterized in sheep [20], cows [21], and goats [22]. It is organized in 6 exons and 5 introns. The water buffalo SCD gene spans approximately 15.5 KB (EMBL Acc. No. AM600640) and its polymorphism seems to affect its expression in the mammary gland [23] and muscles [24]. These last authors characterized the water buffalo SCD gene, showing 15 polymorphic sites, one of which, realized at the 231st nucleotide of exon 5, is responsible for an amino acid change (GCGAlaGTGVal). As observed in the cow [25], such a transition could be associated with a different content of monounsaturated fatty acids (MUFA) in buffalo milk and meat. SCD gene expression is known to be affected by several factors: animal species, tissue, diet, age [26], CLAs [27] and cholesterol content [28]. In rodents, regulation of SCD gene expression by dietary factors has been mainly investigated in liver and adipose tissue [29] and in the mammary gland [30]. In these species, SCD relies on different genes whose expression is tissue-specific as well as their down-regulation by PUFA [29]. In contrast, in sheep [20] and goats [22], there is only one SCD gene, and, according to Bernard et al. [31], in the ruminants’ mammary gland and adipose tissue, it is less sensitive to dietary PUFA intake. Indeed, Daniel et al. [32] reported a SCD gene downregulation in the adipose tissue of lambs fed forage compared with those fed a concentrate-based diet due to the higher content of linolenic acid (C18:3n-3) in the forage. Similar results were reported in our previous studies on SCD gene expression in the mammary gland of goats fed on pasture [33,34,35] or with a diet rich in linolenic acid [36,37].
Concerning the effect of a high fat diet (HFD) on SCD gene expression, conflicting results were reported in studies on rats: increase [38,39], decrease [40] or no alteration [41,42]. In buffalo species, SCD gene expression or activity were studied by several authors [5,23,24,43,44,45,46,47] in the mammary gland, while, to the best of our knowledge, no research was performed in the adipose tissue. Therefore, the aim of present trial was to study the effect of different total fat and PUFA content in the diet on the activity and expression of the SCD gene in the adipose tissue of buffalo bulls.

2. Materials and Methods

The trial, performed according to the Animal Welfare and Good Clinical Practice (Directive 2010/63/EU) and approved by the local Bioethics Committee (protocol number: PG/2021/0044033), was carried out at a buffalo farm located on an irrigated area (41°26′27″ N, 13°50′00″ E, 40 m a.s.l.) of Cassino, province of Frosinone (South-Italy), with 961 mm and 14.9 °C average annual rainfall and temperature, respectively. Twenty 6-month-old male buffalo calves, placed in individual pens with free access to clean water, were divided into two homogeneous groups (low fat, LF and high fat, HF) and fed diets (100 g DM/kg of metabolic weight) constituted by corn silage (32% DM), oat hay (18% DM) and two different concentrates (50% DM): LF (corn 10%, barley 14%, wheat bran 28%, fava bean 31% CP tannin-free variety 48%) and HF (corn 18%, barley 16%, wheat bran 18%, soybean 33% CP 48%). Refusals weremeasured daily. Monthly, feeds and diets’ chemical compositions were analyzed according to AOAC methods [48] for dry matter (DM, ID 934.01), crude protein (CP, ID 984.13), and ether extract (EE, ID 920.29) while the structural carbohydrates were determined as suggested by Van Soest et al. [49] and nutritive values were calculated [50]. The diets were also analyzed for their fatty acid profile through the total fat extraction according to Folch et al. [51] and fatty acid methylation as suggested by Christie [52]. Fatty acid methyl esters were analyzed by a gas-chromatograph Focus (Thermo Scientific Co. Waltham, MA, USA, 02451) equipped with a SP®-2380 fused silica capillary column (100 mL × 0.25 mm internal diameter with 0.2 μm film thickness (Uspelco, Inc, Bellefonte, PA, USA)) using the AS 3000 II autosampler. The gas-chromatograph conditions were: oven temperature at 160 °C and held for 1 min, successively increased up to 230 °C at a rate of 1 °C/min and held for 3 min; the temperature of injector and detector set at 220 °C and 250 °C, respectively; helium as the carrier gas with a flow of 1.5 mL/min. Fatty acids were identified by comparing retention times of peaks with those of the fatty acids standard mixture (Larodan Fine Chemical AB, Malmo, Sweden). The animals were slaughtered when they reached 400 kg live weight (480.4 ± 35.4 days of age) in an authorized slaughterhouse according to EU legislation (EU Regulation 882/2004). After 14 days of ageing at 4 ± 1 °C, a sample cut corresponding to the Longissimus thoracis (LT) was collected for moisture, crude fat, ash and protein analysis by a food analyzer (FoodScan Lab, FOSS Electric, Denmark) and to study the intra-muscular fatty acid profile. To this purpose, total lipids were extracted in duplicate, from 5 g ground meat sample, according to Folch [51]. Fatty acids were methylated as described by Christies [52] with NAOH/MeOH followed by HCl/MeOH and analyzed with gas chromatography apparatus (Thermoquest 8000 tops series, with a system of computerized integration ″Millennium 32”), equipped with a CP-SIL 88 fused silica capillary column 100 m × 0.25 mm (internal diameter) with 0.2-mL film thickness (Varian, Walnut Creek, CA, USA). Gas chromatograph conditions were set as follows: initial oven temperature maintained at 70 °C for 4 min, then ramped up by 13 °C/min to 175 °C and maintained for 27 min, then ramped to 215 °C by 3 °C/min and maintained for 38 min, before reverting to 70 °C at a rate of 10 °C/min. Inlet and detector temperatures were 250 and 260 °C, respectively. The split ratio was 100:1. The helium carrier gas flow rate was 1 mL/min, hydrogen flow to the detector was 30 mL/min, airflow was 350 mL/min and the flow of helium carrier gas was 45 mL/min. Fatty acid peaks were identified using pure methyl ester external standards (Larodan Fine Chemicals, AB, Malmo, Sweden). Additional standards for CLA isomers were obtained from Larodan.

2.1. Sampling and Extraction of Total RNA from Subcutaneous Adipose Tissue

Immediately after slaughtering, samples of subcutaneous adipose tissue were taken from the right side of each carcass (between the 12th and 13th ribs) under RNase-free conditions, snap-frozen in liquid nitrogen and stored at −80 °C until further analysis.
The total RNA in the adipose tissue was used for SCD gene expression analysis. Two hundred mg of tissue were placed into 2 mL microcentrifuge tubes on ice containing one stainless steel bead (5 mm mean diameter) and 600 µL Buffer RLT (lysis buffer, Qiagen). Each tube was placed in the TissueLyser Adapter Set 2 × 24 and the tissues were homogenized two times with the TissueLyser instrument (Qiagen, Hilden, Germany) for 2 min at 20 Hz and centrifuged for 3 min at 10,000 rpm. The expression levels of SCD gene were studied by extraction of total RNA from subcutaneous adipose tissue using the RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. RNA was dissolved in 50 μL of RNase-free water and stored at −80 °C.

2.2. Single-Strand cDNA Synthesis

Total RNA concentration and purity were evaluated through absorbance readings (ratio of A260/A230 and A260/A280) by using a bio-photometer (Eppendorf, Hamburg, Germany). RNA quality was determined using an Agilent 2100 Bioanalyzer instrument (Agilent Technologies, Santa Clara, CA, USA), based on microcapillary electrophoresis. With this technology, electropherograms and gel-like images can be visually evaluated, and expert software can generate an RNA Integrity Number (RIN), a user-independent assessment of RNA integrity.
Total RNA (1 µg) was incubated in gDNA Wipeout buffer (Qiagen) at 42 °C for 2 min to effectively remove contaminating genomic DNA. Then, first-strand cDNA was reverse transcribed using a Quantiscript Reverse transcriptase (Qiagen) according to the manufac-turer’s instructions. The obtained single strand cDNA was diluted in diethylpyrocarbonate-treated water (1:50) and stored at −20 °C.

2.3. Quantitative Real-Time PCR Analysis

Quantitative real-time PCR was performed using five-fold diluted cDNA products with SYBR® Green PCR Master Mix (Applied Biosystem). Analysis was carried out with an ABI Prism 7300 System (Applied Biosystem, Foster City, CA, USA), with software for data management (PE Biosystems 7300 software) for 40 cycles at 95 °C for 20 s and amplification at 60 °C for 1 min. Each sample was run in triplicate with a non-template control included. A melting curve was produced after completion of the thermal PCR program to check for the presence of one gene-specific peak and the absence of primer–dimers. Specific gene primers were: SCD as described by Gu et al. (2019), or β-actin, 18 rRNA [24] and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) [47], as housekeeping genes. Primer pairs were verified by determining the amplification efficiency with five serial dilutions (1:4) of the cDNA template. All threshold cycle (Ct) values of the samples fell on the linear range of the curves. The amplification efficiency of housekeeping genes was 100% and 95.8% for SCD gene. The relative gene expression levels were calculated by normalizing the threshold cycle numbers (Ct) of the SCD mRNA using the mean Ct of housekeeping genes. Results were expressed as arbitrary units (AU) (Table 1).

2.4. Statistical Analysis

Data were processed by one-way ANOVA according to this model:
Yij = µ + Di + Ɛij
where Yij = mean of response variable, µ = population mean, Di = effect of diet (i = 1, 2) and ε = experimental error.
The differences between the mean values were analyzed by using Tukey’s test. Differences were considered statistically significant at p < 0.05 and p < 0.01. All the analyses were performed by JMP software v.11 [53].

3. Results and Discussion

In Table 2, the chemical composition and the nutritive value of feeds and diets are reported. The diets were isoproteic, while the fat content was significantly higher (p < 0.01) in the HF diet than in the LF one (g/kg DM 71.1 vs. 23.1), due to the higher level of lipids in HF concentrate (g/kg DM 120.7) compared to LF concentrate (g/kg DM 23.1). The structural carbohydrates and the lignin were also significantly higher in HF diet (g/kg DM 275.4 vs. 197.5; p < 0.01); thus, the diets’ nutritive value was similar (0.90 vs. 0.91 VFU/kg DM, for LF and HF, respectively).
No dietary refusals were detected. Dietary PUFA (C18:2 cis 9 cis 12 + C18:3 cis 9 cis 12 cis15) intake was 3.35 time higher with HF than LF diet (Table 3), even if the intake of linolenic acid (C18:2 cis 9 cis 12) was the main contributor to this result; according to Calabrò et al. [54], these results are due to the different fatty acids profile of the main ingredient of concentrate of the two diets, fava bean in LF vs. soybean in HF. Indeed, fava has been shown to have a higher C18:3 and lower C18:2 content than soybean.
The dietary treatment did not affect the chemical composition of Longissimus thoracis (Table 4) or its fatty acid profile (Table 5).
In particular, myristic and palmitic acid, known to be significantly associated with the risk of cardiovascular disease [55], showed similar levels in the Longissimus thoracis of the two buffalo groups. In contrast, Scerra et al. [56] found higher levels of palmitic acid in meat from lambs fed concentrate containing soybean vs. fava bean. In the present study, the content of stearic acid in LT did not differ between the two buffalo groups, while Cutrignelli et al. [57], comparing the fatty acid profile of meat from bulls of Marchigiana breed fed concentrate with fava bean vs. soybean, found a significantly (p < 0.01) higher concentration of stearic acid in the first group. Oleic acid was the most represented fatty acid in the LT from both groups. It is well known that this fatty acid originates from the desaturation, through SCD activity, of the stearic acid coming from the biohydrogenation of linoleic and linolenic acids in the rumen [58]. A strong effect of ruminant dietary regimen on oleic acid levels in meat was reported, both in beef [59,60] and in sheep tissues [61], as partially depending on an increased activity of SCD. In the present trial, even if the intake of linoleic acid was higher in the HF diet, the levels of oleic acid in LT were similar between the two groups. Likewise, LT linoleic, linolenic and CLAs content were not different between groups.
SCD activity could be measured by the ratio of product/substrate of some fatty acids. In milk, Lock and Garnsworthy [62] stated that the C14:1 cis 9/C14:0 ratio is the best marker of SCD activity; in fact, C14:0 is entirely de novo synthesized in the mammary gland; thus, C14:1 completely comes from C14:0 desaturation. Consequently, higher values of C14:1 cis 9/C14:0 ratio would indicate an increase of SCD activity. In our trial, this index was unaffected by the treatment: its value was only slightly higher in the LT of group HF (Table 4) without significant differences. In addition, the C16:1/C16:0 and C18:1 cis 9/C18:0 ratios were calculated [63] and for both no difference was detected between groups.
Overall, both chemical and fatty acid composition of the Longissimus thoracis muscle were unaffected by the two diets, and such results seem to be in contrast with similar studies performed on other ruminant species. On the other hand, several authors reported important differences between buffalo and bovine species, one of them being the different fat content of buffalo meat. Our results confirm and underline that specific studies should be performed on buffalo, also in terms of the metabolic pathways activated by diet differences. Importantly, the very low fat percentage represents one of the reasons that justifies the growing interest in buffalo meat, mainly for consumers who need dietetical foods [7]; thus, research on this topic is critical to assess the possible benefits of buffalo meat consumption in human nutrition.
RNA quality and yield extracted from 200 mg of subcutaneous adipose tissue with the modified RNeasy Mini Kit (QIAGEN) were acceptable for the Real Time PCR. All total RNA samples exhibited 260/280 ratios of >1.8 and RNA yield averaged 30.5 µg/g in adipose tissue (varied from 18.5–40.7 µg/g) for HF and LF groups. The mean RIN obtained for all extracted samples from both groups was of 7.1 ± 0.9. This value is higher than 6, the threshold for high- and low-quality RNA defined by Schroeder et al. [63]. SCD gene expression was not affected (4.85 ± 1.37 vs. 5.81 ± 2.15 AU) by the dietary treatment, similarly to what happened to the intramuscular fat percentage and the fatty acid profile. This result agrees with those authors who described SCD expression level as an indicator of intramuscular fat development [64,65] and quality in ruminants and non-ruminants. Therefore, SCD should be a key regulator of muscle metabolism by facilitating lipid biosynthesis and by suppressing fatty acid degradation. In contrast, some authors reported opposite results. Hiller et al. [66] and Hiller et al. [67] described differences in SCD gene expression in bovines fed different diets. In particular, in the first trial, these authors did not find significant differences in intramuscular fat content while, in the second one, lower SCD gene expression was correlated with lower C14:1 and C16:1 content in the muscle. Similarly, Urrutia et al. [68] found a lower SCD gene expression and a lower C18:1 content in the meat from lambs fed with a diet higher in linolenic acid. In addition, Waters et al. [69] and Ebrahimi et al. [70] reported a negative relationship between SCD gene expression and diet n-3 PUFA in meat from cattle and lambs, respectively.

4. Conclusions

Despite the differences between the two diets, mainly in linoleic and linolenic acid, both meat fatty acids profile and gene expression were unchanged. In general, an absolute functional genomic correlation between the expression of genes and gene products was not obtained; thus, further investigations are needed to address developmental stage dependencies, transcriptional, post-transcriptional, translational and post-translational control mechanisms as well as overlapping or conflicting effects of simultaneously proceeding, tissue-specific processes of substrate uptake, lipogenesis, lipolysis and lipid release.

Author Contributions

Conceptualization F.I. and P.I.; methodology M.G. and N.M.; software M.F.; formal analysis P.I., M.F., F.S., N.M. and R.T.; resources F.I.; data curation N.M. and B.D.; writing—original draft preparation F.I.; writing—review and editing P.L. and R.T.; supervision P.L. and R.T.; project administration P.L. and R.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of University of Naples Federico II (PG/2021/0044033).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors wish to thank Franco Barchesi (Azienda Barchesi, Cassino, Frosinone, Italy) for his availability and technical support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Campanile, G.; Di Palo, R.; Infascelli, F.; Gasparrini, B.; Neglia, G.; Zicarelli, F.; D’Occhio, M.J. In-fluence of rumen protein degradability on productive and reproductive performance in buffalo cows. Reprod. Nutr. Dev. 2003, 43, 557–566. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Cutrignelli, M.I.; Piccolo, G.; D’Urso, S.; Calabrò, S.; Bovera, F.; Tudisco, R.; Infascelli, F. Urinary excretion of purine derivatives in dry buffalo and Fresian cows. Ital. J. Anim. Sci. 2007, 6, 563–566. [Google Scholar] [CrossRef] [Green Version]
  3. Calabrò, S.; Infascelli, F.; Tudisco, R.; Musco, N.; Grossi, M.; Monastra, G.; Cutrignelli, M.I. Estimation of in vitro methane production in buffalo and cow. Buffalo Bull. 2013, 32, 924–927. [Google Scholar]
  4. Tufarelli, V.; Dario, M.; Laudadio, V. Diet composition and milk characteristics of Mediterranean water buffaloes reared in Southeastern Italy during spring season. Livest. Res. Rural Dev. 2008, 20, 10. [Google Scholar]
  5. Tudisco, R.; Cutrignelli, M.I.; Calabrò, S.; Grossi, M.; Musco, N.; Monastra, G.; Infascelli, F. Milk CLA content and Δ9 desaturase activity in buffalo cows along the lactation. Buffalo Bull. 2013, 32, 1330–1333. [Google Scholar]
  6. Becskei, Z.; Savić, M.; Ćirković, D.; Rašeta, M.; Puvača, N.; Pajić, M.; Đorđević, S.; Paskaš, S. Assessment of Water Buffalo Milk and Traditional Milk Products in a Sustainable Production System. Sustainability 2020, 12, 6616. [Google Scholar] [CrossRef]
  7. Infascelli, F.; Gigli, S.; Campanile, G. Buffalo meat production: Performance infra vitam and quality of meat. Vet. Res. Commun. 2004, 28, 143–148. [Google Scholar] [CrossRef] [PubMed]
  8. Giordano, G.; Guarini, P.; Ferrari, P.; Biondi-Zoccai, G.; Schiavone, A.; Giordano, A. Beneficial impact on cardiovascular risk profile of water buffalo meat consumption. Eur. J. Clin. Nutr. 2010, 64, 1000–1006. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Cavaliere, G.; Trinchese, G.; Musco, N.; Infascelli, F.; De Filippo, C.; Mastellone, V.; Morittu, V.M.; Lombardi, P.; Tudisco, R.; Grossi, M.; et al. Milk from cows fed a diet with a high forage: Concentrate ratio improves inflammatory state, oxidative stress, and mitochondrial function in rats. J. Dairy Sci. 2018, 101, 1843–1851. [Google Scholar] [CrossRef] [PubMed]
  10. Griinari, J.M.; Bauman, D.E. Biosynthesis of conjugated linoleic acid and its incorporation into meat and milk in ruminants 1999. In Advances in Conjugated Linoleic Acid Reserch; Yurawecz, M.P., Mossoba, M.M., Kramer, J.K.G., Pariza, M.W., Nelson, G.J., Eds.; AOCS Press: Champaign, IL, USA, 2003; Volume 1, pp. 180–220. [Google Scholar]
  11. Griinari, J.M.; Corl, B.A.; Lacy, S.H.; Chouinard, P.Y.; Nurmela, K.V.V.; Bauman, D.E. Conjugated Linoleic Acid Is Synthesized Endogenously in Lactating Dairy Cows by D9-Desaturase. J. Nutr. 2000, 130, 2285–2291. [Google Scholar] [CrossRef]
  12. Lock, A.L.; Garnsworthy, P.C. Independent effects of dietary linoleic and linolenic fatty acids on the conjugated linoleic acid content of cow’s milk. Anim. Sci. 2002, 74, 163–176. [Google Scholar] [CrossRef]
  13. Piperova, L.S.; Sampugna, J.; Teter, B.B.; Kalscheur, K.F.; Yurawecz, M.P.; Ku, Y.; Morehouse, K.M.; Erdman, R.A. Duodenal and Milk Trans Octadecenoic Acid and Conjugated Linoleic Acid (CLA) Isomers Indicate that Postabsorptive Synthesis Is the Predominant Source of cis-9-Containing CLA in Lactating Dairy Cows. J. Nutr. 2002, 132, 1235–1241. [Google Scholar] [CrossRef] [Green Version]
  14. Kay, J.K.; Mackle, T.R.; Auldist, M.J.; Thompson, N.A.; Bauman, D.E. Endogenous synthesis of cis-9, trans-11 conjugated linoleic acid in pasture-fed dairy cows. J. Dairy Sci. 2002, 85, 176. [Google Scholar] [CrossRef] [Green Version]
  15. Loor, J.J.; Herbein, J.H.; Polan, C.E. Trans18:1 and 18:2 Isomers in Blood Plasma and Milk Fat of Grazing Cows Fed a Grain Supplement Containing Solvent-Extracted or Mechanically Extracted Soybean Meal. J. Dairy Sci. 2002, 85, 1197–1207. [Google Scholar] [CrossRef]
  16. Gillis, M.H.; Duckett, S.K.; Sackman, J.S.; Keisler, D.H. Effect of rumen-protected conjugated linoleic acid (CLA) or linoleic acid on leptin and CLA content of bovine adipose depots. J. Anim. Sci. 2003, 81, 12. [Google Scholar]
  17. Bolte, M.R.; Hess, B.W.; Means, W.J.; Moss, G.E.; Rule, D.C. Feeding lambs high-oleate or high linoleate safflower seeds differentially influences carcass fatty acid composition. J. Anim. Sci. 2002, 80, 609–616. [Google Scholar] [CrossRef]
  18. Yurawecz, M.P.; Roach, J.A.G.; Sehat, N.; Mossoba, M.M.; Kramer, J.K.G.; Fritsche, J.; Steinhart, H.; Ku, Y. A new conjugated linoleic acid isomer, 7 trans, 9 cis-octadecadienoic acid, in cow milk, cheese beef and human milk and adipose tissue. Lipids 1998, 33, 803–809. [Google Scholar] [CrossRef] [PubMed]
  19. Parodi, P.W. Conjugated linoleic acid and other anticarcinogenic agents of bovine milk fat. J. Dairy Sci. 1999, 82, 1339–1349. [Google Scholar] [CrossRef]
  20. Ward, R.J.; Travers, M.T.; Richards, S.E.; Vernon, R.G.; Salter, A.M.; Buttery, P.J.; Barber, M.C. Stearoyl-CoA desaturase mRNA is transcribed from a single gene in the ovine genome. Biochim. Biophys. Acta 1998, 1391, 145–156. [Google Scholar] [CrossRef]
  21. Chung, M.; Ha, S.; Jeong, S.; Bok, J.; Cho, K.; Baik, M.; Choi, Y. Cloning and characterization of bovine stearoyl CoA desaturasel cDNA from adipose tissues. Biosci. Biotechnol. Biochem. 2000, 64, 1526–1530. [Google Scholar] [CrossRef] [PubMed]
  22. Bernard, L.; Leroux, C.; Hayes, H.; Gautier, M.; Chilliard, Y.; Martin, P. Characterization of the caprine stearoyl- CoA desaturase gene and its mRNA showing an unsually long 3’-UTR sequence arising from a single exon. Gene 2001, 281, 53–61. [Google Scholar] [CrossRef]
  23. Moioli, B.; Orrù, L.; Catillo, G.; Congiu, G.B.; Napolitano, F. Partial sequencing of Stearoyl-CoA desaturase gene in buffalo. Ita. J. Anim. Sci. 2005, 4, 25–27. [Google Scholar] [CrossRef]
  24. Gu, M.; Cosenza, G.; Iannaccone, M.; Macciotta, N.P.P.; Guo, Y.; Di Stasio, L.; Pauciullo, A. The single nucleotide polymorphism g.133A > C in the stearoyl CoA desaturase gene (SCD) promoter affects gene expression and quali-quantitative properties of river buffalo milk. J. Dairy Sci. 2019, 102, 442–451. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Medrano, J.F.; Johnson, A.; DePeters, E.J.; Islas, A. Genetic modification of the composition of milk fat: Identification of polymorphisms within the bovine stearoyl-CoA desaturase gene. J. Dairy Sci. 1999, 82, 71. [Google Scholar]
  26. Martin, G.S.; Lunt, D.K.; Britain, K.G.; Smith, S.B. Postnatal development of stearoyl coenzyme A desaturase gene expression and adiposity in bovine subcutaneous adipose tissue. J. Anim. Sci. 1999, 77, 630–636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Qin, N.; Bayat, A.; Trevisi, E.; Minuti, A.; Kairenius, P.; Viitala, S.; Mutikainen, M.; Leskinen, H.; Elo, K.; Kokkonen, T.; et al. Dietary supplement of conjugated linoleic acids or polyunsaturated fatty acids suppressed the mobilization of body fat reserves in dairy cows at early lactation through different pathways. J. Dairy Sci. 2018, 101, 7954–7970. [Google Scholar] [CrossRef]
  28. Kim, H.J.; Miyazaki, M.; Ntambi, J.M. Dietary cholesterol opposes PUFA-mediated repression of the stearoyl-CoA desaturase-1 gene by SREBP-1 independent mechanism. J. Lipid Res. 2002, 43, 1750–1757. [Google Scholar] [CrossRef] [Green Version]
  29. Ntambi, J.M. Regulation of stearoyl-CoA desaturase by polyunsatured fatty acids and cholesterol. J. Lipid Res. 1999, 40, 1549–1558. [Google Scholar] [CrossRef]
  30. Singh, K.; Hartley, D.G.; MC Fadden, T.B.; Mackenzie, D.D.S. Dietary fat regulates mammary stearoyl CoA desaturase expression and activity in lactating mice. J. Dairy Res. 2004, 71, 1–6. [Google Scholar] [CrossRef] [PubMed]
  31. Bernard, L.; Rouel, J.; Leroux, C.; Ferlay, A.; Faulconnier, Y.; Legrand, P.; Chilliard, Y. Mammary Lipid Metabolism and Milk Fatty Acid Secretion in Alpine Goats Fed Vegetable Lipids. J. Dairy Sci. 2005, 88, 1478–1489. [Google Scholar] [CrossRef] [Green Version]
  32. Daniel, Z.C.T.R.; Wynn, R.J.; Salter, A.M.; Buttery, P.J. Differing effects of forage and concentrate diets on the oleic acid and conjugated linoleic acid content of sheep tissues: The role of stearoyl-CoA desaturase. J. Anim. Sci. 2004, 82, 747–758. [Google Scholar] [CrossRef] [PubMed]
  33. Tudisco, R.; Calabrò, S.; Cutrignelli, M.I.; Moniello, G.; Grossi, M.; Gonzalez, O.J.; Piccolo, V.; Infascelli, F. Influence of organic systems on Stearoyl-CoA desaturase in goat milk. Small Rum. Res. 2012, 106, 37–42. [Google Scholar] [CrossRef]
  34. Tudisco, R.; Grossi, M.; Calabrò, S.; Cutrignelli, M.I.; Musco, N.; Addi, A.; Infascelli, F. Influence of pasture on goat milk fatty acids and Stearoyl-CoA desaturase expression in milk somatic cells. Small Rum. Res. 2014, 122, 38–43. [Google Scholar] [CrossRef]
  35. Tudisco, R.; Morittu, V.M.; Addi, L.; Moniello, G.; Grossi, M.; Musco, N.; Grazioli, R.; Mastellone, V.; Pero, M.E.; Lombardi, P.; et al. Influence of pasture on stearoyl-coa desaturase and mirna 103 expression in goat milk: Preliminary results. Animals 2019, 9, 606. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Tudisco, R.; Chiofalo, B.; Addi, L.; Lo Presti, V.; Rao, R.; Calabro’, S.; Musco, N.; Grossi, M.; Cutrignelli, M.I.; Mastellone, V.; et al. Effect of hydrogenated palm oil dietary supplementation on milk yield and composition, fatty acids profile and Stearoyl-CoA desaturase expression in goat milk. Small Rum. Res. 2015, 132, 72–78. [Google Scholar] [CrossRef]
  37. Tudisco, R.; Chiofalo, B.; Lo Presti, V.; Morittu, V.M.; Moniello, G.; Grossi, M.; Musco, N.; Grazioli, R.; Mastellone, V.; Lombardi, P.; et al. Influence of feeding linseed on SCD activity in grazing goat mammary glands. Animals 2019, 9, 786. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Lee, J.S.; Pinnamaneni, S.K.; Eo, S.J.; Cho, I.H.; Pyo, J.H.; Kim, C.K.; Sinclair, A.J.; Febbraio, M.A.; Watt, M.J. Saturated, but not n-6 polyunsaturated, fatty acids induce insulin resistance: Role of intramuscular accumulation of lipid metabolites. J. Appl. Physiol. 2006, 100, 1467–1474. [Google Scholar] [CrossRef] [Green Version]
  39. Pinnamaneni, S.; Southgate, R.; Febbraio, M.; Watt, M. Stearoyl CoA desaturase 1 is elevated in obesity but protects against fatty acid-induced skeletal muscle insulin resistance in vitro. Diabetologia 2006, 49, 3027–3037. [Google Scholar] [CrossRef] [Green Version]
  40. Kus, V.; Prazak, T.; Brauner, P.; Hensler, M.; Kuda, O.; Flachs, P.; Janovska, P.; Medrikova, D.; Rossmeisl, M.; Jilkova, Z.; et al. Induction of muscle thermogenesis by high-fat diet in mice: Association with obesity-resistance. Am. J. Physiol. Endocrinol. Metab. 2008, 295, E356–E367. [Google Scholar] [CrossRef] [PubMed]
  41. Pavan, E.; Duckett, S.K. Corn oil supplementation to steers grazing endophyte-free tall fescue. II. Effects on longissimus muscle and subcutaneous adipose fatty acid composition and stearoyl-CoA desaturase activity and expression. J. Anim. Sci. 2007, 85, 1731–1740. [Google Scholar] [CrossRef]
  42. Janovská, A.; Hatzinikolas, G.; Mano, M.; Gary, A. Wittert The effect of dietary fat content on phospholipid fatty acid profile is muscle fiber type dependent. Am. J. Physiol. Endocrinol. Metab. 2010, 298, E779–E786. [Google Scholar] [CrossRef] [Green Version]
  43. Pauciullo, A.; Cosenza, G.; D’Avino, A.; Colimoro, L.; Nicodemo, D.; Coletta, A.; Feligini, M.; Marchitelli, C.; Di Berardino, D.; Ramunno, L. Sequence analysis and genetic variability of stearoyl CoA desaturase (SCD) gene in the Italian Mediterranean river buffalo. Mol. Cell. Probes 2010, 24, 407–410. [Google Scholar] [CrossRef] [PubMed]
  44. Pauciullo, A.; Cosenza, G.; Steri, R.; Coletta, A.; La Battaglia, A.; Di Berardino, D.; Macciotta, N.P.P.; Ramunno, L. A single nucleotide polymorphism in the promoter region of river buffalo stearoyl CoA desaturase gene (SCD) is associated with milk yield. J. Dairy Res. 2012, 79, 429–435. [Google Scholar] [CrossRef] [Green Version]
  45. Yadav, P.; Kumar, P.; Mukesh, M.; Kataria, R.S.; Yadav, A.; Mohanty, A.K.; Mishra, B.P. Kinetics of lipogenic genes expression in milk purified mammary epithelial cells (MEC) across lactation and their correlation with milk and fat yield in buffalo. Res. Vet. Sci. 2015, 99, 129–136. [Google Scholar] [CrossRef]
  46. Janmeda, M.; Kharadi, V.; Pandya, G.; Brahmkshtri, B.; Ramani, U.; Tyagi, K. Relative gene expression of fatty acid synthesis genes at 60 days postpartum in bovine mammary epithelial cells of Surti and Jafarabadi buffaloes. Vet. World 2017, 10, 467–476. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Li, Z.; Lu, S.; Cui, K.; Shafique, L.; Rehman, S.; Luo, C.; Wang, Z.; Ruan, J.; Qian, Q.; Liu, Q. Fatty acid biosynthesis and transcriptional regulation of Stearoyl-CoA Desaturase 1 (SCD1) in buffalo milk. BMC Genet. 2020, 21, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. AOAC. Official Methods of Analysis, 19th ed.; AOAC: Arlington, VA, USA, 2012. [Google Scholar]
  49. Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and non starch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
  50. INRA. Alimentation Des Ruminants; INRA: Paris, France, 1978. [Google Scholar]
  51. Folch, J.; Lees, M.; Sloane-Stanley, G.H.S. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
  52. Christie, W.W. A simple procedure of rapid transmethylation of glycerolipids and cholesteryl esters. J. Lipid Res. 1982, 23, 1072–1075. [Google Scholar] [CrossRef]
  53. SAS 2000. SAS Institute, NC, USA. Available online: https://support.sas.com/en/software/system-2000-support.html (accessed on 10 October 2021).
  54. Calabrò, S.; Cutrignelli, M.I.; Gonzalez, O.J.; Chiofalo, B.; Grossi, M.; Tudisco, R.; Panetta, C.; Infascelli, F. Meat quality of buffalo young bulls fed faba bean as protein source. Meat Sci. 2014, 96, 591–596. [Google Scholar] [CrossRef] [Green Version]
  55. Valsta, L.M.; Tapanainen, H.; Mannisto, S. Meat fats in nutrition—A review. Meat Sci. 2005, 70, 525–530. [Google Scholar] [CrossRef] [PubMed]
  56. Scerra, M.; Caparra, P.; Foti, F.; Cilione, C.; Zappia, G.; Motta, C.; Scerra, V. Intramuscular fatty acid composition of lambs fed diets containing alternative protein sources. Meat Sci. 2011, 87, 229–233. [Google Scholar] [CrossRef] [PubMed]
  57. Cutrignelli, M.I.; Calabrò, S.; Bovera, F.; Tudisco, R.; D’Urso, S.; Marchiello, M.; Piccolo, V.; Infascelli, F. Effects of two protein sources and energy level of diet on the performance of young Marchigiana bulls. 2. Meat quality. Ital. J. Anim. Sci. 2008, 7, 271–285. [Google Scholar] [CrossRef]
  58. Woods, V.B.; Fearon, E.A. Dietary sources of unsaturated fatty acids for animals and their transfer into meat, milk and eggs: A review. Livest. Sci. 2009, 126, 1–20. [Google Scholar] [CrossRef]
  59. Hidiroglu, N.; McDowell, L.R.; Johnson, D.D. Effect of diet on animal performance, lipid composition of subcutaneous adipose tissue and liver tissue of beef cattle. Meat Sci. 1987, 20, 195–210. [Google Scholar] [CrossRef]
  60. Mitchell, G.E.; Reed, A.W.; Rogers, S.A. Influence of feeding regime on the sensory qualities and fatty acid contents of beefsteaks. J. Food Sci. 1991, 56, 1102–1103. [Google Scholar] [CrossRef]
  61. Rowe, A.; Macedo, F.A.F.; Visentainer, J.V.; Souza, N.E.; Matsushita, M. Muscle composition and fatty acid profile in lambs fattened in dry lot or pasture. Meat Sci. 1999, 51, 283–288. [Google Scholar] [CrossRef]
  62. Lock, A.L.; Garnsworthy, P.C. Seasonal variation in milk conjugated linoleic acid and 9-desaturase activity in dairy cows. Livest. Prod. Sci. 2003, 79, 47–59. [Google Scholar] [CrossRef]
  63. Schroeder, A.; Mueller, O.; Stocker, S.; Salowsky, R.; Leiber, M.; Gassmann, M.; Lightfoot, S.; Menzel, W.; Granzow, M.; Ragg, T. The RIN: An RNA integrity number for assigning integrity values to RNA measurements. BMC Mol. Biol. 2003, 7, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Cedernaes, J.; Alsiö, J.; Västermark, Å.; Risérus, U.; Schiöth, H.B. Adipose tissue stearoyl-CoA desaturase 1 index is increased and linoleic acid is decreased in obesity-prone rats fed a high-fat diet. Lipids Health Dis. 2013, 12, 2. [Google Scholar] [CrossRef] [Green Version]
  65. Wang, Y.H.; Bower, N.I.; Reverter, A.; Tan, S.H.; De Jager, N.; Wang, R.; McWilliam, S.M.; Café, L.M.; Greenwood, P.L.; Lehnert, S.A. Gene expression patterns during intramuscular fat development in cattle. J. Anim. Sci. 2009, 87, 119–130. [Google Scholar] [CrossRef] [PubMed]
  66. Hiller, B.; Herdmann, A.; Nuernberg, K. Dietary n-3 Fatty Acids Significantly Suppress Lipogenesis in Bovine Muscle and Adipose Tissue: A Functional Genomics Approach. Lipids 2011, 46, 557–567. [Google Scholar] [CrossRef]
  67. Hiller, B.; Hocquette, J.; Cassar-Malek, I.; Nuernberg, G.; Nuernberg, K. Dietary n-3 PUFA affect lipid metabolism and tissue function-related genes in bovine muscle. Br. J. Nutr. 2012, 108, 858–863. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Urrutia, O.; Mendizaba, J.A.; Insausti, K.; Soret, B.; Purroy, A.; Arana, A. Effects of Addition of Linseed and Marine Algae to the Diet on Adipose Tissue Development, Fatty Acid Profile, Lipogenic Gene Expression, and Meat Quality in Lambs. PLoS ONE 2016, 11, e0156765. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  69. Waters, S.M.; Kelly, J.P.; O’Boyle, P.; Moloney, A.P.; Kenny, D.A. Effect of level and duration of dietary n-3 polyunsaturated fatty acid supplementation on the transcriptional regulation of Δ9-desaturase in muscle of beef cattle. J. Anim. Sci. 2009, 87, 244–253. [Google Scholar] [CrossRef] [PubMed]
  70. Ebrahimi, M.; Rajion, M.A.; Goh, Y.M.; Sazili, A.Q.; Schonewille, J.T. Effect of Linseed Oil Dietary Supplementation on Fatty Acid Composition and Gene Expression in Adipose Tissue of Growing Goats. BioMed Res. Int. 2013, 2013, 194625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Table
Table 1. Pairs of primers used for Real Time PCR.
Table 1. Pairs of primers used for Real Time PCR.
Sequence (5′->3′)Tm (°C)Product Length (bp)References
GAPDH-FTGGAAAGGCCATCACCATCT60119Li et al. 2020
GAPDH-RCCCACTTGATGTTGGCAG
Actin-FTCCTCCCTGGAGAAGAGCTA60101Gu et al. 2019
Actin-RAGGAAGGAAGGCTGGAAGAG
18S rRNA-FCGTTCTTAGTTGGTGG6076Gu et al. 2019
18S rRNA-FGTAACTAGTTAGCATGC
SCD F CAGCGGAAGGTCCCGA60157 Gu et al. 2019
SCD R CAAGTGGGCCGGCATC
Table
Table 2. Feeds and diets chemical composition (g/kg DM) and nutritive value (VFU/kg DM).
Table 2. Feeds and diets chemical composition (g/kg DM) and nutritive value (VFU/kg DM).
CSOHLFCHFCLF DietHF DietSEM
CP 77.290.1220.0220.0140.6 140.9 4.34
EE 21.022.224.7120.723.1 B 71.1 A 1.92
NDF482.2560.0216.1233.2363.0 381.6 8.46
ADF272.1370.087.6103.4197.5 B275.4 A12.67
ADL31.338.112.221.424.227.31.03
VFU/kg DM0.770.631.081.100.900.910.01
CS: corn silage; OH: oat hay; VFU: veal forage unit. LFC (low fat concentrate; % DM): corn 10, barley 14, wheat bran 28, faba bean (31% CP tannin-free variety) 48. HFC (high fat concentrate; % DM): corn 18, barley 16, wheat bran 18, soybean (33% CP) 48. A-B: p < 0.01.
Table
Table 3. Dietary main fatty acid intake (g/kg DM).
Table 3. Dietary main fatty acid intake (g/kg DM).
LF DietHF Diet
C14:00.020.14
C16:02.297.54
C16:10.020.06
C18:00.621.49
C18:1 cis 92.8411.6
C18:1 cis 110.181.07
C18:2 cis 9 cis 127.9728.40
C18:3 cis 9 cis12 cis151.593.70
C20:00.090.14
C22:00.090.21
Table
Table 4. Longissimus thoracis chemical composition.
Table 4. Longissimus thoracis chemical composition.
LFHF
Moisture %75.375.4
Fat %1.8 1.9
Protein % 21.421.2
Ash %0.710.70
Table
Table 5. Fatty acids composition of Longissimus thoracis muscle (g/100 g FA).
Table 5. Fatty acids composition of Longissimus thoracis muscle (g/100 g FA).
Acids LFHFSEM
Myristic C14:01.25 ± 0.21.18 ± 0.10.336
MyristoleicC14:1 cis-90.47 ± 0.070.47 ± 0.020.039
PentadecylicC15:0 iso0.17 ± 0.020.16 ± 0.020.010
MethyltetradecanoicC15:0 ante iso0.21 ± 0.10.24 ± 0.090.009
PalmiticC16:020.9 ± 0.721.0 ± 0.90.478
PalmitoleicC16:11.13 ± 0.171.17 ± 0.040.162
MargaricC17:01.20 ± 0.31.24 ± 0.30.089
EptadecenoicC17:1 cis-100.39 ± 0.070.41± 0.080.220
StearicC18:025.1 ± 2.124.6 ± 1.90.370
OctadecenoicC18:1 trans-100.58 ± 0.050.62 ± 0.070.067
trans-VaccenicC18:1 trans-111.32 ± 0.351.30 ± 0.050.067
OleicC18:1 cis-930.55 ± 1.530.86 ± 0.60.643
C18:1 cis-111.20 ± 0.091.20 ± 0.060.660
LinoleicC18:2 ɷ-67.89 ± 0.97.92 ± 0.40.182
alpha-LinolenicC18:3 ɷ-30.59 ± 0.020.56 ± 0.020.093
gamma-LinolenicC18:3 ɷ-60.09 ± 0.010.09 ± 0.010.002
Rumeniccis 9-trans 11 CLA0.04 ± 0.0030.05 ± 0.0040.005
Octa-deca Dienoictrans10-trans12 CLA0.16 ± 0.010.17 ± 0.030.060
ArachidicC20:00.21 ± 0.050.24 ± 0.060.093
GondoicC20:1 cis-110.90 ± 0.090.98 ± 0.050.025
EicosadienoicC20:2 cis11,140.16 ± 0.060.20 ± 0.060.056
Dihomo-gamma-linolenicC20:3 ɷ-60.52 ± 0.080.40 ± 0.050.096
EicosapentaenoicC20:3 ɷ-3 0.28 ± 0.050.21 ± 0.060.023
ArachidonicC20:4 ɷ-31.78 ± 0.11.62 ± 0.10.018
EicosapentanoicC20:5 ɷ-30.21 ± 0.010.22 ± 0.030.067
BehenicC22:00.18 ± 0.010.18 ± 0.020.051
AdrenicC22:4 ɷ-60.28 ± 0.030.29 ± 0.020.078
DocosapentanoicC22:5 ɷ-30.41 ± 0.020.40 ± 0.030.049
DocosahexaenoicC22:6 ɷ-30.20 ± 0.030.20 ± 0.030.034
TricosylicC23:00.15 ± 0.010.22 ± 0.020.012
LignocericC24:00.18 ± 0.020.18 ± 0.030.027
NervonicC24:1 cis150.40 ± 0.020.40 ± 0.030.080
SFA50.6 ± 0.4749.9 ± 0.576.231
MUFA36.3 ± 1.336.5 ± 0.673.902
PUFA12.8 ± 1.213.4 ± 0.481.924
PUFA ɷ 68.78 ± 0.88.07 ± 0.41.401
PUFA ɷ 33.47 ± 0.23.21 ± 0.30.530
ɷ 6/ɷ 32.53 ± 0.32.51 ± 0.30.630
CLA0.231 ± 0.010.212 ± 0.010.072
C14:1 cis-9/C14:00.376 ± 0.10.398 ± 0.090.106
C16:1/C16:00.054 ± 0.020.055± 0.010.0042
C18:1 cis-9/C18:01.22 ± 0.31.25 ± 0.20.652
SEM: standard error of the mean.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Iommelli, P.; Infascelli, F.; Musco, N.; Grossi, M.; Ferrara, M.; Sarubbi, F.; D’Aniello, B.; Lombardi, P.; Tudisco, R. Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile. Agriculture 2021, 11, 1209. https://doi.org/10.3390/agriculture11121209

AMA Style

Iommelli P, Infascelli F, Musco N, Grossi M, Ferrara M, Sarubbi F, D’Aniello B, Lombardi P, Tudisco R. Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile. Agriculture. 2021; 11(12):1209. https://doi.org/10.3390/agriculture11121209

Chicago/Turabian Style

Iommelli, Piera, Federico Infascelli, Nadia Musco, Micaela Grossi, Maria Ferrara, Fiorella Sarubbi, Biagio D’Aniello, Pietro Lombardi, and Raffaella Tudisco. 2021. "Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile" Agriculture 11, no. 12: 1209. https://doi.org/10.3390/agriculture11121209

APA Style

Iommelli, P., Infascelli, F., Musco, N., Grossi, M., Ferrara, M., Sarubbi, F., D’Aniello, B., Lombardi, P., & Tudisco, R. (2021). Stearoyl-CoA Desaturase Activity and Gene Expression in the Adipose Tissue of Buffalo Bulls Was Unaffected by Diets with Different Fat Content and Fatty Acid Profile. Agriculture, 11(12), 1209. https://doi.org/10.3390/agriculture11121209

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop