Next Article in Journal
Resistance and Adaptation of Bacteria to Non-Antibiotic Antibacterial Agents: Physical Stressors, Nanoparticles, and Bacteriophages
Previous Article in Journal
The Bacterial Genomic Context of Highly Trimethoprim-Resistant DfrB Dihydrofolate Reductases Highlights an Emerging Threat to Public Health
Previous Article in Special Issue
The Roles of Microbial Cell-Cell Chemical Communication Systems in the Modulation of Antimicrobial Resistance
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 10
Issue 4
10.3390/antibiotics10040434
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Adsorption of Phenazines Produced by Pseudomonas aeruginosa Using AST-120 Decreases Pyocyanin-Associated Cytotoxicity

by
Hidetada Hirakawa
1,*,
Ayako Takita
1,
Motoyuki Uchida
2,
Yuka Kaneko
1,
Yuto Kakishima
1,
Koichi Tanimoto
3,
Wataru Kamitani
4 and
Haruyoshi Tomita
1,3
1
Department of Bacteriology, Graduate School of Medicine, Gunma University, Maebashi, Gunma 371-8511, Japan
2
R&D Strategy & Planning Department, Kureha Corporation, 16 Ochiai, Iwaki, Fukushima 974-8686, Japan
3
Laboratory of Bacterial Drug Resistance, Graduate School of Medicine, Gunma University, Maebashi, Gunma 371-8511, Japan
4
Department of Infectious Diseases and Host Defense, Graduate School of Medicine, Gunma University, Maebashi, Gunma 371-8511, Japan
*
Author to whom correspondence should be addressed.
Antibiotics 2021, 10(4), 434; https://doi.org/10.3390/antibiotics10040434
Submission received: 15 March 2021 / Revised: 9 April 2021 / Accepted: 10 April 2021 / Published: 13 April 2021
(This article belongs to the Special Issue Interference of Bacterial Signaling as a New Strategy for Treatment of AMR Pathogens)
Browse Figures
Review Reports Versions Notes

Abstract

:
AST-120 (Kremezin) is used to treat progressive chronic kidney disease by adsorbing uremic toxin precursors produced by the gut microbiota, such as indole and phenols. Previously, we found that AST-120 decreased drug tolerance and virulence in Escherichia coli by adsorbing indole. Here, we show that AST-120 adsorbs phenazine compounds, such as pyocyanin, produced by Pseudomonas aeruginosa including multidrug-resistant P. aeruginosa strains, and suppresses pyocyanin-associated toxicity in A-549 (alveolar adenocarcinoma) and Caco-2 (colon adenocarcinoma) cells. Addition of fosfomycin, colistin and amikacin, which are often used to treat P. aeruginosa, inhibited the bacterial growth, regardless of the presence or absence of AST-120. These results suggest a further benefit of AST-120 that supports anti-Pseudomonas chemotherapy in addition to that of E. coli and propose a novel method to treat P. aeruginosa infection.

1. Introduction

Pseudomonas aeruginosa is a well-studied opportunistic pathogen. This bacteria is frequently found in patients suffering from chronic respiratory infections, such as cystic fibrosis (CF) and diffuse panbronchiolitis, and it eventually causes respiratory failure in patients [1,2]. Serious infections also occur in compromised hosts when P. aeruginosa enters the bloodstream from multiple possible sites, such as burn wound sites, the urinary tract and the intestinal tract, resulting in fatal sepsis [3,4,5]. Treatment of P. aeruginosa infections is generally difficult because of its innate resistance and tolerance to a broad range of antimicrobial agents [6,7]. In addition, advanced multidrug-resistant strains have often been isolated in clinical settings [8,9].
P. aeruginosa produces a large number of molecules that contribute to its virulence. Phenazines are one such group of molecules, of which pyocyanin is the most well characterized phenazine molecule. This molecule is synthesized from the shikimic acid substrate [10]. Some studies have suggested the crucial roles of pyocyanin in its toxicity to host cells. This molecule causes oxidative stress in epithelial cells and disrupts Ca2+ homeostasis associated with the V-ATPase activity while also decreasing the immune response by inducing apoptosis in neutrophils and suppressing the secretion of immunoglobulins by B-lymphocytes and the proliferation of T-lymphocytes [11,12,13,14]. In addition, phenazine/pyocyanin-deficient P. aeruginosa mutants exhibit a low fatality rate in Caenorhabditis elegans, Drosophila and burned mice and a reduced infection rate in the lungs of mice [15,16,17,18].
AST-120 (Kremezin) is a carbonaceous adsorbent, used as an oral drug to treat progressive chronic kidney disease (CKD) by delaying the disease’s progression and the initiation of dialysis. In enteric sites, AST-120 adsorbs uremic toxin precursors, including indole produced by enteric bacteria, and reduces the production of uremic toxins, such as indoxyl sulfate [19]. In addition to its efficacy in treating CKD, we previously found that indole induced drug tolerance and virulence in Escherichia coli including enterohaemorrhagic E. coli, and AST-120 eliminated these effects by adsorbing indole. Thus, AST-120 reduces drug tolerance and virulence in E. coli [20]. AST-120 can also adsorb some other small-sized molecules that have aromatic ring structures in addition to indole [10]. Here, we show evidence that AST-120 adsorbs phenazines, including pyocyanin produced by P. aeruginosa including clinical isolates that are resistant to antimicrobials, such as multidrug-resistance P. aeruginosa (MDRP), and reduces pyocyanin-associated toxicity to host epithelial cells.

2. Results

2.1. AST-120 Adsorbs Phenazines Produced by P. aeruginosa and Decreases the Extracellular Pyocyanin Levels

Pyocyanin is one of the phenazine molecules and it is produced from its phenazine precursors such as phenazine-1-carboxylic acid and 5-methylphenazine-1-carboxylic acid betaine (Figure 1). Since phenazine compounds, including pyocyanin, have tricyclic structures consisting of a benzene ring [10], we hypothesized that AST-120 might adsorb these molecules, decreasing the levels of pyocyanin in P. aeruginosa cultures. To test this hypothesis, we incubated a synthetic phenazine with AST-120 for 2 h in a bacteria-free solution and the level of phenazine in the supernatant was measured after the removal of AST-120. More than 90% of the phenazine was adsorbed when incubated with at least 10 mg of AST-120 (Figure 2A). The bacteria-free supernatant, filtrated from a 24 h culture of PAO1, was incubated with AST-120, and we measured the level of pyocyanin in the supernatant after the removal of AST-120 to assess the pyocyanin-adsorption ability of AST-120. We did not detect pyocyanin residues after incubation with at least 20 mg AST-120 (Figure 2B). We also measured the pyocyanin level in the culture supernatant of PAO1 when co-cultured with AST-120. The color of the PAO1 culture was clear when cultured in the presence of 30 mg AST-120 and the pyocyanin level was below the detection limit (Figure 2C,D). In contrast, the color of the bacterial culture was blue/green when grown in the absence of AST-120 (Figure 2C). PhzA1 and PhzB1 proteins are required for the synthesis of pyocyanin. Previously, the phzB1 mutant was found to exhibit defective production of pyocyanin [21]. Here, we confirmed that the phzA1/B1 mutant (designated ∆phzA1/B1) exhibited no pyocyanin production (Figure 2C). These observations suggest that AST-120 adsorbs phenazine products including pyocyanin produced by P. aeruginosa, and decreases the level of pyocyanin. In addition to PAO1 culture, we tested the effect of AST-120 on removing pyocyanin in some drug-resistant clinical isolates, including MDRP strains. We found that strains Ps.a-1200, Ps.a-1205 and RPs.a-947 highly produced pyocyanin, and the addition of 30 mg AST-120 reduced pyocyanin levels in their cultures, while RPs.a-914 exhibited a low pyocyanin production (Figure 2E).

2.2. AST-120 Does Not Alter the Levels of LasI-LasR and RhlI-RhlR-Mediated Quorum Sensing

Pyocyanin production is induced by LasI-LasR and RhlI-RhlR quorum sensing (QS) systems [22]. We concluded that AST-120 does not alter the activities of these QS systems for the following reasons. LasI-LasR and RhlI-RhlR are known to elevate the activity of lasI and rhlA promoters, respectively. We measured the levels of lasI and rhlA promoters to determine LasI-LasR and RhlI-RhlR activities in PAO1 grown with and without 30 mg AST-120. There was no significant difference in β-galactosidase levels corresponding to the activity of lasI in the PAO1 strains grown with and without AST-120 while β-galactosidase level corresponding to the activity of rhlA in PAO1 grown with AST-120 was modestly lower than that grown without AST-120 (Figure 3). We also found that there was no significant difference in the growth of PAO1 when cultured in the presence and absence of AST-120 (data not shown).

2.3. AST-120 Decreases Pyocyanin-Associated Toxicity of P. aeruginosa to Host Cells

Pyocyanin causes damage and death to host cells. Its function has been well defined in airway epithelial cells, such as A-549 (11). We tested whether removal of pyocyanin by AST-120 treatment reduces the toxicity to A-549 cells. The addition of a bacteria-free supernatant from a PAO1 culture killed approximately 80% of A-549 cells while 55% of the host cells survived when incubated with supernatant from PAO1 cultured with 30 mg AST-120 (Figure 4A). We also found that the cytotoxicity of supernatants from Ps.a-1200, Ps.a-1205 and RPs.a-946 cultures, but not RPs.a-914 (poor pyocyanin producer), was alleviated when the bacteria were grown in the presence of AST-120 (Figure 4A). When AST-120 is orally administrated, it may adsorb pyocyanin produced by P. aeruginosa in the gut and attenuate damage to intestinal cells. We determined the toxicity of supernatants from P. aeruginosa cultured with and without AST-120 to Caco-2 cells to test this hypothesis. The addition of supernatants from PAO1, Ps.a-1200, Ps.a-1205 and RPs.a-946 cultures killed more than 99.9% of Caco-2 cells while the cytotoxicity of culture supernatant from RPs.a-914 (the poor pyocyanin producer) was relatively modest (approximately 10% of the host cells survived). Similar to A-549 cells, the addition of AST-120 to the cultures neutralized the toxicity of bacterial supernatants (Figure 4B). We also found that the toxicity of supernatant from the ∆phzA1/B1 strain was lower than that from the parent PAO1 strain and the addition of AST-120 to the mutant culture did not further decrease the toxicity to Caco-2 cells (Figure 4C). We assessed the neutralizing effect of AST-120 on cytotoxicity in low doses. We found that treatment with at least 10 mg AST-120 markedly reduced the toxicity of PAO1 culture supernatant to Caco-2 cells (Figure 4D). These results indicate that AST-120 decreases pyocyanin-associated cytotoxicity of P. aeruginosa to Caco-2 cells.

2.4. AST-120 Does Not Impair Antibacterial Activities of Fosfomycin, Colistin and Amikacin

As an unfavorable property of AST-120, it adsorbs some classes of antimicrobial agents including β-lactams and quinolones. However, fosfomycin, colistin and aminoglycosides are not adsorbed by AST-120 (20). Therefore, fosfomycin, colistin and aminoglycosides, such as amikacin, might still be able to be used together with AST-120 to treat P. aeruginosa infections. We estimated the in vitro effectiveness of the combination treatment that used AST-120 and either of these drugs. At the beginning of the experiment, we determined that minimum inhibitory concentrations (MICs) of fosfomycin, colistin and amikacin in PAO1 were 64, 16 and 2 μg/mL, respectively. The PAO1 strains were incubated with either 128 μg/mL fosfomycin, 32 μg/mL colistin or 4 μg/mL amikacin in the presence and absence of 30 mg AST-120. Addition of these drugs inhibited the bacterial growth even when AST-120 was present, suggesting that AST-120 can be used together with fosfomycin, colistin and amikacin (Figure 5).

3. Discussion

AST-120 is used to treat progressive CKD. It decreases the production of indoxyl sulfate, a uremic toxin derived from indole produced by some kinds of enteric bacteria [19]. In addition to its role in CKD treatment, we recently found that AST-120 decreased drug tolerance and virulence of E. coli, including enterohaemorrhagic E. coli [20]. Here, we propose another potential benefit of AST-120 in reducing the cytotoxicity of P. aeruginosa by adsorbing phenazines including pyocyanin.
P. aeruginosa is one of the major pathogens that cause nosocomial infections. In addition to the airway, the intestinal tract is considered the primary reservoir of this bacteria in hospitalized patients [23]. P. aeruginosa colonized in the gut of immunocompromised patients disrupts the intestinal epithelial barrier and enters the bloodstream, leading to systemic infections. Pyocyanin impairs colon epithelial cells, which may be associated with disruption of the intestinal epithelial barrier. Our results indicated that AST-120 alleviated this effect of pyocyanin. In addition to the cytotoxicity to host epithelial cells, pyocyanin exhibits bactericidal activity against many bacterial species [21,24]. The gut microbiota acts as an intestinal barrier to protect against intestinal pathogens. A recent in vivo study using a mouse model suggested that E. coli protected mice from intestinal P. aeruginosa [25]. Therefore, adsorption of pyocyanin by AST-120 may protect the host from intestinal P. aeruginosa by decreasing the direct damage to intestinal epithelial cells and disturbance of gut microbiota, including E. coli, contributing to the homeostasis of the intestinal barrier.
Phenazines, including pyocyanin, also contribute to the biological fitness of P. aeruginosa and they may enable the bacteria to establish infection, as these molecules are involved in anaerobic survival, iron acquisition and biofilm development [21,26,27]. Phenazines have also been shown to be involved in the progression of chronic respiratory infections, such as in CF patients [28]. Availability of iron and oxygen for P. aeruginosa could be limited in the gut due to the presence of other microorganism competitors, such as gut microbiota. Therefore, phenazines may also aid P. aeruginosa to colonize and survive in the gut. AST-120 has the potential to remove the benefits of intestinal P. aeruginosa conferred by phenazines.
Pyocyanin is considered as a potential target for treating P. aeruginosa infections. Some methods to alleviate the burden of pyocyanin-associated virulence have been previously proposed. Antioxidant agents have been shown to decrease pyocyanin-induced oxidative stress and improve CF lung function [29]. Pyocyanin is synthesized from shikimic acid via chorismic acid, the phenazine precursor. A pathway to produce chorismic acid from the shikimic acid substrate, termed the aro pathway, is found in prokaryotes, but is not present in vertebrates. Thus, aro enzymes could be used as attractive therapeutic targets in P. aeruginosa [30]. Since the QS systems of P. aeruginosa are involved in the induction of pyocyanin biosynthesis, the interference of this system could be a potential alternative therapeutic strategy [22,31]. The adsorption method proposed in this study may be incorporated with novel approaches to prevent and treat P. aeruginosa infections.
Although AST-120 adsorbs certain antimicrobial agents [20], it can be used in combination with fosfomycin, colistin and amikacin. Fosfomycin and colistin have recently attracted attention as “last-resort drugs” to treat MDRP strains, which are resistant to commonly used anti-P. aeruginosa agents, such as some β-lactams, quinolones and aminoglycosides [32,33]. Therefore, AST-120 may offer a potential benefit by helping chemotherapy treat refractory MDRP infections. In addition to some antimicrobial agents, AST-120 might adsorb some of beneficial secondary metabolites in host cells because it non-selectively adsorbs small-sized molecules containing aromatic ring structures. Several tryptophan metabolites, such as indole propionic acid and indole-3-carboxaldehyde, contribute to the protection of gut epithelial cells [34,35,36]. AST-120 may adsorb these compounds. AST-120 is widely used to treat CKD and it has been approved to be safe even when administrated for a long period. Therefore, non-selective adsorption of AST-120 may be not a critical issue as shown in several clinical trials [37]. However, to enhance the potential efficacy of AST-120 therapy, it is important to establish a protocol that minimizes the interference in the beneficial effects of some secondary metabolites.

4. Materials and Methods

4.1. Bacterial Strains, Host Cells and Culture Conditions

We used P. aeruginosa PAO1 strain, its derivative and some clinical antibiotic-resistant isolates originally isolated from sputum (Ps.a-1200, Ps.a-1205 and RPs.a-914) and urinary catheters (RPs.a-946) in hospitalized patients. The strains are resistant to the antibiotics as follows: Ps.a-1200 (levofloxacin), Ps.a-1205 (aztreonam, meropenem and levofloxacin), RPs.a-946 (imipenem, meropenem, gentamycin, amikacin and levofloxacin) and Rps.a-914 (imipenem, meropenem, gentamycin, amikacin and levofloxacin). The bacteria were aerobically grown in glass tubes with shaking at 160 rpm. Antibiotics were added to the growth media at the following concentrations for marker selection and plasmid maintenance: 300 μg/mL carbenicillin and 100 μg/mL gentamicin for PAO1, 150 μg/mL ampicillin and 20 μg/mL gentamicin for E. coli. The A-549 (ATCC CCL-185) and Caco-2 (ATCC HTB-37) cells were obtained from American Type Culture Collection (ATCC). These cells were cultured in Dulbecco’s modified Eagle medium (DMEM) containing 10% HyClone FetalClone III serum (HyClone Laboratories, Inc., Logan, UT, United States) at 37 °C and in an atmosphere of 5% CO2.

4.2. Mutant Construction

To construct the in-frame deletions of phzA1 and phzB1 in the PAO1 background, we performed a gene replacement strategy based on homologous recombination using the pEX18Gm vector as previously described [38,39]. We amplified a flanking DNA fragment including the upstream region of phzA1 and the downstream region of phzB1 by sequence overlap extension polymerase chain reaction (PCR) with primer pairs, delta1/delta2 and delta3/delta4 (Table 1). The upstream flanking DNA included 450 bp and the first three amino acid codons. The downstream flanking DNA included the last two amino acid codons, the stop codon and 450 bp of DNA. This deletion construct was ligated into BamHI and HindIII-digested pEX18Gm and introduced into PAO1. We selected sucrose-resistant/gentamicin-sensitive colonies and confirmed the resulting mutant strains using PCR analysis and DNA sequencing.

4.3. Pyocyanin Assay

Pyocyanin level was determined as previously described [40], with slight modifications. Bacteria were grown in Luria–Bertani (LB) medium for 24 h and the cell cultures were centrifuged to remove the cell pellets. Pyocyanin in the culture supernatants was extracted with chloroform and then re-extracted into 0.2 M HCl. Pyocyanin was quantified by measuring the absorbance of this solution at 520 nm.

4.4. Reporter Construction and Promoter Assays

To measure the promoter activities of lasI and rhlA in PAO1, we PCR-amplified the 365- and 425-bp regions upstream of lasI and rhlA in PAO1, respectively, using the primer pairs listed in Table 1 and ligated each product into the NsiI and KpnI-digested pBBR1MCS4lacZ reporter plasmid [38]. The PAO1 strains carrying each reporter plasmid, designated pBBRlasI (PAO1)-P or pBBRrhlA (PAO1)-P, were grown in the presence and absence of AST-120 and 10% of chloroform was added to lyse the cells. The chemiluminescent signal in the supernatant was generated using a Tropix Galacto-Light Plus kit according to the manufacturer’s instructions (Thermo Fisher Scientific, Waltham, MA, USA). Their β-galactosidase activities corresponding to LacZ expression were determined as the signal value normalized to an OD600 of 1 [38].

4.5. Cytotoxicity Assays

Bacteria were grown in LB medium for 24 h. The bacteria-free culture supernatants were 2-fold diluted into DMEM containing 10% HyClone FetalClone III serum and added to cultured A-549 and Caco-2 cells in 96-well plates. As a control, a two-fold diluted LB medium in DMEM containing 10% HyClone FetalClone III serum was added to the host cells. After incubation for 24 h, the cell viabilities were determined using CellTiter-Glo Luminescent Cell Viability Assay (Promega Corp., Madison, WI, USA) according to the manufacturer’s instructions. The cell viabilities were represented as relative light units (RLUs) by their ratios (%) to RLU of the control sample.

4.6. Minimum Inhibitory Concentration (MIC) Assays

MIC assays were performed by the standard serial agar dilution method of the Clinical and Laboratory Standards Institute (CLSI). The MIC was determined as the lowest concentration at which growth was inhibited.

4.7. Statistical Analysis

The p-value in each assay was determined by the unpaired t-test with the GraphPad Prism version 6.00.

4.8. Approval for Experiments

All experimental protocols were approved by the Gunma University Gene.
Recombination Experiment Safety Committee for all gene recombination and bacteria culture studies (The approval number: 19–041). All experiments were performed in accordance with these committee’s guidelines and regulations.

Author Contributions

H.H., M.U., K.T., W.K. and H.T. designed the research and wrote the manuscript. M.U., K.T. and W.K. provided the materials. H.H., K.T., W.K., and H.T. analyzed the data. H.H., A.T., Y.K. (Yuka Kaneko) and Y.K. (Yuto Kakishima) performed the research. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Japan Society for the Promotion of Science (JSPS) “Grant-in-Aid for Scientific Research (C)” (Grant No. 19K07533) and the Japan Agency for Medical Research and Development (AMED) (Grant No. 21fk0108604h0901).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Conflicts of Interest

The author, Uchida belongs to a commercial company, Kureha corp. This author contributed to the study design, and providing the AST-120 material to perform experiments but did not directly participate in data collection.

References

  1. Murray, T.S.; Egan, M.; Kazmierczak, B.I. Pseudomonas aeruginosa chronic colonization in cystic fibrosis patients. Curr. Opin. Pediatr. 2007, 19, 83–88. [Google Scholar] [CrossRef] [PubMed]
  2. Poletti, V.; Casoni, G.L.; Chilosi, M.; Zompatori, M. Diffuse panbronchiolitis. Eur. Respir. J. 2006, 28, 862–871. [Google Scholar] [CrossRef] [PubMed]
  3. Turner, K.H.; Everett, J.; Trivedi, U.; Rumbaugh, K.P.; Whiteley, M. Requirements for Pseudomonas aeruginosa Acute Burn and Chronic Surgical Wound Infection. PLoS Genet. 2014, 10, e1004518. [Google Scholar] [CrossRef] [Green Version]
  4. Mittal, R.; Aggarwal, S.; Sharma, S.; Chhibber, S.; Harjai, K. Urinary tract infections caused by Pseudomonas aeruginosa: A minireview. J. Infect. Public Health 2009, 2, 101–111. [Google Scholar] [CrossRef] [Green Version]
  5. Alverdy, J.; Holbrook, C.; Rocha, F.; Seiden, L.; Wu, R.L.; Musch, M.; Chang, E.; Ohman, D.; Suh, S. Gut-derived sepsis occurs when the right pathogen with the right virulence genes meets the right host: Evidence for in vivo virulence expression in Pseudomonas aeruginosa. Ann. Surg. 2000, 232, 480–489. [Google Scholar] [CrossRef]
  6. Poole, K. Pseudomonas aeruginosa: Resistance to the max. Front. Microbiol. 2011, 2, 65. [Google Scholar] [CrossRef] [Green Version]
  7. Hoiby, N. Recent advances in the treatment of Pseudomonas aeruginosa infections in cystic fibrosis. BMC Med. 2011, 9, 32. [Google Scholar] [CrossRef] [Green Version]
  8. Aloush, V.; Navon-Venezia, S.; Seigman-Igra, Y.; Cabili, S.; Carmeli, Y. Multidrug-Resistant Pseudomonas aeruginosa: Risk Factors and Clinical Impact. Antimicrob. Agents Chemother. 2006, 50, 43–48. [Google Scholar] [CrossRef] [Green Version]
  9. Obritsch, M.D.; Fish, D.N.; MacLaren, R.; Jung, R. National Surveillance of Antimicrobial Resistance in Pseudomonas aeruginosa Isolates Obtained from Intensive Care Unit Patients from 1993 to 2002. Antimicrob. Agents Chemother. 2004, 48, 4606–4610. [Google Scholar] [CrossRef] [Green Version]
  10. Mavrodi, D.V.; Bonsall, R.F.; Delaney, S.M.; Soule, M.J.; Phillips, G.; Thomashow, L.S. Functional Analysis of Genes for Biosynthesis of Pyocyanin and Phenazine-1-Carboxamide from Pseudomonas aeruginosa PAO1. J. Bacteriol. 2001, 183, 6454–6465. [Google Scholar] [CrossRef] [Green Version]
  11. Hall, S.; McDermott, C.; Anoopkumar-Dukie, S.; McFarland, A.J.; Forbes, A.; Perkins, A.V.; Davey, A.K.; Chess-Williams, R.; Kiefel, M.J.; Arora, D.; et al. Cellular Effects of Pyocyanin, a Secreted Virulence Factor of Pseudomonas aeruginosa. Toxins 2016, 8, 236. [Google Scholar] [CrossRef]
  12. Denning, G.M.; Railsback, M.A.; Rasmussen, G.T.; Cox, C.D.; Britigan, B.E. Pseudomonas pyocyanine alters calcium signaling in human airway epithelial cells. Am. J. Physiol. 1998, 274, L893–L900. [Google Scholar] [CrossRef]
  13. O’Malley, Y.Q.; Reszka, K.J.; Rasmussen, G.T.; Abdalla, M.Y.; Denning, G.M.; Britigan, B.E. The Pseudomonas secretory product pyocyanin inhibits catalase activity in human lung epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 2003, 285, L1077–L1086. [Google Scholar] [CrossRef] [Green Version]
  14. Ran, H.; Hassett, D.J.; Lau, G.W. Human targets of Pseudomonas aeruginosa pyocyanin. Proc. Natl. Acad. Sci. USA 2003, 100, 14315–14320. [Google Scholar] [CrossRef] [Green Version]
  15. Mahajan-Miklos, S.; Tan, M.-W.; Rahme, L.G.; Ausubel, F.M. Molecular Mechanisms of Bacterial Virulence Elucidated Using a Pseudomonas aeruginosa—Caenorhabditis elegans Pathogenesis Model. Cell 1999, 96, 47–56. [Google Scholar] [CrossRef] [Green Version]
  16. Lau, G.W.; Goumnerov, B.C.; Walendziewicz, C.L.; Hewitson, J.; Xiao, W.; Mahajan-Miklos, S.; Tompkins, R.G.; Perkins, L.A.; Rahme, L.G. The Drosophila melanogaster Toll Pathway Participates in Resistance to Infection by the Gram-Negative Human Pathogen Pseudomonas aeruginosa. Infect. Immun. 2003, 71, 4059–4066. [Google Scholar] [CrossRef] [Green Version]
  17. Lau, G.W.; Ran, H.; Kong, F.; Hassett, D.J.; Mavrodi, D. Pseudomonas aeruginosa Pyocyanin Is Critical for Lung Infection in Mice. Infect. Immun. 2004, 72, 4275–4278. [Google Scholar] [CrossRef] [Green Version]
  18. Cao, H.; Krishnan, G.; Goumnerov, B.; Tsongalis, J.; Tompkins, R.; Rahme, L.G. A quorum sensing-associated virulence gene of Pseudomonas aeruginosa encodes a LysR-like transcription regulator with a unique self-regulatory mechanism. Proc. Natl. Acad. Sci. USA 2001, 98, 14613–14618. [Google Scholar]
  19. Niwa, T. Role of Indoxyl Sulfate in the Progression of Chronic Kidney Disease and Cardiovascular Disease: Experimental and Clinical Effects of Oral Sorbent AST-120. Ther. Apher. Dial. 2011, 15, 120–124. [Google Scholar] [CrossRef]
  20. Hirakawa, H.; Uchida, M.; Kurabayashi, K.; Nishijima, F.; Takita, A.; Tomita, H. In vitro activity of AST-120 that suppresses indole signaling in Escherichia coli, which attenuates drug tolerance and virulence. PLoS ONE 2020, 15, e0232461. [Google Scholar]
  21. Costa, K.C.; Bergkessel, M.; Saunders, S.; Korlach, J.; Newman, D.K. Enzymatic Degradation of Phenazines Can Generate Energy and Protect Sensitive Organisms from Toxicity. mBio 2015, 6, e01520-15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Schuster, M.; Lostroh, C.P.; Ogi, T.; Greenberg, E.P. Identification, Timing, and Signal Specificity of Pseudomonas aeruginosa Quorum-Controlled Genes: A Transcriptome Analysis. J. Bacteriol. 2003, 185, 2066–2079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Bertrand, X.; Thouverez, M.; Talon, D.; Boillot, A.; Capellier, G.; Floriot, C.; Hélias, J.P. Endemicity, molecular diversity and colonisation routes of Pseudomonas aeruginosa in intensive care units. Intensive Care Med. 2001, 27, 1263–1268. [Google Scholar] [CrossRef] [PubMed]
  24. Voggu, L.; Schlag, S.; Biswas, R.; Rosenstein, R.; Rausch, C.; Götz, F. Microevolution of Cytochrome bd Oxidase in Staphylococci and Its Implication in Resistance to Respiratory Toxins Released by Pseudomonas. J. Bacteriol. 2006, 188, 8079–8086. [Google Scholar] [CrossRef] [Green Version]
  25. Christofi, T.; Panayidou, S.; Dieronitou, I.; Michael, C.; Apidianakis, Y. Metabolic output defines Escherichia coli as a health-promoting microbe against intestinal Pseudomonas aeruginosa. Sci. Rep. 2019, 9, 1–13. [Google Scholar] [CrossRef] [Green Version]
  26. Glasser, N.R.; Kern, S.E.; Newman, D.K. Phenazine redox cycling enhances anaerobic survival in Pseudomonas aeruginosa by facilitating generation of ATP and a proton-motive force. Mol. Microbiol. 2014, 92, 399–412. [Google Scholar]
  27. Wang, Y.; Wilks, J.C.; Danhorn, T.; Ramos, I.; Croal, L.; Newman, D.K. Phenazine-1-Carboxylic Acid Promotes Bacterial Biofilm Development via Ferrous Iron Acquisition. J. Bacteriol. 2011, 193, 3606–3617. [Google Scholar] [CrossRef] [Green Version]
  28. Wilson, R.; Sykes, D.A.; Watson, D.; Rutman, A.; Taylor, G.W.; Cole, P.J. Measurement of Pseudomonas aeruginosa phenazine pigments in sputum and assessment of their contribution to sputum sol toxicity for respiratory epithelium. Infect. Immun. 1988, 56, 2515–2517. [Google Scholar] [CrossRef] [Green Version]
  29. Wood, L.G.; Fitzgerald, D.A.; Lee, A.K.; Garg, M.L. Improved antioxidant and fatty acid status of patients with cystic fibrosis after antioxidant supplementation is linked to improved lung function1–3. Am. J. Clin. Nutr. 2003, 77, 150–159. [Google Scholar] [CrossRef]
  30. Lau, G.W.; Hassett, D.J.; Ran, H.; Kong, F. The role of pyocyanin in Pseudomonas aeruginosa infection. Trends Mol. Med. 2004, 10, 599–606. [Google Scholar] [CrossRef]
  31. Hirakawa, H.; Tomita, H. Interference of bacterial cell-to-cell communication: A new concept of antimicrobial chemotherapy breaks antibiotic resistance. Front. Microbiol. 2013, 4, 114. [Google Scholar] [CrossRef] [Green Version]
  32. Michalopoulos, A.S.; Livaditis, I.G.; Gougoutas, V. The revival of fosfomycin. Int. J. Infect. Dis. 2011, 15, e732–e739. [Google Scholar] [CrossRef] [Green Version]
  33. Montero, M.; Horcajada, J.P.; Sorlí, L.; Alvarez-Lerma, F.; Grau, S.; Riu, M.; Sala, M.; Knobel, H. Effectiveness and safety of colistin for the treatment of multidrug-resistant Pseudomonas aeruginosa infections. Infection 2009, 37, 461–465. [Google Scholar] [CrossRef]
  34. Chyan, Y.J.; Poeggeler, B.; Omar, R.A.; Chain, D.G.; Frangione, B.; Ghiso, J.; Pappolla, M.A. Potent neuroprotective properties against the Alzheimer beta-amyloid by an endogenous melatonin-related indole structure, indole-3-propionic acid. J. Biol. Chem. 1999, 274, 21937–21942. [Google Scholar] [CrossRef] [Green Version]
  35. Venkatesh, M.; Mukherjee, S.; Wang, H.; Li, H.; Sun, K.; Benechet, A.P.; Qiu, Z.; Maher, L.; Redinbo, M.R.; Phillips, R.S.; et al. Symbiotic Bacterial Metabolites Regulate Gastrointestinal Barrier Function via the Xenobiotic Sensor PXR and Toll-like Receptor 4. Immunity 2014, 41, 296–310. [Google Scholar] [CrossRef] [Green Version]
  36. Swimm, A.; Giver, C.R.; DeFilipp, Z.; Rangaraju, S.; Sharma, A.; Antonova, A.U.; Sonowal, R.; Capaldo, C.; Powell, D.; Qayed, M.; et al. Indoles derived from intestinal microbiota act via type I interferon signaling to limit graft-versus-host disease. Blood 2018, 132, 2506–2519. [Google Scholar] [CrossRef] [Green Version]
  37. Asai, M.; Kumakura, S.; Kikuchi, M. Review of the efficacy of AST-120 (KREMEZIN((R))) on renal function in chronic kidney disease patients. Ren. Fail. 2019, 41, 47–56. [Google Scholar] [CrossRef] [Green Version]
  38. Hirakawa, H.; Kurabayashi, K.; Tanimoto, K.; Tomita, H. Oxygen Limitation Enhances the Antimicrobial Activity of Fosfomycin in Pseudomonas aeruginosa Following Overexpression of glpT Which Encodes Glycerol-3-Phosphate/Fosfomycin Symporter. Front. Microbiol. 2018, 9, 1950. [Google Scholar] [CrossRef] [Green Version]
  39. Hoang, T.T.; Karkhoff-Schweizer, R.R.; Kutchma, A.J.; Schweizer, H.P. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: Application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 1998, 212, 77–86. [Google Scholar] [CrossRef]
  40. Essar, D.W.; Eberly, L.; Hadero, A.; Crawford, I.P. Identification and characterization of genes for a second anthranilate synthase in Pseudomonas aeruginosa: Interchangeability of the two anthranilate synthases and evolutionary implications. J. Bacteriol. 1990, 172, 884–900. [Google Scholar] [CrossRef] [Green Version]
Antibiotics 10 00434 g001 550
Figure 1. The pathway of pyocyanin production in P. aeruginosa.
Figure 1. The pathway of pyocyanin production in P. aeruginosa.
Antibiotics 10 00434 g001
Antibiotics 10 00434 g002 550
Figure 2. Adsorption and accumulation of phenazine and pyocyanin. (A) Phenazine level corresponding to the absorbance of 370 nm in supernatant from an aqueous solution containing 200 μM synthetic phenazine after incubation for 2 h with or without AST-120. (B) Pyocyanin level corresponding to the absorbance of 520 nm in supernatant from PAO1 culture after incubation for 2 h with or without AST-120. (C) Pyocyanin accumulation in cultures of PAO1 grown with and without 30 mg AST-120 and phzA1/B1 mutant (designated ∆phzA1/B1). (D) Pyocyanin level corresponding to the absorbance of 520 nm in PAO1 culture grown with or without AST-120. (E) Pyocyanin level corresponding to the absorbance of 520 nm in PAO1 and P. aeruginosa clinical isolates that are resistant to some antimicrobial culture grown with and without 30 mg AST-120. Data plotted are the means from three independent experiments; error bars indicate the standard deviations. Asterisks denote significance for values (p < 0.05) of samples or bacterial cultures in the presence of AST-120 relative to those in the absence of AST-120.
Figure 2. Adsorption and accumulation of phenazine and pyocyanin. (A) Phenazine level corresponding to the absorbance of 370 nm in supernatant from an aqueous solution containing 200 μM synthetic phenazine after incubation for 2 h with or without AST-120. (B) Pyocyanin level corresponding to the absorbance of 520 nm in supernatant from PAO1 culture after incubation for 2 h with or without AST-120. (C) Pyocyanin accumulation in cultures of PAO1 grown with and without 30 mg AST-120 and phzA1/B1 mutant (designated ∆phzA1/B1). (D) Pyocyanin level corresponding to the absorbance of 520 nm in PAO1 culture grown with or without AST-120. (E) Pyocyanin level corresponding to the absorbance of 520 nm in PAO1 and P. aeruginosa clinical isolates that are resistant to some antimicrobial culture grown with and without 30 mg AST-120. Data plotted are the means from three independent experiments; error bars indicate the standard deviations. Asterisks denote significance for values (p < 0.05) of samples or bacterial cultures in the presence of AST-120 relative to those in the absence of AST-120.
Antibiotics 10 00434 g002
Antibiotics 10 00434 g003 550
Figure 3. Activities of LasI-LasR and RhlI-RhlR quorum sensing. β-Galactosidase activities of PAO1 containing pBBRlasI (PAO1)-P or pBBRrhlA (PAO1)-P, the lacZ reporter plasmid grown with or without 30 mg AST-120, were measured to determine promoter levels of lasI and rhlI genes regulated by the LasI-LasR and RhlI-RhlR systems. Data plotted are the means from three independent experiments; error bars indicate the standard deviations. Asterisks denote significance for values (p < 0.05) of promoter activities in PAO1 grown with AST-120 relative to those in PAO1 grown without AST-120.
Figure 3. Activities of LasI-LasR and RhlI-RhlR quorum sensing. β-Galactosidase activities of PAO1 containing pBBRlasI (PAO1)-P or pBBRrhlA (PAO1)-P, the lacZ reporter plasmid grown with or without 30 mg AST-120, were measured to determine promoter levels of lasI and rhlI genes regulated by the LasI-LasR and RhlI-RhlR systems. Data plotted are the means from three independent experiments; error bars indicate the standard deviations. Asterisks denote significance for values (p < 0.05) of promoter activities in PAO1 grown with AST-120 relative to those in PAO1 grown without AST-120.
Antibiotics 10 00434 g003
Antibiotics 10 00434 g004 550
Figure 4. Cytotoxicity of supernatants from PAO1 parent and its phzA1/B1 mutant strains and drug-resistant clinical isolates. (A) Survival of A-549 cells after incubation with or without culture supernatants from indicated P. aeruginosa strains cultured in the presence or absence of 30 mg AST-120. (B) Survival of Caco-2 cells after incubation with or without culture supernatants from indicated P. aeruginosa strains cultured in the presence or absence of 30 mg AST-120. (C) Survival of Caco-2 cells after incubation with or without culture supernatants from PAO1 and its phzA1/B1 mutant (∆phzA1/B1), the phenazines non-producer, cultured in the presence or absence of 30 mg AST-120. (D) Survival of Caco-2 cells after incubation with or without culture supernatants from PAO1 cultured in indicated amounts of AST-120. The survival rates are presented as the percentage of the RLU value for the cells after incubation with each supernatant relative to that after incubation without supernatant. Data plotted are the means of two biological replicates, error bars indicate the ranges. We repeated experiments twice, then obtained similar results.
Figure 4. Cytotoxicity of supernatants from PAO1 parent and its phzA1/B1 mutant strains and drug-resistant clinical isolates. (A) Survival of A-549 cells after incubation with or without culture supernatants from indicated P. aeruginosa strains cultured in the presence or absence of 30 mg AST-120. (B) Survival of Caco-2 cells after incubation with or without culture supernatants from indicated P. aeruginosa strains cultured in the presence or absence of 30 mg AST-120. (C) Survival of Caco-2 cells after incubation with or without culture supernatants from PAO1 and its phzA1/B1 mutant (∆phzA1/B1), the phenazines non-producer, cultured in the presence or absence of 30 mg AST-120. (D) Survival of Caco-2 cells after incubation with or without culture supernatants from PAO1 cultured in indicated amounts of AST-120. The survival rates are presented as the percentage of the RLU value for the cells after incubation with each supernatant relative to that after incubation without supernatant. Data plotted are the means of two biological replicates, error bars indicate the ranges. We repeated experiments twice, then obtained similar results.
Antibiotics 10 00434 g004
Antibiotics 10 00434 g005 550
Figure 5. Growth of the PAO1 strain when cultured with or without indicated drugs in the presence and absence of AST-120. Bacteria were grown in LB medium in the presence and absence of 30 mg of AST-120 without drug (A) or together with fosfomycin (B), colistin (C) or amikacin (D). The bacterial growth was monitored by measuring OD600.
Figure 5. Growth of the PAO1 strain when cultured with or without indicated drugs in the presence and absence of AST-120. Bacteria were grown in LB medium in the presence and absence of 30 mg of AST-120 without drug (A) or together with fosfomycin (B), colistin (C) or amikacin (D). The bacterial growth was monitored by measuring OD600.
Antibiotics 10 00434 g005
Table
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimerDNA Sequence (5′–3′)Use
phzA1B1-delta1
phzA1B1-delta2
phzA1B1-delta3
phzA1B1-delta4
lasI-PF		gcgggatccctacaacctccggcattgc
cttccaggatggcctcaggtgggaccgttcatgcgccgcctc
ctcggaggcggcgcatgaacggtcccacctgaggccatcctg
gcgaagcttcggcgctgttcggcatggg
gcgatgcattcttgcctctcaggtcggc		phzA1 and phzB1 deletion construction
phzA1 and phzB1 deletion construction
phzA1 and phzB1 deletion construction
phzA1 and phzB1 deletion construction
pBBRlasI (PAO1)-P construction
lasI-PR
rhlA-PF		gcgggtacccttcacttcctccaaatagg
gcgatgcatcgccagagcgtttcgacac		pBBRlasI (PAO1)-P construction
pBBRrhlA (PAO1)-P construction
rhlA-PRgcgggtaccttcacacctcccaaaaattttcgpBBRrhlA (PAO1)-P construction
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Hirakawa, H.; Takita, A.; Uchida, M.; Kaneko, Y.; Kakishima, Y.; Tanimoto, K.; Kamitani, W.; Tomita, H. Adsorption of Phenazines Produced by Pseudomonas aeruginosa Using AST-120 Decreases Pyocyanin-Associated Cytotoxicity. Antibiotics 2021, 10, 434. https://doi.org/10.3390/antibiotics10040434

AMA Style

Hirakawa H, Takita A, Uchida M, Kaneko Y, Kakishima Y, Tanimoto K, Kamitani W, Tomita H. Adsorption of Phenazines Produced by Pseudomonas aeruginosa Using AST-120 Decreases Pyocyanin-Associated Cytotoxicity. Antibiotics. 2021; 10(4):434. https://doi.org/10.3390/antibiotics10040434

Chicago/Turabian Style

Hirakawa, Hidetada, Ayako Takita, Motoyuki Uchida, Yuka Kaneko, Yuto Kakishima, Koichi Tanimoto, Wataru Kamitani, and Haruyoshi Tomita. 2021. "Adsorption of Phenazines Produced by Pseudomonas aeruginosa Using AST-120 Decreases Pyocyanin-Associated Cytotoxicity" Antibiotics 10, no. 4: 434. https://doi.org/10.3390/antibiotics10040434

APA Style

Hirakawa, H., Takita, A., Uchida, M., Kaneko, Y., Kakishima, Y., Tanimoto, K., Kamitani, W., & Tomita, H. (2021). Adsorption of Phenazines Produced by Pseudomonas aeruginosa Using AST-120 Decreases Pyocyanin-Associated Cytotoxicity. Antibiotics, 10(4), 434. https://doi.org/10.3390/antibiotics10040434

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop