Next Article in Journal
Multiple Soil Health Assessment Methods for Evaluating Effects of Organic Fertilization in Farmland Soil of Agro-Pastoral Ecotone
Next Article in Special Issue
Efficacy of Intravaginal Lactic Acid Bacteria, Cell-Free Supernatant, or Enrofloxacin on Vaginitis and Fertility in Ewes Synchronized with Progesterone-Based Protocol
Previous Article in Journal
Design and Testing of the Double-Symmetric Eccentric Exciter for Fruit Tree Vibration Harvest
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 14
Issue 4
10.3390/agriculture14040571
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Resistant S. aureus Isolates Capable of Producing Biofilm from the Milk of Dairy Cows with Subclinical Mastitis in Slovakia

by
Ján Király
1,
Vanda Hajdučková
1,
Gabriela Gregová
2,*,
Tatiana Szabóová
2 and
Emil Pilipčinec
1
1
Department of Microbiology and Immunology, The University of Veterinary Medicine and Pharmacy in Košice, 041 81 Košice, Slovakia
2
Department of Public Veterinary Medicine and Animal Welfare, the University of Veterinary Medicine and Pharmacy in Košice, 041 81 Košice, Slovakia
*
Author to whom correspondence should be addressed.
Agriculture 2024, 14(4), 571; https://doi.org/10.3390/agriculture14040571
Submission received: 27 February 2024 / Revised: 23 March 2024 / Accepted: 31 March 2024 / Published: 3 April 2024
(This article belongs to the Special Issue Productivity, Performance and Health of Dairy Ruminants)
Browse Figures
Review Reports Versions Notes

Abstract

:
Staphylococcus spp. is the most common cause of mastitis, with a significantly low cure rate. Bacterial characteristics like adhesion and biofilm formation, as well as extracellular factors, can affect the pathogenesis of staphylococcal mastitis. The study’s objectives were to confirm S. aureus, assess their antibiotic resistance, identify methicillin resistance genes, verify biofilm formation, and detect biofilm-associated genes from bovine mastitis samples using multiplex PCR (mPCR). From 215 milk samples, six were confirmed as S. aureus. Most isolates were sensitive to all measured antibiotics. One isolate was identified as an inducible form of MLSB resistance (macrolides, lincosamides, and streptogramin B resistance), while the other two isolates were resistant to penicillins and carboxypenicillins. In S. aureus cultures used for methicillin resistance genotypic analysis by PCR, the mecA and mecC genes were not found. Biofilm formation phenotypes were determined in four strains. An mPCR analysis revealed that all strains of S. aureus carried icaABCD, agrA, srtA, fnbA, clfA, and clfB genes. Only in one isolate was the fnbB gene detected; the bap gene was not detected in any of the isolates. This emphasizes the importance of using appropriate treatment and continuous monitoring of S. aureus to prevent the spread of antibiotic-resistant strains in dairy cow farms.

1. Introduction

Mastitis caused by bacterial infections is the most common disease in dairy cows. It is the reason for antimicrobial treatment in dairy cows and a public health threat. It occurs in clinical or subclinical form. The pathogenic potential of bacteria, an individual’s immunity, and their overall health all influence how severe mastitis can become. Subclinical mastitis is an asymptomatic infection that influences milk production and milk quality [1]. The main problem connected with the subclinical form of mastitis is its higher incidence, longer persistence, and speed of spread in dairy farming. A commonly used diagnostic method for detecting the subclinical form of mastitis is a test to determine the somatic cell count in milk [2,3].
Dairy cow mastitis is frequently caused by the bacterial genera Staphylococcus, Streptococcus, and Escherichia. The predominant infectious pathogens causing subclinical mastitis with a significantly low cure rate are staphylococcal infections [4]. Additionally, S. chromogenes, S. warneri, and S. xylosus were isolated from animals that exhibit clinical mastitis, which is defined by mild, moderate, or severe symptoms as well as chronic infections [5]. Treatment of clinical mastitis should follow national and international prudent use guidelines. The systemic (parenteral) route of mastitis treatment is more efficient than the intramammary route because antimicrobials can better penetrate udder tissue. For the treatment of clinical mastitis, broad-spectrum antibiotics (oxytetracycline, macrolides, trimethoprim-sulfonamide, and ceftiofur combination) are frequently used [6,7].
The consumption of veterinary antibiotics decreased in Slovakia during the last decade. The top-selling antimicrobials include tetracyclines (46.0%), penicillins (14.0%), and sulfonamides (52.0%) [8]. Of the total sales of antimicrobials, approximately 41.0% were used in beef farms, 42.0% in swine farms, 10.0% in turkey farms, 3.0% in chicken farms, and about 4.0% in other farms. Tetracyclines account for the highest sales volume of ATB used in food animals (4,117,031 kg in 2019), which is 67.0%. They are followed by penicillins at 12.0%, macrolides at 8.0%, sulfonamides at 5.0%, aminoglycosides at 5.0%, lincosamides at 2.0%, cephalosporins at less than 1.0%, and fluoroquinolones at less than 1.0%. About 81.0% of cephalosporins, 65.0% of sulfonamides, 45.0% of aminoglycosides, and 42.0% of tetracyclines were used in cattle production. In pig production, approximately 85.0% of lincosamides and 40.0% of macrolides were utilized. For use on turkey farms, 66.0% of penicillins were used [9].
S. aureus is the most important causative agent of subclinical mastitis worldwide, which is also highly isolated from milk samples from dairy cows with mastitis. In addition, it is the most common isolated foodborne pathogen, while milk and milk products are potential sources of infection [10]. Both extracellular elements and bacterial characteristics, like adhesion and biofilm formation, can have an impact on the pathogenesis of staphylococcal mastitis. The expression of virulence factors is upregulated during bacterial infection, leading to increased resistance to phagocytosis and upregulation of genes through which host tissue destruction occurs [1,11,12] S. aureus is able to escape the innate and adaptive immunity of the host and resist the effects of β-lactam antibiotics. The long-term use of various antibiotics leads to an increased prevalence of multiresistant strains [13]. Methicillin-resistant S. aureus (MRSA) was initially detected as a hospital-acquired infection (HA-MRSA), later in the human community (CA-MRSA), and more recently in livestock (LA-MRSA) [14]. Bacteria carrying the mecA gene and its homolog mecC can encode a modified low-affinity penicillin-binding protein, rendering them resistant to methicillin and most other beta-lactams. Both genes are transferred on mobile genetic elements (MGEs) called staphylococcal chromosome cassette—mec (SCC mec) [15], which contains regulation genes mecI (encoding repressor) and mecR1 (encoding sensory protein). Several structural variants of SCC mec were described that differ in their genetic content, size, and structural organization. Twelve major types of SCC mec elements in MRSA strains were classified, some of which were divided into subtypes [16]. SCC mec element typing is essential because, in combination with S. aureus chromosome genotype, SCC mec type is an important characteristic for defining MRSA clones in epidemiological studies and for understanding the evolution of these clones. Strains containing different elements of SCC mec differ in their sensitivity to antibiotics, which is significant from the point of view of clinical consequences. A divergent homolog of the mecA gene, described as mecC, was discovered in the same SCC mec element (SCC mec type XI) in the genome of S. aureus strain LGA251, which was isolated from bovine mastitis [17].
In recent years, there has been an increase in the occurrence of MRSA in different samples. It resulted in increased use of alternative antibiotics (macrolides, lincosamides, and streptogramin B) for the treatment of staphylococcal infections. Because of its good pharmacokinetic properties, proven effectiveness, low cost, oral and parenteral form availability, good tissue penetration, good abscess accumulation, inhibition of staphylococcal toxin production, and lack of need for renal dosing modifications, clindamycin is the most commonly used antibiotic in this class [6].
Biofilm-forming S. aureus strains are very resistant to antibiotics [18,19], which complicates the eradication of biofilm infections [20,21]. Biofilm consists of several bacterial layers protected by the exopolysaccharide glycocalyx. As one of the virulence factors, it facilitates the adherence and colonization of bacteria in the epithelium of the mammary glands. It contributes to protection against the immune response, decreases eradication of pathogens, and results in recurrent or persistent infections [22]. The mechanism of formation of biofilm by staphylococci is a complicated process involving many genes and regulation factors. Its formation basically consists of the initial adhesion of bacteria to the surface, the formation of microcolonies, the maturation of the biofilm, and dispersion. In biofilm-forming S. aureus, several types of adhesive molecules used by bacteria to attach to the host tissue were identified. Adhesion to biotic surfaces is mediated by a group of surface-exposed proteins expressed in the S. aureus cell wall, which are referred to as MSCRAMMs (microbial surface components recognizing adhesive matrix molecules) [23]. The attachment to extracellular proteins of cells in S. aureus is mediated by fibronectin-binding proteins (FnbA, FnbB) and fibrinogen-binding proteins (ClfA, ClfB). In strains isolated from bovine mastitis, in strong producers of biofilm, an important role of biofilm-associated protein (Bap) (also belonging to the MSCRAMM group) was identified [24] during the primary attachment and accumulation of bacterial cells. It was also observed that formation of biofilm mediated by Bap is independent of production of polysaccharide intracellular adhesion (PIA). A significant characteristic of the majority of MSCRAMMs is the amino acid Leu-Pro-X-Thr-Gly (LPXTG) motif, which is recognized and cleaved by enzyme sortase A, which catalyzes the covalent bonding of MSCRAMMs to the peptidoglycan layer of bacteria during assembly of the cellular wall at vegetative growth. Excessive expression of gene srtA (encoding sortase A) increases the rapidity of anchorage of surface proteins during cellular wall biosynthesis and contributes to increased virulence [25]. During the phase of multiplication of bacteria in the biofilm resulting in development of a number of bacterial layers, a staphylococcal exopolysaccharide referred to as PIA (polysaccharide intercellular adhesion) is produced on the basis of function, or poly-β-1-6-N-acetylglukózamín (PNAG) on the basis of its chemical character. The genes necessary for biosynthesis of PIA are encoded in the locus of intracellular adhesion (ica), and this locus is the primary determinant supporting adhesive interactions between bacterial cells [26]. Products of the genes of locus icaABCD are inevitable for formation of biofilm, and products of genes icaA and icaD play a key role in this process [27].

2. Materials and Methods

2.1. Sampling, Isolation, and Identification of Staphylococcus aureus

Milk samples (n = 215) were collected from dairy herds in Slovakia with reduced milk quality and milk production. Milk samples from dairy cows with subclinical mastitis were positive for the NK-test (natural killer test) (Bioveta, Ivanovice na Hané, Czech Republic). The dairy cows were without clinical signs of mastitis, without previous cases of mastitis in the same lactation, and without treatment. The NK test is a rapid determination used to find dairy cows suspected of having mastitis based on an increased somatic cell count and acid pH in milk. The somatic cell counts of 100,000–300,000 cells/mL (mild coagulation), 300,000–500,000 cells/mL (coagulation with mild gel formation), and 500,000–1,500,000 cells/mL (strong precipitation with gel formation) indicate a positive reaction.
Isolates were stored at −80 °C in Microbank cryotubes (Pro-Lab, Mississauga, ON, Canada). Isolation and identification of S. aureus was performed by classical microbiological methods. Hemolytic activity was determined using blood agar, and Baird–Parker agar was used to evaluate lecithinase activity. Phenotypic identification of the isolates was performed using the STAPHYTest 24 biochemical series (Erba Lachema, Brno-Řečkovice a Mokrá Hora, Czech Republic). Subsequently, the isolates were subjected to confirmation at the molecular level by using mPCR.

2.2. DNA Extraction

From the overnight culture of isolates, genomic DNA was extracted by modified Brain Heart Infusion Broth (mBHI, HiMedia Laboratories, Mumbai, India) containing 1.0% glucose and 2.0% NaCl using the High Pure PCR Template Preparation Kit (Roche Molecular Systems, Inc., Pleasanton, CA, USA). The amount and purity of DNA were determined using an ND-8000 spectrophotometer (ThermoFisher SCIENTIFIC, Waltham, MA, USA).

2.3. Gene Detection Using Simplex PCR (PCR) and Multiplex PCR (mPCR)

For the specification of S. aureus by mPCR, we used primers amplifying the Staphylococcus genus 16S rRNA gene segment and species-specific primers for S. aureus that detect the eap (extracellular adhesion protein) and nuc (thermostable nuclease) genes (Table 1).
The presence of genes responsible for antibiotic resistance was monitored by PCR using primers amplifying sections of the mecA and mecC genes. Genes associated with biofilm were monitored by PCR (bap) and by mPCR (icaABCD, srtA, and agrA). A combination of primers detecting genes icaD, srtA, and agrA, as well as primers detecting icaA, icaB, and icaC, were chosen for mPCR based on the size of the products. Two primer combinations were used in mPCR: fnbA with the fnbB gene and clfA with the clfB gene. The primer sequences are shown in Table 1.
The PCR and mPCR reaction mixture was contained in the resulting volume 0.5 ng of isolated DNA, 1x DreamTaq Green PCR Master Mix (ThermoFisher SCIENTIFIC, USA), 0.125 pmol (16S rRNA), 0.5 pmol (eap), 0.25 pmol (nuc), 0.5 pmol (mecA, mecC), 0.5 pmol (bap), 0.25 pmol (icaB, icaC, icaD, agrA, srtA), 0.375 pmol (icaA), 0.5 pmol (fnbB), and 0.25 fnbA, clfA, clfB) of each primer (“forward, reverse”) and water. The PCR and mPCR reaction took place on a Mastercycler® nexus X2 thermocycler (Eppendorf, Hamburg, Germany) under the optimized conditions listed in the tables (Table 2 and Table 3).
Amplified DNA sections were separated electrophoretically (Wide Mini-Sub® GT Cell, BIORAD, Hercules, CA, USA) on a 2.5% agarose gel using a non-toxic nucleic acid detection reagent called GoodView™ (Amplia, SR, Bratislava, Slovakia). PCR products were visualized in the gel after electrophoresis using the UV light of an Ultraviolet Transilluminator (Bio-Imaging Systems, Modi’in-Maccabim-Re’ut, Israel) and recorded using a Kodak Gel Logic 100 Digital Imaging System (Kodak, Rochester, NY, USA).

2.4. Antibiotic Susceptibility Testing

S. aureus isolates confirmed by PCR were analyzed for antibiotic susceptibility. Minimum inhibitory concentration (MIC) for determination of phenotype antibiotic resistance was determined by a microdilution colorimetric method according to CLSI VET01-S2 [34] and EUCAST [35] using the Miditech system (Bratislava, Slovakia) with an interpretive reading of MIC. The following antibiotics were tested: ampicillin (AMP), ampicillin + sulbactam (SAM), oxacillin (OXA), cefoxitin (FOX), piperacillin + tazobactam (TZP), erythromycin (ERY), clindamycin (CLI), linezolid (LNZ), rifampicin (RIF), gentamicin (GEN), teicoplanin (TEC), vancomycin (VAN), trimethoprim (TMP), chloramphenicol (CHL), tigecycline (TGC), moxifloxacin (MFX), ciprofloxacin (CIP), tetracycline (TET), trimethoprim + sulphonamide (COT), and nitrofurantoin (NIT). The antibioticogram profile and MIC profile will serve to determine mechanisms of resistance (MRCoNS, MRSA, MLSB) [36].

2.5. Biofilm Activity Testing—Crystal Violet Biofilm Testing

Biofilm activity was tested on a 96-well polystyrene microtiter plate by staining with crystal violet, using a modified colorimetric method according to O’Toole et al. [37]. The tested strains of S. aureus were incubated as pure bacterial cultures at 37 °C overnight (for 18 h) on blood agar. From individual bacterial colonies and physiological solution, one McFarland turbidity was suspended; 100 µL of the suspension was added to the wells of a polystyrene plate with 100 µL of modified Brain Heart Infusion Broth (mBHI, HiMedia Laboratories, Mumbai, India) with 1.0% glucose and 2.0% NaCl. The reference strains were the non-biofilm-forming S. epidermidis CCM 4418 and the biofilm-forming S. aureus CCM 4223 (Czech Collection of Microorganisms, Brno, Czech Republic). The negative control was pure broth.
After being incubated for 24 h at 37 °C, the planktonic cell medium was removed, and the wells were washed four times with distilled water. Subsequently, the biofilms were stained by adding 200 µL of 0.1% crystal violet solution (Merck, Darmstadt, Germany) and incubated for 30 min at room temperature. Following four rounds of washing and ten minutes of room-temperature drying, the adhered cells were dye-free by adding a 30.0% glacial acetic acid solution in a volume of 200 µL per well. The optical density was determined spectrophotometrically by measuring the absorbance at a wavelength length of 550 nm using a SYNERGY READER 4 plate reader (BioTek, Merck, Germany).

2.6. Statistical Evaluation of Biofilm Formation

Biofilm formation was evaluated based on the obtained data by statistical analysis using the GraphPad Prism 6.01 program (GraphPad Inc., San Diego, CA, USA) using one-way analysis of variance (ANOVA) and Tukey’s test to determine significance at p < 0.001.

3. Results

3.1. Confirmation of the Genus S. aureus

S. aureus isolates (n = 11) from milk samples (n = 215) from dairy cows with a subclinical form of mastitis were identified using traditional microbiological methods. Staphylococcus spp. was confirmed via mPCR using the 16S rRNA sequence (141 bp), nuc (103 bp), and eap genes (230 bp).
All field isolates identified using standard microbiological procedures had positive detections of the 16S rRNA gene specific to the Staphylococcus genus. Six isolates (isolates no. 7 to 12) had species-specific genes for S. aureus nuc and eap (Figure A1).

3.2. Antimicrobial Susceptibility Profile

The MIC (minimal inhibition concentration) of antibiotics was determined in six confirmed S. aureus isolates (Table 4).
S. aureus isolates were mainly sensitive to all monitored antibiotics. One isolate was resistant to ampicillin and ampicillin with sulbactam. One strain showed resistance to erythromycin, clindamycin, and ampicillin. One of the two isolates, which exhibited resistance to both penicillins and carboxypenicillins, was phenotypically identified as an inducible type of MLSB-resistant S. aureus (macrolide-lincosamide-streptogramin B) (Figure A2).
None of the confirmed S. aureus isolates from subclinical mastitis cows showed resistance to cefoxitin or oxacillin. The significance of this for animal health lies in the fact that β-lactam antibiotics remain one of the most widely used antimicrobial therapeutics for treating mastitis, and there are few other options for treating the condition with non-β-lactam antibiotics [10].
To confirm the obtained MIC of S. aureus sensitivity to antibiotics by determining the MIC, PCR detection of the genes mecA and mecC was performed. The presence of specified genes was not detected, which correlates with our MIC results.
It demonstrates that phenotypic testing of resistance can result in both false positives and false negatives for MRSA. Most of the published studies aimed at monitoring the susceptibility of S. aureus strains to antibiotics report results obtained only through phenotypic resistance testing without demonstrating the presence of the mecA and mecC genes responsible for the production of an altered penicillin-binding protein 2a (PBP2a), which has a lower affinity for β-lactam antimicrobial substances than normal PBP [10].

3.3. Phenotypic Identification of Biofilm-Forming S. aureus

The biofilm formation ability of individual S. aureus isolates was tested using a modified colorimetric method according to O’Toole et al. [37]. Statistically, 4 out of 6 isolates of S. aureus (samples 8, 10, 11, and 12) were evaluated as producers of biofilm, as well as a positive control (reference strain S. aureus CCM 4223). Two isolates (samples 7 and 9) showed a significantly lower ability to produce biofilm (Figure 1).
Growth conditions influence biofilm formation both in vitro and in vivo, so phenotypic and genotypic analysis of biofilm-associated genes is required to identify strains that form biofilms. For this reason, in every clinical isolate of S. aureus, we also monitored the biofilm-associated genes by using the simplex and multiplex PCR methods (Figure A3, Figure A4, Figure A5 and Figure A6).

3.4. Detection of Biofilm-Associated Genes in S. aureus

By mPCR analyzing the amplified segments of the icaABCD, srtA, and agrA genes, their presence was confirmed in all (100%) S. aureus isolates (isolates no. 7 to 12) in our study (Figure A3 and Figure A4).
Genes that encode proteins of the MSCRAMM group of adhesins (LPXTG proteins), which S. aureus uses to bind to extracellular proteins in mammals, are another set of genes involved in the biofilm formation process. Among the most significant biofilm-associated genes, fnbA and fnbB encode the fibronectin-binding proteins FnbA and FnbB, and the clfA and clfB genes encode the fibrinogen-binding proteins referred to as clumping factors A (ClfA) and B (ClfB). The MSCRAMM group of adhesins also includes the biofilm-associated protein (Bap), which supports the initial and intercellular adhesion of S. aureus strains. The bap gene was detected mainly in strong biofilm producers of S. aureus isolated from cattle [38]. Using the mPCR method, we monitored the presence of a pair of fnbA, fnbB, and clfA, clfB genes in clinical isolates (Figure A5 and Figure A6) and the bap gene by simplex PCR. In every isolate, the fnbA, clfA, and clfB genes were found (isolates no. 7 to 12). The presence of the fnbB gene was recorded only in one isolate (no. 10), and there was no detection of the bap gene in any clinical strain of S. aureus.

4. Discussion

Based on an investigation of 813 isolates, which included species of the genus Staphylococcus in addition to S. aureus [29], the eap gene was detected in 597 isolates of S. aureus. In 216 staphylococcal isolates, which included 47 various species (coagulase-negative, other coagulase-positive, or coagulase-variable subspecies of staphylococci), the eap gene was not detected. Based on the results obtained from transcriptional and protein analyses, they proved that species other than S. aureus do not express eap homologues. Therefore, they established the sensitivity and specificity of the newly developed PCR aimed at detecting the eap gene at 100%. For the molecular detection of S. aureus through the amplification of part of the nuc gene, Gonzalez-Dominguez et al. [39] also used it in their work. As in our study, they used specific primers designed to identify a segment within sequence homologies shared between the nuc gene of S. aureus species. The authors of the study state that despite the high specificity of the Staph-API kit (92.49%) to diagnose Staphylococcus species, the identification by means of phenotyping of staphylococci obtained from clinical samples does not reach the stated specificity. This may be one of the explanations for our results. We confirmed S. aureus in 6 out of 11 isolates by the PCR method, which represents 54.5%. Qolbaini et al. [40] obtained similar results. They also detected the nuc gene in 49 (57.0%) of 86 S. aureus isolates identified by classical microbiological methods. For proper identification, it is necessary to perform sequence analysis of isolates without eap and nuc genes.
S. aureus isolates from the milk of dairy cows with a subclinical form of mastitis were mostly sensitive to all analyzed antibiotics. Based on its phenotypic characteristics, one strain of S. aureus was identified as MLSB-resistant S. aureus, which can be inducible. MRSA was not identified by using genotypic or phenotypic methods. The MLSB (macrolide-lincosamide-streptogramin B) inducible resistance type of S. aureus can encode over 60 genes, such as rRNA methylases (ermA-ermZ, erm(30)-erm(42)), efflux pumps (isaA-isaC genes, mefA- mefG, msrA, vgaA-vgaC) and inactivating genes encoding esterases, lyases, phosphorylases, and transferases (ereA, ereB, ereC, lnuA-lnuF, vatA-vatG) [41].
The widespread use of the MLSB antibiotics (mostly clindamycin) has increased the number of MLSB-resistant S. aureus isolates [42]. The rate of MLSB-resistant staphylococci varies between countries and species. Many authors report the high occurrence of MLSB in the human community, which causes nosocomial diseases. On the other hand, a high rate of erythromycin-resistant staphylococci was also observed in veterinary practice [43].
Szczuka et al. [44], from Poland, investigated the presence of genes linked to antibiotic resistance in milk samples and milk products. Antibiotic-resistant genes, which are critical for both human and veterinary medicine, were presented in S. aureus strains, i.e., β-lactams (mecA) and aminoglycosides. According to the antimicrobial susceptibility test, 74.0% of the strains of S. aureus were resistant to at least one of the 16 tested antibiotics, representing 11 different categories. Furthermore, 28.0% of the strains were multidrug-resistant, and two MRSAs demonstrated notable antibiotic resistance. Their research indicates that S. aureus strains expressing enterotoxin and antibiotic resistance genes are present in dairy products. In foods originating from animals, they detected MRSA strains as well as MSSA isolates that demonstrated multidrug resistance [44].
Cvetnić et al. [45] reported that ten MRSA strains (4.2%) were isolated from milk samples of cows with subclinical mastitis in Croatia. In a Norwegian study [46], they found that all S. aureus strains isolated from milk and cheese were sensitive to the 12 antibiotics tested. The Chinese research found that raw milk samples had a high MRSA frequency of 51.6%, and 80.6% of S. aureus strains identified from milk were resistant to at least one antibiotic [47]. Moreover, in our former study [48], the highest antimicrobial resistance to penicillin (91.0%) and erythromycin (67.0%) was confirmed in S. aureus and CoNS isolates from sheep and goat cheeses.
According to our results, the prevalence of S. aureus strains isolated from the milk of dairy cows with subclinical mastitis capable of forming a biofilm (66.7% of isolated S. aureus had the ability to form biofilm) is similar to that in the study of Rychshanova et al. [49]. The achieved results highlight the need for increased attention in relation to the prevalence of biofilm-forming strains isolated from cattle farms due to the existence of a potential risk of the spread of these strains and the contamination of milk and milk products with an impact on public health. Wang et al. [50] emphasize the importance of biofilm in antibiotic resistance gene transfer. Ineffective treatment of mastitis caused by biofilm-forming S. aureus with antibiotics can increase the risk of antibiotic resistance, which poses a threat to human and animal health [1].
PIA encoding the intercellular adhesion locus (ica) formed from the icaABCD genes, of which the icaA and icaD genes play the most important role in the process of biofilm formation, is reported as an important virulence factor in the pathogenesis of mastitis [51]. Sortase A is a transpeptidase enzyme that facilitates the attachment of numerous surface proteins involved in bacterial cell wall synthesis. These proteins are associated with aspects of virulence, such as invasibility and adhesion. S. aureus strains lacking the srtA gene are defective in the anchoring of LPXTG proteins in the cell wall; therefore, bacteria are unable to attach cell surface proteins, which are necessary for adhesion to eukaryotic cell structures [52]. The agr locus plays an important role in controlling the expression of most S. aureus virulence factors. The agrA gene encodes a response regulator that is part of the agr quorum-sensing system and, by binding to DNA, activates the P3 promoter, thereby regulating the expression of various virulence factors, the dispersion phase, and the survival of S. aureus in the host tissue [26].
The prevalence of the genes detected by us (icaABCD, srtA, agrA) is different in published studies [22,26,38,51]. Studies focused on the detection of genes encoding the proteins FnbA, FnbB, ClfA, ClfB, and Bap also do not agree in their results of determining the percentage of prevalence of individual genes [22,26,32,53]. Point mutations in the corresponding genes may be the reason for variations in gene detection in biofilm-forming strains. Therefore, differences in DNA sequences are the cause of unsuccessful amplification of gene segments in some clinical isolates, and the results obtained are likely to show false negativity. The two most studied mechanisms responsible for biofilm formation are the PIA-dependent biofilm formation mechanism under the control of the ica operon and the PIA-independent biofilm formation mechanism mediated by the Bap protein [38]. Results in published studies showing the absence of genes involved in the process of biofilm formation in biofilm-positive S. aureus strains may be related to biofilm formation under the control of other genes responsible for biofilm formation [26]. However, even in biofilm-negative isolates, we found that 100% of the monitored genes (icaABCD, srtA, agrA, fnbA, clfA, and clfB) were present in our work, with the exception of fnbB (16.7%) and bap (0%). This may be related to the different abilities of S. aureus isolates to form biofilm in vivo and in vitro.

5. Conclusions

Staphylococci, and especially S. aureus, are important pathogens in humans and animals. The overall occurrence of S. aureus is variable and varies between farms and regions. Based on our results, S. aureus is not the most common pathogen of the mammary gland. Inaccuracies in the identification of S. aureus in clinical samples based on classic microbiological procedures point to the need to also include methods for the detection of species-specific nuc and eap genes in the diagnostic procedure. The overall rate of MRSA in dairy farms is low, but there is still a risk of it increasing. By monitoring sensitivity to antibiotics, no MRSA strain was recorded, which is a positive sign since the antibiotics of first choice in the treatment of staphylococcal mastitis are β-lactams. Continuous monitoring of antibiotic resistance is essential because resistant strains of S. aureus (MLSB and penicillin-resistant strains) are emerging, which poses a problem in the treatment of bovine mastitis. The obtained results of the detection of MRSA strains were also confirmed by the detection of mecA and mecC genes, which were not present in any S. aureus isolate.
The results of our study show a relationship between the occurrence of S. aureus isolates in the milk of dairy cows with subclinical mastitis and biofilm formation, which points to the pathogenic potential of these strains.
The occurrence of strains capable of forming a biofilm in a herd of dairy cows points to the need to pay attention to the observance of good milking practices and to implement procedures for effective prevention, control, and treatment of mammary gland infection.

Author Contributions

Conceptualization, J.K. and G.G.; methodology, J.K., G.G., V.H. and T.S.; validation, J.K. and G.G.; formal analysis, J.K., G.G. and E.P.; investigation, J.K., G.G., V.H. and T.S.; resources, J.K. and G.G.; data curation, J.K. and G.G.; writing—original draft preparation, J.K. and G.G.; writing—review and editing, J.K. and G.G.; visualization, J.K. and G.G.; supervision, E.P.; funding acquisition, G.G. and E.P. All authors have read and agreed to the published version of the manuscript.

Funding

This publication was supported by the Slovak Research and Development Agency under the contract no. APVV-15-0377 and by the cultural and educational grant agency KEGA of the Ministry of Education, Science, Research and Sports of the Slovak Republic, project numbers KEGA 007UVLF-4/2021 and KEGA 001UVLF-4/2022.

Institutional Review Board Statement

All procedures involving animals followed the guidelines stated in the Guide for the Care and Use of Animals (protocol number 4356/2022-220, date of approval–February 2022), which was approved by the State Veterinary and Food Administration of the Slovak Republic and by the Ethics Commission of the University of Veterinary Medicine and Pharmacy in Košice (Slovakia). The animals were handled in a humane manner in accordance with the guidelines established by the relevant commission. All applicable international, national, and institutional guidelines for the care and use of animals were followed. All animal owners agreed to participate in the study.

Data Availability Statement

All existing data are listed in the manuscript.

Conflicts of Interest

The authors have no competing interests to declare that are relevant to the content of this article. The authors declare they have no relevant financial or non-financial interests to disclose.

Appendix A

Agriculture 14 00571 g0a1
Figure A1. Detection of 16S rRNA, eap and, nuc genes in S. aureus isolates using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus; 2—negative control without DNA; 3 to 13—S. aureus isolates positive for 16S rRNA (141 bp); 7 to 12—isolates positive for gene eap (230 bp) and nuc (103 bp).
Figure A1. Detection of 16S rRNA, eap and, nuc genes in S. aureus isolates using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus; 2—negative control without DNA; 3 to 13—S. aureus isolates positive for 16S rRNA (141 bp); 7 to 12—isolates positive for gene eap (230 bp) and nuc (103 bp).
Agriculture 14 00571 g0a1
Agriculture 14 00571 g0a2
Figure A2. MIC results of S. aureus isolate (sample 10) and analysis of resistance mechanisms using the MIDITECH system. S—sensitive; I—intermediate; R—resistant; MICxG—geometric mean MIC.
Figure A2. MIC results of S. aureus isolate (sample 10) and analysis of resistance mechanisms using the MIDITECH system. S—sensitive; I—intermediate; R—resistant; MICxG—geometric mean MIC.
Agriculture 14 00571 g0a2
Agriculture 14 00571 g0a3
Figure A3. Detection of icaA, icaB, and icaC genes in S. aureus isolates by using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus CCM 4223; 2—negative control without DNA; 7 to 12—isolates positive for icaA (75 bp), icaB (141 bp), and icaC (209 bp).
Figure A3. Detection of icaA, icaB, and icaC genes in S. aureus isolates by using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus CCM 4223; 2—negative control without DNA; 7 to 12—isolates positive for icaA (75 bp), icaB (141 bp), and icaC (209 bp).
Agriculture 14 00571 g0a3
Agriculture 14 00571 g0a4
Figure A4. Detection of agrA, srtA, and icaD genes in S. aureus isolates by using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus CCM 4223; 2—negative control without DNA; 7 to 12—isolates positive for agrA (96 bp), srtA (183 bp), and icaD (211 bp).
Figure A4. Detection of agrA, srtA, and icaD genes in S. aureus isolates by using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus CCM 4223; 2—negative control without DNA; 7 to 12—isolates positive for agrA (96 bp), srtA (183 bp), and icaD (211 bp).
Agriculture 14 00571 g0a4
Agriculture 14 00571 g0a5
Figure A5. Detection of fnbA and fnbB genes in S. aureus isolates by using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus CCM 4223; 2—negative control without DNA; 7 to 12—isolates positive for fnbA gene (192 bp); 10—isolate positive for fnbB gene (156 bp).
Figure A5. Detection of fnbA and fnbB genes in S. aureus isolates by using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus CCM 4223; 2—negative control without DNA; 7 to 12—isolates positive for fnbA gene (192 bp); 10—isolate positive for fnbB gene (156 bp).
Agriculture 14 00571 g0a5
Agriculture 14 00571 g0a6
Figure A6. Detection of clfA and clfB genes in S. aureus isolates by using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus CCM 4223; 2—negative control without DNA; 7 to 12—isolates positive for clfA gene (180 bp) and clfB gene (120 bp).
Figure A6. Detection of clfA and clfB genes in S. aureus isolates by using mPCR. M—standard GeneRuler 50 bp DNA ladder; 1—control strain S. aureus CCM 4223; 2—negative control without DNA; 7 to 12—isolates positive for clfA gene (180 bp) and clfB gene (120 bp).
Agriculture 14 00571 g0a6

References

  1. Pedersen, R.R.; Kromker, V.; Bjarnsholt, T.; Dahl-Pedersen, K.; Buhl, R.; Jorgensen, E. Biofilm Research in Bovine Mastitis. Front. Vet. Sci. 2021, 8, 656810. [Google Scholar] [CrossRef] [PubMed]
  2. Javed, S.; McClure, J.; Syed, M.A.; Obasuyi, O.; Ali, S.; Tabassum, S.; Ejaz, M.; Zhang, K. Epidemiology and molecular characterization of Staphylococcus aureus causing bovine mastitis in water buffaloes from the Hazara division of Khyber Pakhtunkhwa, Pakistan. PLoS ONE 2022, 175, e0268152. [Google Scholar] [CrossRef] [PubMed]
  3. Ozbey, G.; Cambay, Z.; Yilmaz, S.; Aytekin, O.; Zigo, F.; Ozçelik, M.; Otlu, B. Identification of bacterial species in milk by MALDI-TOF and assessment of some oxidant-antioxidant parameters in blood and milk from cows with different health status of the udder. Pol. J. Vet. Sci. 2022, 25, 269–277. [Google Scholar] [CrossRef] [PubMed]
  4. Mbindyo, C.M.; Gitao, G.C.; Mulei, C.M. Prevalence, Etiology, and Risk Factors of Mastitis in Dairy Cattle in Embu and Kajiado Counties, Kenya. Vet. Med. Int. 2020, 2020, 8831172. [Google Scholar] [CrossRef] [PubMed]
  5. Zigo, F.; Farkašová, Z.; Výrostková, J.; Regecová, I.; Ondrašovičová, S.; Vargová, M.; Sasáková, N.; Pecka-Kielb, E.; Bursová, Š.; Kiss, D.S. Dairy Cows’ Udder Pathogens and Occurrence of Virulence Factors in Staphylococci. Animals 2022, 12, 470. [Google Scholar] [CrossRef] [PubMed]
  6. Petinaki, E.; Papagiannitsis, C. Resistance of Staphylococci to Macrolides-Lincosamides-Streptogramins B (MLSB): Epidemiology and Mechanisms of Resistance. In Staphylococcus Aureus; Hassan, H., Hani, O., Farhat, A., Eds.; IntechOpen: Berlin, Germany, 2018. [Google Scholar] [CrossRef]
  7. Zigo, F.; Elečko, J.; Farkašová, Z.; Zigová, M.; Vasiľ, M.; Ondrašovičová, S.; Kudělková, L. Preventive methods in reduction of mastitis pathogens in dairy cows. J. Microbiol. Biotechnol. Food Sci. 2019, 9, 121–126. [Google Scholar] [CrossRef]
  8. EMA, European Medicines Agency. Sales of Veterinary Antimicrobial Agents in 31 European Countries in 2018; 10th ESVAC Report; EMA: Amsterdam, The Netherlands, 2020; pp. 1–101. Available online: https://www.ema.europa.eu/en/documents/report/sales-veterinary-antimicrobial-agents-31-european-countries-2018-trends-2010-2018-tenth-esvac-report_en.pdf (accessed on 7 January 2024).
  9. FDA, Food and Drug Administration. 2019 Summary Report on Antimicrobials Sold or Distributed for Use in Food-Producing Animals. 2020; p. 49. Available online: https://www.fda.gov/media/154820/download (accessed on 7 January 2024).
  10. Schnitt, A.; Tenhagen, B.A. Risk Factors for the Occurrence of Methicillin-Resistant Staphylococcus aureus in Dairy Herds: An Update. Foodborne Pathog. Dis. 2020, 17, 585–596. [Google Scholar] [CrossRef] [PubMed]
  11. Zecconi, A.; Cesaris, L.; Liandris, E.; Dapra, V.; Piccinini, R. Role of several Staphylococcus aureus virulence factors on the inflammatory response in bovine mammary gland. Microb. Pathog. 2006, 40, 177–183. [Google Scholar] [CrossRef] [PubMed]
  12. Vargová, M.; Zigo, F.; Výrostková, J.; Farkašová, Z.; Rehan, I.F. Biofilm-Producing Ability of Staphylococcus aureus Obtained from Surfaces and Milk of Mastitic Cows. Vet. Sci. 2023, 10, 386. [Google Scholar] [CrossRef]
  13. Zaatout, N.; Ayachi, A.; Kecha, M.; Kadlec, K. Identification of staphylococci causing mastitis in dairy cattle from Algeria and characterization of Staphylococcus aureus. J. Appl. Microbiol. 2019, 127, 1305–1314. [Google Scholar] [CrossRef]
  14. Khazaie, F.; Ahmadi, E. Bovine subclinical mastitis-associated methicillin-resistant Staphylococcus aureus, selective genotyping and antimicrobial susceptibility profile of the isolates in Kurdistan province of Iran. Iran J. Microbiol. 2021, 13, 65–73. [Google Scholar] [CrossRef] [PubMed]
  15. Deurenberg, R.H.; Vink, C.; Kalenic, S.; Friedrich, A.W.; Bruggeman, C.A.; Stobberingh, E.E. The molecular evolution of methicillin-resistant Staphylococcus aureus. Clin. Microbiol. Infect. 2007, 13, 222–235. [Google Scholar] [CrossRef] [PubMed]
  16. Wu, Z.; Li, F.; Liu, D.; Xue, H.; Zhao, X. Novel Type XII Staphylococcal Cassette Chromosome mec Harboring a New Cassette Chromosome Recombinase, CcrC2. Antimicrob. Agents Chemother. 2015, 59, 7597–7601. [Google Scholar] [CrossRef] [PubMed]
  17. Garcia-Alvarez, L.; Holden, M.T.; Lindsay, H.; Webb, C.R.; Brown, D.F.; Curran, M.D.; Walpole, E.; Brooks, K.; Pickard, D.J.; Teale, C.; et al. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: A descriptive study. Lancet Infect. Dis. 2011, 11, 595–603. [Google Scholar] [CrossRef] [PubMed]
  18. Agarwal, A.; Jain, A. Association between drug resistance and production of biofilm in staphylococci. Indian J. Med. Res. 2012, 135, 562–564. [Google Scholar] [PubMed]
  19. Moufti, M.F.E.; Baddour, M.; Harfoush, R.A.H.; Owais, H.M.A. Characterization of Some Genotypic and Phenotypic Traits of Biofilm Producing Clinical Isolates of Methicillin Resistant Staphylococcus epidermidis. Am. J. Infect. Dis. Microbiol. 2015, 3, 95–103. [Google Scholar]
  20. Hoiby, N.; Bjarnsholt, T.; Moser, C.; Bassi, G.L.; Coenye, T.; Donelli, G.; Hall-Stoodley, L.; Hola, V.; Imbert, C.; Kirketerp-Moller, K.; et al. ESCMID Study Group for Biofilms (ESGB) and Consulting External Expert Werner Z. ESCMID guideline for the diagnosis and treatment of biofilm infections 2014. Clin. Microbiol. Infect. 2015, 21 (Suppl. S1), S1–S25. [Google Scholar] [CrossRef] [PubMed]
  21. Hoiby, N.; Ciofu, O.; Johansen, H.K.; Song, Z.J.; Moser, C.; Jensen, P.O.; Molin, S.; Givskov, M.; Tolker-Nielsen, T.; Bjarnsholt, T. The clinical impact of bacterial biofilms. Int. J. Oral Sci. 2011, 3, 55–65. [Google Scholar] [CrossRef]
  22. Darwish, S.F.; Asfour, H.A.E. Investigation of biofilm forming ability in Staphylococci causing bovine mastitis using phenotypic and genotypic assays. Sci. World J. 2013, 2013, 378492. [Google Scholar] [CrossRef]
  23. Arciola, C.R.; Campoccia, D.; Gamberini, S.; Baldassarri, L.; Montanaro, L. Prevalence of cna, fnbA and fnbB adhesin genes among Staphylococcus aureus isolates from orthopedic infections associated to different types of implant. FEMS Microbiol. Lett. 2005, 246, 81–86. [Google Scholar] [CrossRef]
  24. Cucarella, C.; Solano, C.; Valle, J.; Amorena, B.; Lasa, I.; Penades, J.R. Bap, a Staphylococcus aureus surface protein involved in biofilm formation. J. Bacteriol. 2001, 183, 2888–2896. [Google Scholar] [CrossRef]
  25. Tsompanidou, E.; Denham, E.L.; Sibbald, M.J.; Yang, X.M.; Seinen, J.; Friedrich, A.W.; Buist, G.; van Dijl, J.M. The sortase A substrates FnbpA, FnbpB, ClfA and ClfB antagonize colony spreading of Staphylococcus aureus. PLoS ONE 2012, 7, e44646. [Google Scholar] [CrossRef] [PubMed]
  26. Khoramrooz, S.S.; Mansouri, F.; Marashifard, M.; Malek Hosseini, S.A.; Akbarian Chenarestane-Olia, F.; Ganavehei, B.; Gharibpour, F.; Shahbazi, A.; Mirzaii, M.; Darban-Sarokhalil, D. Detection of biofilm related genes, classical enterotoxin genes and agr typing among Staphylococcus aureus isolated from bovine with subclinical mastitis in southwest of Iran. Microb. Pathog. 2016, 97, 45–51. [Google Scholar] [CrossRef] [PubMed]
  27. Vasudevan, P.; Nair, M.K.; Annamalai, T.; Venkitanarayanan, K.S. Phenotypic and genotypic characterization of bovine mastitis isolates of Staphylococcus aureus for biofilm formation. Vet. Microbiol. 2003, 92, 179–185. [Google Scholar] [CrossRef] [PubMed]
  28. Kryvtsova, M.V.; Király, J.; Koščová, J.; Kostenko, Y.Y.; Bubnov, R.V.; Spivak, M.Y. Determination of biofilm formation and associated gene detection in Staphylococcus genus isolated from the oral cavity under inflammatory periodontal diseases. Stud. Biol. 2020, 14, 49–64. [Google Scholar] [CrossRef]
  29. Hussain, M.; von Eiff, C.; Sinha, B.; Joost, I.; Herrmann, M.; Peters, G.; Becker, K. eap Gene as novel target for specific identification of Staphylococcus aureus. J. Clin. Microbiol. 2008, 46, 470–476. [Google Scholar] [CrossRef] [PubMed]
  30. Iqbal, Z.; Seleem, M.N.; Hussain, H.I.; Huang, L.; Hao, H.; Yuan, Z. Comparative virulence studies and transcriptome analysis of Staphylococcus aureus strains isolated from animals. Sci. Rep. 2016, 6, 35442. [Google Scholar] [CrossRef] [PubMed]
  31. Nourbakhsh, F.; Namvar, A.E. Detection of genes involved in biofilm formation in Staphylococcus aureus isolates. GMS Hyg. Infect. Control 2016, 11, Doc07. [Google Scholar] [CrossRef] [PubMed]
  32. Pereyra, E.A.L.; Picech, F.; Renna, M.S.; Baravalle, C.; Andreotti, C.S.; Russi, R.; Calvinho, L.F.; Diez, C.; Dallard, B.E. Detection of Staphylococcus aureus adhesion and biofilm-producing genes and their expression during internalization in bovine mammary epithelial cells. Vet. Microbiol. 2016; 183, 69–77. [Google Scholar] [CrossRef]
  33. Englerová, K.; Bedlovičová, Z.; Nemcová, R.; Király, J.; Maďar, M.; Hajdučková, V.; Styková, E.; Mucha, R.; Reiffová, K. Bacillus amyloliquefaciens-Derived Lipopeptide Biosurfactants Inhibit Biofilm Formation and Expression of Biofilm-Related Genes of Staphylococcus aureus. Antibiotics 2021, 10, 1252. [Google Scholar] [CrossRef]
  34. CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, Second Informational Supplement; CLSI Document VET01-S2; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2013. [Google Scholar]
  35. EUCAST Guidelines for Detection of Resistance Mechanisms and Specific Resistances of Clinical and/or Epidemiological Importance. Version 2.0. 2017, pp. 1–43. Available online: http://www.eucast.org (accessed on 7 January 2024).
  36. Gattringer, R.; Niks, M.; Ostertag, R.; Schwarz, K.; Medvedovic, H.; Graninger, W.; Georgopoulos, A. Evaluation of MIDITECH automated colorimetric MIC reading for antimicrobial susceptibility testing. J. Antimicrob. Chemother. 2002, 49, 651–659. [Google Scholar] [CrossRef]
  37. O’Toole, G.A.; Pratt, L.A.; Watnick, P.I.; Newman, D.K.; Weaver, V.B.; Kolter, R. Genetic approaches to study of biofilms. Methods Enzym. 1999, 310, 91–109. [Google Scholar] [CrossRef]
  38. Torres, G.; Vargas, K.; Sanchez-Jimenez, M.; Reyes-Velez, J.; Olivera-Angel, M. Genotypic and phenotypic characterization of biofilm production by Staphylococcus aureus strains isolated from bovine intramammary infections in Colombian dairy farms. Heliyon 2019, 5, e02535. [Google Scholar] [CrossRef] [PubMed]
  39. Gonzalez-Dominguez, M.S.; Carvajal, H.D.; Calle-Echeverri, D.A.; Chinchilla-Cardenas, D. Molecular Detection and Characterization of the mecA and nuc Genes From Staphylococcus Species (S. aureus, S. pseudintermedius, and S. schleiferi) Isolated From Dogs Suffering Superficial Pyoderma and Their Antimicrobial Resistance Profiles. Front. Vet. Sci. 2020, 7, 376. [Google Scholar] [CrossRef] [PubMed]
  40. Qolbaini, E.N.; Khoeri, M.M.; Salsabila, K.; Paramaiswari, W.T.; Tafroji, W.; Artika, I.M.; Safari, D. Identification and antimicrobial susceptibility of methicillin-resistant Staphylococcus aureus-associated subclinical mastitis isolated from dairy cows in Bogor, Indonesia. Vet. World 2021, 14, 1180–1184. [Google Scholar] [CrossRef] [PubMed]
  41. van Hoek, A.H.; Mevius, D.; Guerra, B.; Mullany, P.; Roberts, A.P.; Aarts, H.J. Acquired antibiotic resistance genes: An overview. Front. Microbiol. 2011, 2, 203. [Google Scholar] [CrossRef] [PubMed]
  42. Yamamoto, T.; Nishiyama, A.; Takano, T.; Yabe, S.; Higuchi, W.; Razvina, O.; Shi, D. Community-acquired methicillin-resistant Staphylococcus aureus: Community transmission, pathogenesis, and drug resistance. J. Infect. Chemother. 2010, 16, 225–254. [Google Scholar] [CrossRef] [PubMed]
  43. Bagcigil, F.A.; Moodley, A.; Baptiste, K.E.; Jensen, V.F.; Guardabassi, L. Occurrence, species distribution, antimicrobial resistance and clonality of methicillin- and erythromycin-resistant staphylococci in the nasal cavity of domestic animals. Vet. Microbiol. 2007, 121, 307–315. [Google Scholar] [CrossRef] [PubMed]
  44. Szczuka, E.; Porada, K.; Wesolowska, M.; Leska, B. Occurrence and Characteristics of Staphylococcus aureus Isolated from Dairy Products. Molecules 2022, 27, 4649. [Google Scholar] [CrossRef]
  45. Cvetnic, L.; Samardzija, M.; Duvnjak, S.; Habrun, B.; Cvetnic, M.; Jaki Tkalec, V.; Duricic, D.; Benic, M. Multi Locus Sequence Typing and spa Typing of Staphylococcus aureus Isolated from the Milk of Cows with Subclinical Mastitis in Croatia. Microorganisms 2021, 9, 725. [Google Scholar] [CrossRef]
  46. Mehli, L.; Hoel, S.; Thomassen, G.M.; Jakobsen, A.; Karlsen, H. The prevalence, genetic diversity and antibiotic resistance of Staphylococcus aureus in milk, whey, and cheese from artisan farm dairies. Int. Dairy J. 2016, 65, 20–27. [Google Scholar] [CrossRef]
  47. Kou, X.; Cai, H.; Huang, S.; Ni, Y.; Luo, B.; Qian, H.; Ji, H.; Wang, X. Prevalence and Characteristics of Staphylococcus aureus Isolated from Retail Raw Milk in Northern Xinjiang, China. Front. Microbiol. 2021, 12, 705947. [Google Scholar] [CrossRef] [PubMed]
  48. Vyrostkova, J.; Regecova, I.; Zigo, F.; Semjon, B.; Gregova, G. Antimicrobial Resistance of Staphylococcus sp. Isolated from Cheeses. Animals 2021, 12, 36. [Google Scholar] [CrossRef] [PubMed]
  49. Rychshanova, R.; Mendybayeva, A.; Micinski, B.; Mamiyev, N.; Shevchenko, P.; Bermukhametov, Z.; Orzechowski, B.; Micinski, J. Antibiotic resistance and biofilm formation in Staphylococcus aureus isolated from dairy cows at the stage of subclinical mastitis in northern Kazakhstan. Arch. Anim. Breed. 2022, 65, 439–448. [Google Scholar] [CrossRef] [PubMed]
  50. Wang, W.; Lin, X.; Jiang, T.; Peng, Z.; Xu, J.; Yi, L.; Li, F.; Fanning, S.; Baloch, Z. Prevalence and Characterization of Staphylococcus aureus Cultured from Raw Milk Taken from Dairy Cows with Mastitis in Beijing, China. Front. Microbiol. 2018, 9, 1123. [Google Scholar] [CrossRef] [PubMed]
  51. Gajewska, J.; Chajecka-Wierzchowska, W. Biofilm Formation Ability and Presence of Adhesion Genes among Coagulase-Negative and Coagulase-Positive Staphylococci Isolates from Raw Cow’s Milk. Pathogens 2020, 9, 654. [Google Scholar] [CrossRef] [PubMed]
  52. Hussain, M.; Kohler, C.; Becker, K. Role of SrtA in Pathogenicity of Staphylococcus lugdunensis. Microorganisms 2020, 8, 1975. [Google Scholar] [CrossRef]
  53. Mohammadi, A.; Goudarzi, M.; Dadashi, M.; Soltani, M.; Goudarzi, H.; Hajikhani, B. Molecular Detection of Genes Involved in Biofilm Formation in Staphylococcus aureus Strains Isolates: Evidence from Shahid Motahari Hospital in Tehran. Jundishapur J. Microbiol. 2020, 13, e102058. [Google Scholar] [CrossRef]
Agriculture 14 00571 g001
Figure 1. Biofilm formation in S. aureus isolates from subclinical mastitis milk. CCM 4418—non-forming biofilm S. epidermidis (negative control), CCM 4223—biofilm forming S. aureus (positive control), Samples 7–12—strains with weak or strong production of biofilm. *** significantly lower ability to produce biofilm (p < 0.005).
Figure 1. Biofilm formation in S. aureus isolates from subclinical mastitis milk. CCM 4418—non-forming biofilm S. epidermidis (negative control), CCM 4223—biofilm forming S. aureus (positive control), Samples 7–12—strains with weak or strong production of biofilm. *** significantly lower ability to produce biofilm (p < 0.005).
Agriculture 14 00571 g001
Table 1. Primers used for PCR analysis.
Table 1. Primers used for PCR analysis.
GenePrimerSequence (5′→3′)Product (bp)Reference
16S
rRNA		16S rRNA_FwCTACAATGGACAATACAAAGGGC141[28]
16S rRNA_RevTCACCGTAGCATGCTGATCT
eapEAP-CON1TACTAACGAAGCATCTGCC230[29]
EAP-CON2TTAAATCGATATCACTAATACCTC
nucnuc_FwACCTGCGACATTAATTAAAGCG103This study
nuc_RevTGTTTCAGGTGTATCAACCAATAATAG
mecAmecA_FwTGGAAGTTAGATTGGGATCATAGC154This study
mecA_RevCGATGCCTATCTCATATGCTGTT
mecCmecC_FwGACGATGGATCTGGTACAGCA94This study
mecC_RevCATTCATGAATGGATAAACATCGTA
bapbap_Fw TTGACGAGGTTGGTAATGGC 87This study
bap_Rev CGCCTACAGTTTCTGGTAATGC
icaAicaA_Fw CTTGCTGGCGCAGTCAATAC 75[30]
icaA_Rev GTAGCCAACGTCGACAACTG
icaBicaB_Fw ATACCGGCGACTGGGTTTAT 141[31]
icaB_Rev ATGCAAATCGTGGGTATGTGT
icaCicaC_Fw CTTGGGTATTTGCACGCATT 209[32]
icaC_Rev GCAATATCATGCCGACACCT
icaDicaD_Fw ACCCAACGCTAAAATCATCG211[31]
icaD_Rev GCGAAAATGCCCATAGTTTC
srtAsrtA_Fw GTGGTACTTATCCTAGTGGCAGC183[33]
srtA_Rev GCCTGCCACTTTCGATTTATC
agragr_FwTCGTAAGCATGACCCAGTTG96[33]
agr_RevAAATCCATCGCTGCAACTTT
fnbAfnbA_FwGAAGTGGCACAGCCAAGAAC192[33]
fnbA_RevACGTTGACCAGCATGTGG
fnbBfnbB_FwCAATGATCCTATCATTGAGAAGAGTG156[33]
fnbB_RevCCTTCTACACCTTCAACAGCTGTA
clfAclfA_FwGAGAGCATTTAGTTTAGCGGCA180This study
clfA_RevTCACCTTTAACAGCAGAATTAGGC
clfBclfB_FwGTCTACACAAACGAGCAATACCAC120This study
clfB_RevTGAGGAACAGTTTGATCTTGCA
Table 2. Conditions of mPCR detection of 16S rRNA and genes eap and nuc.
Table 2. Conditions of mPCR detection of 16S rRNA and genes eap and nuc.
ProcessTemperature (°C)Time (s/min)Number of Cycles
Initial denaturation 953 min1
Denaturation9530 s30
Annealing5530 s
Extension7220 s
Denaturation9530 s10
Annealing6130 s
Extension7220 s
Final extension7210 min1
Table 3. Conditions for PCR detection of genes mecA, mecC, and bap and for mPCR detection of genes icaABCD, srtA, agrA, fnbA/B, and clfA/B.
Table 3. Conditions for PCR detection of genes mecA, mecC, and bap and for mPCR detection of genes icaABCD, srtA, agrA, fnbA/B, and clfA/B.
ProcessTemperature (°C)Time (s/min)Number of Cycles
Initial denaturation 953 min1
Denaturation9530 s35
Annealing6130 s
Extension7220 s
Final extension7210 min1
Table 4. MIC results of S. aureus isolates and resistance assessment.
Table 4. MIC results of S. aureus isolates and resistance assessment.
Sample7 8 9 10 11 12
ATBMICxG (mg/L)Antimicrobial Susceptibility ProfileMICxG (mg/L)Antimicrobial Susceptibility ProfileMICxG (mg/L)Antimicrobial Susceptibility ProfileMICxG (mg/L)Antimicrobial Susceptibility ProfileMICxG (mg/L)Antimicrobial Susceptibility ProfileMICxG (mg/L)Antimicrobial Susceptibility Profile
AMP0.25S0.25S0.25S2R0.25S>32R
SAM0.25S0.25S0.25S0.5S0.25S>32R
OXA0.25S0.25S0.25S0.5S0.25S0.25S
FOX2S2S2S2S2S2S
TZP0.5S0.5S0.5S2S0.5S0.5S
ERY0.25S0.25S0.25S>8R0.25S0.12S
CLI0.12S0.12S0.12S4R0.12S0.06S
LNZ4S4S4S2S4S2S
RIF0.03S0.03S0.03S0.03S0.03S0.03S
GEN0.5S0.5S1S1S0.5S0.5S
TEC1S2S2S2S1S1S
VAN1S2S1S1S1S1S
TMP2S4S4S2S1S1S
CHL8S8S8S16R8S8S
TGC0.12S0.06S0.06S0.12S0.06S0.06S
MFX0.12S0.06S0.06S0.06S0.03S0.03S
CIP0.5I0.25I0.5I0.5I0.25I0.25I
TET1S0.5S0.25S0.5S0.25S0.25S
COT0.25S0.25S0.25S0.25S0.25S0.25S
NIT16S32S32S16S16S16S
S—sensitive; I—intermediate; R—resistant; MICxG—geometric mean MIC.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Király, J.; Hajdučková, V.; Gregová, G.; Szabóová, T.; Pilipčinec, E. Resistant S. aureus Isolates Capable of Producing Biofilm from the Milk of Dairy Cows with Subclinical Mastitis in Slovakia. Agriculture 2024, 14, 571. https://doi.org/10.3390/agriculture14040571

AMA Style

Király J, Hajdučková V, Gregová G, Szabóová T, Pilipčinec E. Resistant S. aureus Isolates Capable of Producing Biofilm from the Milk of Dairy Cows with Subclinical Mastitis in Slovakia. Agriculture. 2024; 14(4):571. https://doi.org/10.3390/agriculture14040571

Chicago/Turabian Style

Király, Ján, Vanda Hajdučková, Gabriela Gregová, Tatiana Szabóová, and Emil Pilipčinec. 2024. "Resistant S. aureus Isolates Capable of Producing Biofilm from the Milk of Dairy Cows with Subclinical Mastitis in Slovakia" Agriculture 14, no. 4: 571. https://doi.org/10.3390/agriculture14040571

APA Style

Király, J., Hajdučková, V., Gregová, G., Szabóová, T., & Pilipčinec, E. (2024). Resistant S. aureus Isolates Capable of Producing Biofilm from the Milk of Dairy Cows with Subclinical Mastitis in Slovakia. Agriculture, 14(4), 571. https://doi.org/10.3390/agriculture14040571

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop