Transcriptome-Based Identification and Characterization of Genes Associated with Resistance to Beta-Cypermethrin in Rhopalosiphum padi (Hemiptera: Aphididae)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Aphid Strain
2.2. Bioassay
2.3. RNA Isolation
2.4. Library Preparation and Sequencing
2.5. Functional Annotation
2.6. Differentially Expressed Genes (DEGs) Analysis and Annotation
2.7. Quantitative Real-Time PCR Analysis
3. Results
3.1. Bioassay
3.2. Transcriptome Data Analysis
3.3. Functional Annotation and Classification
3.4. Differentially Expressed Genes Analysis
3.5. GO Classification and KEGG Pathway Identification of DEGs
3.6. Analysis of DEGs Associated with Drug Resistance and qRT-PCR Validation of DEGs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, K.; Zhao, J.N.; Bai, J.Y.; Shang, Y.Z.; Zhang, S.Q.; Hou, Y.F.; Chen, M.H.; Han, Z.J. Pyrethroid resistance and fitness cost conferred by the super-kdr mutation M918L in Rhopalosiphum padi (Hemiptera: Aphididae). J. Econ. Entomol. 2021, 114, 1789–1795. [Google Scholar] [CrossRef] [PubMed]
- Souza, D.; Jimenez, A.V.; Sarath, G.; Meinke, L.J.; Miller, N.J.; Siegfried, B.D. Enhanced metabolism and selection of pyrethroid-resistant western corn rootworms (Diabrotica virgifera virgifera LeConte). Pestic. Biochem. Physiol. 2020, 164, 165–172. [Google Scholar] [CrossRef] [PubMed]
- Hemming-Schroeder, E.; Strahl, S.; Yang, E.; Nguyen, A.; Lo, E.; Zhong, D.B.; Atieli, H.; Githeko, A.; Yan, G.Y. Emerging Pyrethroid Resistance among Anopheles arabiensis in Kenya. Am. J. Trop. Med. Hyg. 2018, 98, 704–709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Radhika, P.; Subbaratnam, G.V. Insecticide resistance in Spodoptera litura F.-A review. J. Cotton Res. Dev. 2007, 21, 88–93. [Google Scholar]
- Rotkin, A.T. Synthetic Pyrethroid Resistance in Dipterans on the Example of the Housefly Musca Domestica (Review); All-Russian Scientific Research Institute for Fundamental and Applied Parasitology of Animals and Plants: Moscow, Russia, 2022; pp. 382–386. [Google Scholar]
- Zhang, D.D.; Xiao, Y.T.; Xu, P.J.; Yang, X.M.; Wu, Q.L.; Wu, K.M. Insecticide resistance monitoring for the invasive populations of fall armyworm, Spodoptera frugiperda in China. J. Integr. Agric. 2021, 20, 783–791. [Google Scholar] [CrossRef]
- Resende, E.S.; Beuzelin, J.M.; Dunkley, V.E.; Paula-Moraes, S.V.; Seal, D.R.; Nuessly, G.S. Pyrethroid Susceptibility in Field Populations of Picture-Winged Flies (Diptera: Ulidiidae) Infesting Fresh Market Sweet Corn in Florida. J. Econ. Entomol. 2022, 115, 1685–1692. [Google Scholar] [CrossRef]
- Valmorbida, I.; Hohenstein, J.D.; Coates, B.S.; Bevilaqua, J.G.; Menger, J.; Hodgson, E.W.; Koch, R.L.; O’Neal, M.E. Association of voltage-gated sodium channel mutations with field-evolved pyrethroid resistant phenotypes in soybean aphid and genetic markers for their detection. Sci. Rep. 2022, 12, 14. [Google Scholar] [CrossRef]
- Chen, X.W.; Tie, M.Y.; Chen, A.Q.; Ma, K.S.; Li, F.; Liang, P.Z.; Liu, Y.; Song, D.L.; Gao, X.W. Pyrethroid resistance associated with M918L mutation and detoxifying metabolism in Aphis gossypii from Bt cotton growing regions of China. Pest Manag. Sci. 2017, 73, 2353–2359. [Google Scholar] [CrossRef]
- Gong, P.; Li, X.; Gao, H.; Wang, C.; Li, M.; Zhang, Y.; Li, X.; Liu, E.; Zhu, X. Field evolved resistance to pyrethroids, neonicotinoids, organophosphates and macrolides in Rhopalosiphum padi (Linnaeus) and Sitobion avenae (Fabricius) from China. Chemosphere 2021, 269, 128747. [Google Scholar] [CrossRef]
- Chen, C.; Shi, X.; Gao, X. Mechanism of insect metabolic resistance to pyrethroid insecticides. Chin. J. Pestic. Sci. 2016, 18, 545–555. [Google Scholar]
- Heckel, D.G. Insecticide resistance after silent spring. Science 2012, 337, 1612–1614. [Google Scholar] [CrossRef] [Green Version]
- Balabanidou, V.; Grigoraki, L.; Vontas, J. Insect cuticle: A critical determinant of insecticide resistance. Curr. Opin. Insect Sci. 2018, 27, 68–74. [Google Scholar] [CrossRef]
- Chen, N.; Pei, X.J.; Li, S.; Fan, Y.L.; Liu, T.X. Involvement of integument-rich CYP4G19 in hydrocarbon biosynthesis and cuticular penetration resistance in Blattella germanica (L.). Pest Manag. Sci. 2020, 76, 215–226. [Google Scholar] [CrossRef]
- Pan, C.Y.; Zhou, Y.; Mo, J.C. The clone of laccase gene and its potential function in cuticular penetration resistance of Culex pipiens pallens to fenvalerate. Pestic. Biochem. Physiol. 2009, 93, 105–111. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Dong, J.; Wu, H.H.; Zhang, H.H.; Zhang, J.Z.; Ma, E.B. Knockdown of cytochrome P450 CYP6 family genes increases susceptibility to carbamates and pyrethroids in the migratory locust, Locusta migratoria. Chemosphere 2019, 223, 48–57. [Google Scholar] [CrossRef]
- Li, X.X.; Shi, H.Y.; Gao, X.W.; Liang, P. Characterization of UDP-glucuronosyltransferase genes and their possible roles in multi-insecticide resistance in Plutella xylostella (L.). Pest Manag. Sci. 2018, 74, 695–704. [Google Scholar] [CrossRef]
- Pavlidi, N.; Vontas, J.; Van Leeuwen, T. The role of glutathione S-transferases (GSTs) in insecticide resistance in crop pests and disease vectors. Curr. Opin. Insect Sci. 2018, 27, 97–102. [Google Scholar] [CrossRef]
- Merzendorfer, H. Chapter one-ABC transporters and their role in protecting insects from pesticides and their Metabolites. In Target Receptors in the Control of Insect Pests: Pt II; Cohen, E., Ed.; Advances in Insect Physiology; Academic Press Ltd.-Elsevier Science Ltd.: London, UK, 2014; Volume 46, pp. 1–72. [Google Scholar]
- Sogorb, M.A.; Vilanova, E. Enzymes involved in the detoxification of organophosphorus, carbamate and pyrethroid insecticides through hydrolysis. Toxicol. Lett. 2002, 128, 215–228. [Google Scholar] [CrossRef]
- Zheng, S.C.; Luo, J.Y.; Zhu, X.Z.; Gao, X.K.; Hua, H.X.; Cui, J.J. Transcriptomic analysis of salivary gland and proteomic analysis of oral secretion in Helicoverpa armigera under cotton plant leaves, gossypol, and tannin stresses. Genomics 2022, 114, 12. [Google Scholar] [CrossRef]
- Wang, K.Y.; Liu, T.X.; Yu, C.H.; Jiang, X.Y.; Yi, M.Q. Resistance of Aphis gossypii (Homoptera: Aphididae) to fenvalerate and imidacloprid and activities of detoxification enzymes on cotton and cucumber. J. Econ. Entomol. 2002, 95, 407. [Google Scholar] [CrossRef]
- Li, Y.; Xu, Z.F.; Shi, L.; Shen, G.M.; He, L. Insecticide resistance monitoring and metabolic mechanism study of the green peach aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae), in Chongqing, China. Pestic. Biochem. Physiol. 2016, 132, 21–28. [Google Scholar] [CrossRef] [PubMed]
- Xi, J.; Pan, Y.O.; Bi, R.; Gao, X.W.; Chen, X.W.; Peng, T.F.; Zhang, M.; Zhang, H.; Hu, X.Y.; Shang, Q.L. Elevated expression of esterase and cytochrome P450 are related with lambda-cyhalothrin resistance and lead to cross resistance in Aphis glycines Matsumura. Pestic. Biochem. Physiol. 2015, 118, 77–81. [Google Scholar] [CrossRef] [PubMed]
- Du, T.H.; Fu, B.L.; Wei, X.G.; Yin, C.; Yang, J.; Huang, M.J.; Liang, J.J.; Gong, P.P.; Liu, S.N.; Xue, H.; et al. Knockdown of UGT352A5 decreases the thiamethoxam resistance in Bemisia tabaci (Hemiptera: Gennadius). Int. J. Biol. Macromol. 2021, 186, 100–108. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhu, B.; Gao, X.; Liang, P. Over-expression of UDP–glycosyltransferase gene UGT2B17 is involved in chlorantraniliprole resistance in Plutella xylostella (L.). Pest Manag. Sci. 2017, 73, 1402–1409. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Xia, J.; Shang, Q.; Song, D.; Gao, X. UDP-glucosyltransferases potentially contribute to imidacloprid resistance in Aphis gossypii glover based on transcriptomic and proteomic analyses. Pestic. Biochem. Physiol. 2019, 159, 98–106. [Google Scholar] [CrossRef]
- Zhou, Y.; Fu, W.B.; Si, F.L.; Yan, Z.T.; Zhang, Y.J.; He, Q.Y.; Chen, B. UDP-glycosyltransferase genes and their association and mutations associated with pyrethroid resistance in Anopheles sinensis (Diptera: Culicidae). Malar. J. 2019, 18, 62. [Google Scholar] [CrossRef] [Green Version]
- Deng, D.H.; Duan, W.B.; Wang, H.; Zhang, K.; Guo, J.L.; Yuan, L.L.; Wang, L.K.; Wu, S.Y. Assessment of the effects of lethal and sublethal exposure to dinotefuran on the wheat aphid Rhopalosiphum padi (Linnaeus). Ecotoxicology 2019, 28, 825–833. [Google Scholar] [CrossRef]
- Zhang, Q.Q.; Li, W.Q.; Lu, Z.B.; Li, L.L.; Yu, Y.; Li, C.; Men, X.Y. Sublethal effects of beta-cypermethrin on the bird cherry-oat aphid Rhopalosiphum padi (Hemiptera: Aphididae). J. Asia-Pac. Entomol. 2019, 22, 693–698. [Google Scholar] [CrossRef]
- Feng, K.Y.; Liu, J.L.; Zhao, M.Y.; Jiang, Z.X.; Liu, P.L.; Wei, P.; Dou, W.; He, L. The dynamic changes of genes revealed that persistently overexpressed genes drive the evolution of cyflumetofen resistance in Tetranychus cinnabarinus. Insect Sci. 2022, 11, 20. [Google Scholar] [CrossRef]
- Wang, X.; Xu, X.; Ullah, F.; Ding, Q.; Gao, X.W.; Desneux, N.; Song, D.L. Comparison of full-length transcriptomes of different imidacloprid-resistant strains of Rhopalosiphum padi (L.). Entomol. Gen. 2021, 41, 289–304. [Google Scholar] [CrossRef]
- Gong, P.; Chen, D.; Wang, C.; Li, M.; Li, X.; Zhang, Y.; Li, X.; Zhu, X. Susceptibility of four species of aphids in wheat to seven insecticides and its relationship to detoxifying enzymes. Front. Physiol. 2021, 11, 1852. [Google Scholar] [CrossRef]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, 12. [Google Scholar] [CrossRef] [Green Version]
- Li, M.Y.; Li, X.N.; Wang, C.; Li, Q.C.; Zhu, S.G.; Zhang, Y.H.; Li, X.R.; Yang, F.S.; Zhu, X. Selection and validation of reference genes for qRT-PCR analysis of Rhopalosiphum padi (Hemiptera: Aphididae). Front. Physiol. 2021, 12, 13. [Google Scholar] [CrossRef]
- Schmittgen, T.D. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Kaplanoglu, E.; Chapman, P.; Scott, I.M.; Donly, C. Overexpression of a cytochrome P450 and a UDP-glycosyltransferase is associated with imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata. Sci. Rep. 2017, 7, 10. [Google Scholar] [CrossRef] [Green Version]
- Liang, X.; Chen, B.; Qiao, L. Research progress in insect cuticular protein genes. Acta Entomol. Sin. 2014, 57, 1084–1093. [Google Scholar]
- Puinean, A.M.; Foster, S.P.; Oliphant, L.; Denholm, I.; Field, L.M.; Millar, N.S.; Williamson, M.S.; Bass, C. Amplification of a cytochrome P450 gene is associated with resistance to neonicotinoid insecticides in the Aphid Myzus persicae. PLoS Genet. 2010, 6, 11. [Google Scholar] [CrossRef] [Green Version]
- Pan, Y.; Peng, T.; Gao, X.; Zhang, L.; Yang, C.; Xi, J.; Xin, X.; Bi, R.; Shang, Q. Transcriptomic comparison of thiamethoxam-resistance adaptation in resistant and susceptible strains of Aphis gossypii Glover. Comp. Biochem. Physiol. Part D Genom. Proteom. 2015, 13, 10–15. [Google Scholar] [CrossRef]
- Chen, E.H.; Hou, Q.L. Identification and expression analysis of cuticular protein genes in the diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae). Pestic. Biochem. Physiol. 2021, 178, 13. [Google Scholar] [CrossRef]
- Meng, J.; Chen, X.; Zhang, C. Transcriptome-based identification and characterization of genes responding to imidacloprid in Myzus persicae. Sci. Rep. 2019, 9, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balabanidou, V.; Kefi, M.; Aivaliotis, M.; Koidou, V.; Girotti, J.R.; Mijailovsky, S.J.; Juarez, M.P.; Papadogiorgaki, E.; Chalepakis, G.; Kampouraki, A.; et al. Mosquitoes cloak their legs to resist insecticides. Proc. R. Soc. B-Biol. Sci. 2019, 286, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dang, K.; Doggett, S.L.; Veera Singham, G.; Lee, C.Y. Insecticide resistance and resistance mechanisms in bed bugs, Cimex spp. (Hemiptera: Cimicidae). Parasites Vectors 2017, 10, 1–31. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.K.; Wang, C.P.; Gao, X.K.; Luo, J.Y.; Zhu, X.Z.; Wan, S.M. Characterization of P450 monooxygenase gene family in the cotton aphid, Aphis gossypii Glover. J. Asia-Pac. Entomol. 2022, 25, 10. [Google Scholar] [CrossRef]
- Tang, T.; Zhao, C.; Feng, X.; Liu, X.; Qiu, L. Effects of RNAi-mediated silencing of several components of cytochrome P450s on beta-cypermethrin toxicity against Helicoverpa armigera. Acta Phytophylacica Sin. 2013, 40, 355–362. [Google Scholar]
- Wang, R.L.; Zhu-Salzman, K.; Baerson, S.R.; Xin, X.W.; Li, J.; Su, Y.J.; Zeng, R.S. Identification of a novel cytochrome P450 CYP321B1 gene from tobacco cutworm (Spodoptera litura) and RNA interference to evaluate its role in commonly used insecticides. Insect Sci. 2017, 24, 235–247. [Google Scholar] [CrossRef]
- Chen, X.E.; Zhang, Y.L. Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b(5) gene from Plutella xylostella: Possible involvement in resistance to beta-cypermethrin. Gene 2015, 558, 208–214. [Google Scholar] [CrossRef]
- Fan, D.; Li, S.; Wang, X.; Pei, H.; Lu, B.; Dong, S.; Muhammad Junaid, S. Cloning of CYP4G51 gene from Aphis glycines and induction effect of imidacloprid stress. J. Northeast. Agric. Univ. 2019, 50, 10–17. [Google Scholar]
- Liu, S.; Liang, Q.M.; Zhou, W.W.; Jiang, Y.D.; Zhu, Q.Z.; Yu, H.; Zhang, C.X.; Gurr, G.M.; Zhu, Z.R. RNA interference of NADPH-cytochrome P450 reductase of the rice brown planthopper, Nilaparvata lugens, increases susceptibility to insecticides. Pest Manag. Sci. 2015, 71, 32–39. [Google Scholar] [CrossRef]
- Cao, J.; Gao, Q.; Wang, J.; Zhou, H.; Li, J. Studies on the molecular mechanism of Anopheles anthropophagus resistance to deltamethrin. III. Semi-quantitative analysis of P450 genes mRNA between susceptible and deltamethrin-resistant strains of Anopheles anthropophagus. Chin. J. Schistosomiasis Control 2005, 17, 433–436. [Google Scholar]
- Yang, Y.X.; Zhang, Y.X.; Yang, B.J.; Fang, J.C.; Liu, Z.W. Transcriptomic responses to different doses of cycloxaprid involved in detoxification and stress response in the whitebacked planthopper, Sogatella furcifera. Entomol. Exp. Et Appl. 2016, 158, 248–257. [Google Scholar] [CrossRef]
- Avicor, S.W.; Wajidi, M.F.F.; El-garj, F.M.A.; Jaal, Z.; Yahaya, Z.S. Insecticidal activity and expression of cytochrome P450 family 4 genes in Aedes albopictus after exposure to pyrethroid mosquito coils. Protein J. 2014, 33, 457–464. [Google Scholar] [CrossRef]
- Kamiya, E.; Yamakawa, M.; Shono, T.; Kono, Y. Molecular cloning, nucleotide sequences and gene expression of new cytochrome P450s (CYP6A24, CYP6D3v2) from the pyrethroid resistant housefly, Musca domestica L. (Diptera: Muscidae). Appl. Entomol. Zool. 2001, 36, 225–229. [Google Scholar] [CrossRef] [Green Version]
- Hopkins, B.W.; Longnecker, M.T.; Pietrantonio, P.V. Transcriptional overexpression of CYP6B8/CYP6B28 and CYP6B9 is a mechanism associated with cypermethrin survivorship in field-collected Helicoverpa zea (Lepidoptera: Noctuidae) moths. Pest Manag. Sci. 2011, 67, 21–25. [Google Scholar] [CrossRef]
- Gao, S.S.; Sun, H.D.; Zhang, J.H.; Zhang, Y.L.; Sun, P.P.; Shang, J.; Zhang, K.P.; Li, R.M. Knockdown of Uridine Diphosphate Glucosyltransferase 86Dg Enhances Susceptibility of Tribolium castaneum (Coleoptera:Tenebrionidae) to Artemisia vulgaris (Asterales: Asteraceae) Essential Oil. J. Econ. Entomol. 2021, 114, 2553–2561. [Google Scholar] [CrossRef]
- Bock, K.W. The UDP-glycosyltransferase (UGT) superfamily expressed in humans, insects and plants: Animal-plant arms-race and co-evolution. Biochem. Pharmacol. 2016, 99, 11–17. [Google Scholar] [CrossRef]
- Pan, Y.O.; Tian, F.Y.; Wei, X.; Wu, Y.Q.; Gao, X.W.; Xi, J.H.; Shang, Q.L. Thiamethoxam Resistance in Aphis gossypii Glover Relies on Multiple UDP-Glucuronosyltransferases. Front. Physiol. 2018, 9, 9. [Google Scholar] [CrossRef] [Green Version]
- Yan, M.W.; Xing, X.R.; Wu, F.A.; Wang, J.; Sheng, S. UDP-glycosyltransferases contribute to the tolerance of parasitoid wasps towards insecticides. Pestic. Biochem. Physiol. 2021, 179, 8. [Google Scholar] [CrossRef]
- Hu, B.; Zhang, S.H.; Ren, M.M.; Tian, X.R.; Wei, Q.; Mburu, D.K.; Su, J.Y. The expression of Spodoptera exigua P450 and UGT genes: Tissue specificity and response to insecticides. Insect Sci. 2019, 26, 199–216. [Google Scholar] [CrossRef] [Green Version]
- Huang, F.; Chai, C.; Zhang, Z.; Liu, Z.; Dai, F.; Lu, C.; Xiang, Z. The UDP-glucosyltransferase multigene family in Bombyx mori. Bmc Genom. 2008, 9, 563. [Google Scholar] [CrossRef] [Green Version]
- Dermauw, W.; Van Leeuwen, T. The ABC gene family in arthropods: Comparative genomics and role in insecticide transport and resistance. Insect Biochem. Mol. Biol. 2014, 45, 89–110. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Cai, T.W.; Qin, Y.; Zhang, Y.H.; Jin, R.H.; Mao, K.K.; Liao, X.; Wan, H.; Li, J.H. Transcriptional Response of ATP-Binding Cassette (ABC) Transporters to Insecticide in the Brown Planthopper, Nilaparvata lugens (Stal). Insects 2020, 11, 280. [Google Scholar] [CrossRef] [PubMed]
- Rault, L.C.; Johnson, E.J.; O’Neal, S.T.; Chen, R.; McComic, S.E.; Swale, D.R.; Anderson, T.D. Age- and sex-related ABC transporter expression in pyrethroid-susceptible and-resistant Aedes aegypti. Sci. Rep. 2019, 9, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, N.; Zhong, Y.Z.; Lin, L.L.; Xie, M.H.; Zhang, G.L.; Su, W.H.; Li, C.R.; Chen, H.L. Transcriptome Analysis and Identification of Insecticide Tolerance-Related Genes after Exposure to Insecticide in Sitobion avenae. Genes 2019, 10, 951. [Google Scholar] [CrossRef] [Green Version]
- Valenzuela-Miranda, D.; Gallardo-Escarate, C. Caligus rogercresseyi serine proteases: Transcriptomic analysis in response to delousing drugs treatments. Aquaculture 2016, 465, 65–77. [Google Scholar] [CrossRef]
- Li, A.M.; Wang, M.; Chen, Z.L.; Qin, C.X.; Liao, F.; Wu, Z.; He, W.Z.; Lakshmanan, P.; Pan, Y.Q.; Huang, D.L. Integrated Transcriptome and Metabolome Analysis to Identify Sugarcane Gene Defense against Fall Armyworm (Spodoptera frugiperda) Herbivory. Int. J. Mol. Sci. 2022, 23, 3712. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
g9940 | ACACATCGTTGGGAATCG | GCTCTGTAACCACGCTTTC |
g24565 | GCAGTTTGCTTTGCTTGC | TTCGGCTGTCTTGTAATCG |
g488 | CCGCACTTGCCCAATAC | AACCGCTGTGGTCATCG |
g19171 | TGACGCCACATACGACATC | CGATTCTCTTGGTGCCATC |
g11992 | GGTGGCCCAAGAGGTTGTATAGG | TGGACACTGAAGTTTCGCAAGAATG |
g7371 | TAAGGATTTCCCAGCGGA | CGTTTCTCGCCTGTATCAAG |
g9824 | GTTACAAGTTCGCTGGTTTC | CATTGCTGATGCCTCAAG |
g7368 | ATCACTACTCGCATCGCAC | AGATTCGGGTTCAACACC |
g4263 | ACAACAAGCCGTTCCCAAG | ATGGACCTTCGGAGACGAGT |
g4506 | CCTGTTCTTGGATTCCCTC | TGACATCGGTCGGTCTTT |
g16174 | TCCAGAGGTTCGTCAATG | GTTCAGAAAGATAACTGCCG |
g12284 | TGATTCGTCGCACCCAAAC | ACACGCCTTCCGTTGTCTTG |
g7359 | GTCATCAGGTTCTATCTATGGC | TCAGTGTGCCTTCCAAAC |
g8765 | TCCAGAGACATAGCGTTGC | AGACCACACACTGACTGACG |
GAPDH(reference gene) | GCTCCATTAGCCAAGGTTATTC | CAGCACCTCTACCATCTCTCC |
Strain | Generation 1 | LC50 (95%Cl; mg/L) 2 | RR 3 |
---|---|---|---|
SS | - | 3.22 (1.97–5.26) | - |
Beta-R | G24 | 14,774.89 (5808.17–37,603.98) | 4588.48 |
Samples 1 | Raw Reads 2 | Clean Reads 3 | Q30 (%) 4 | GC Content (%) 5 | Total Mapped 6 | Mapped Ratio (%) 7 |
---|---|---|---|---|---|---|
SS-1 | 25,645,404 | 25,388,540 | 92.75 | 38.53 | 25,388,540 | 96.99 |
SS-2 | 25,744,355 | 25,439,416 | 94.81 | 39.17 | 25,439,416 | 95.81 |
SS-3 | 25,802,229 | 25,478,353 | 94.75 | 38.64 | 25,478,353 | 95.79 |
SS-4 | 22,427,557 | 22,191,059 | 95.58 | 39.19 | 22,191,059 | 97.43 |
Beta-R-1 | 19,606,609 | 19,307,241 | 98.15 | 38.47 | 42,874,386 | 73.73 |
Beta-R-2 | 23,305,059 | 22,881,481 | 98.23 | 36.95 | 22,881,481 | 48.97 |
Beta-R-3 | 19,873,732 | 19,350,373 | 98.91 | 37.11 | 19,350,373 | 45.28 |
Beta-R-4 | 19,816,890 | 19,333,166 | 98.18 | 38.67 | 19,333,166 | 64.92 |
SS-T-1 | 20,228,267 | 19,995,591 | 95.81 | 39.52 | 19,995,591 | 97.38 |
SS-T-2 | 26,040,187 | 25,614,225 | 95.97 | 38.83 | 25,614,225 | 97.47 |
SS-T-3 | 25,027,865 | 24,448,408 | 95.72 | 39.14 | 24,448,408 | 97.24 |
SS-T-4 | 20,847,432 | 20,497,212 | 95.87 | 39.11 | 20,497,212 | 97.40 |
Beta-R-T-1 | 17,985,440 | 17,587,297 | 98.81 | 35.73 | 38,741,343 | 48.04 |
Beta-R-T-2 | 21,079,387 | 20,600,348 | 98.92 | 37.03 | 20,600,348 | 28.55 |
Beta-R-T-3 | 24,195,778 | 23,528,216 | 98.21 | 38.02 | 23,528,216 | 74.14 |
Beta-R-T-4 | 22,214,579 | 21,623,496 | 98.82 | 38.98 | 21,623,496 | 81.06 |
Compare | Up | Down |
---|---|---|
Beta-R-T vs. Beta-R 1 | 147 | 31 |
SS-T vs. SS 2 | 584 | 297 |
Beta-R-T vs. SS-T 3 | 1518 | 930 |
Beta-R vs. SS 4 | 1758 | 1098 |
Beta-R-T vs. Beta-R 1 | SS-T vs. SS 2 | Beta-R-T vs. SS-T 3 | Beta-R vs. SS 4 | |||||
---|---|---|---|---|---|---|---|---|
Up | Down | Up | Down | Up | Down | Up | Down | |
Cuticle protein | 4 | 0 | 7 | 2 | 7 | 12 | 11 | 14 |
Cytochrome P450 | 0 | 0 | 6 | 5 | 4 | 16 | 6 | 11 |
UDP-glucosyltransferases UGT | 0 | 1 | 6 | 7 | 3 | 6 | 5 | 10 |
ATP-binding cassette (ABC) transporter | 0 | 0 | 0 | 0 | 1 | 4 | 1 | 1 |
Trypsin | 0 | 0 | 0 | 0 | 2 | 0 | 2 | 1 |
Gene ID | Accession Number | Description |
---|---|---|
g9940 | XM_026951046.1 | cuticle protein 19-like |
g24565 | XM_026952080.1 | cuticle protein 7-like |
g488 | XM_027990008.1 | cuticle protein 7-like |
g19171 | XM_026961146.1 | cuticle protein-like |
g11992 | XM_027984718.1 | P450 4C1-like |
g7371 | MW287284.1 | cytochrome P450 6CY8 (CYP6CY8) |
g9824 | MN764890.1 | cytochrome P450 CYP6DC1 (CYP6DC1) |
g7368 | MK534505.1 | cytochrome P450 CYP6CZ1 (CYP6CZ1) |
g4263 | XM_027994410.1 | UDP-glucuronosyltransferase 2C1-like |
g4506 | XM_026960509.1 | UDP-glucuronosyltransferase 2B2-like |
g16174 | XM_026962565.2 | UDP-glucuronosyltransferase 2C1-like |
g12284 | XM_026954189.1 | UDP-glucuronosyltransferase-like |
g7359 | XM_026956515.1 | ABC transporter G family member 23-like |
g8765 | XM_026949522.1 | trypsin-1-like |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Q.; Li, X.; Sun, Y.; Tian, X.; Zhu, S.; Wang, Y.; Gao, H.; Shi, C.; Zhu, X. Transcriptome-Based Identification and Characterization of Genes Associated with Resistance to Beta-Cypermethrin in Rhopalosiphum padi (Hemiptera: Aphididae). Agriculture 2023, 13, 235. https://doi.org/10.3390/agriculture13020235
Li Q, Li X, Sun Y, Tian X, Zhu S, Wang Y, Gao H, Shi C, Zhu X. Transcriptome-Based Identification and Characterization of Genes Associated with Resistance to Beta-Cypermethrin in Rhopalosiphum padi (Hemiptera: Aphididae). Agriculture. 2023; 13(2):235. https://doi.org/10.3390/agriculture13020235
Chicago/Turabian StyleLi, Qiuchi, Xinan Li, Yulin Sun, Xujun Tian, Saige Zhu, Yanbo Wang, Haifeng Gao, Caihua Shi, and Xun Zhu. 2023. "Transcriptome-Based Identification and Characterization of Genes Associated with Resistance to Beta-Cypermethrin in Rhopalosiphum padi (Hemiptera: Aphididae)" Agriculture 13, no. 2: 235. https://doi.org/10.3390/agriculture13020235
APA StyleLi, Q., Li, X., Sun, Y., Tian, X., Zhu, S., Wang, Y., Gao, H., Shi, C., & Zhu, X. (2023). Transcriptome-Based Identification and Characterization of Genes Associated with Resistance to Beta-Cypermethrin in Rhopalosiphum padi (Hemiptera: Aphididae). Agriculture, 13(2), 235. https://doi.org/10.3390/agriculture13020235