Next Article in Journal
Gradients of Variation in the At-Vessel Mortality Rate between Twelve Species of Sharks and Skates Sampled through a Fishery-Independent Trawl Survey in the Asinara Gulf (NW Mediterranean Sea)
Previous Article in Journal
Thermal Profiles of Chainsaw Hollows and Natural Hollows during Extreme Heat Events
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 12
Issue 3
10.3390/biology12030362
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Variation versus Morphological Variability in European Peatland Violets (Viola epipsila—V. palustris Group)

by
Justyna Żabicka
1,*,
Tom Kirschey
2,
Grzegorz Migdałek
3,
Aneta Słomka
1 and
Elżbieta Kuta
1
1
Department of Plant Cytology and Embryology, Institute of Botany, Faculty of Biology, Jagiellonian University in Kraków, 9 Gronostajowa St., 30-387 Cracow, Poland
2
International Peatland and Southeast Asia Programme, International Department, The Nature and Biodiversity Conservation Union (NABU), 3 Charitéstrasse, 10117 Berlin, Germany
3
Institute of Biology and Earth Sciences, Pedagogical University of Cracow, 2 Podchorążych St., 30-084 Cracow, Poland
*
Author to whom correspondence should be addressed.
Biology 2023, 12(3), 362; https://doi.org/10.3390/biology12030362
Submission received: 31 January 2023 / Revised: 15 February 2023 / Accepted: 16 February 2023 / Published: 24 February 2023
(This article belongs to the Section Conservation Biology and Biodiversity)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

The wetland violets of Central and Northern Europe (Viola epipsila Ledeb., V. palustris L.) are endangered because the ranges of both species are drastically decreased due to global climatic changes. Their disappearance might also be the result of the formation of interspecific hybrids which can replace the parent species. The study of such species is particularly important because they might be considered as indicators of anthropogenic changes occurring in peatlands and their disappearances. The taxonomic situation of studied species is intricate, and the presence of interspecific hybrids and putative introgressants [V. pubifolia (Kuta) G. H. Loos (=V. palustris subsp. pubifolia Kuta)] makes it even more complicated. The main goal of our study was to reconstruct the origin of V. pubifolia and its genetic relatedness to both putative parental species—V. palustris and V. epipsila—using advanced molecular methods. The taxonomic problem has been finally solved. We found no basis to separate V. pubifolia as a species in its own right because its morphological characters as well as genetic variation fall well within the range of variability of V. palustris. We have also concluded that the low genetic differentiation and heterozygosity of V. epipsila in Europe might be a cause of the reduced tolerance of this species to changing environmental conditions and can possibly lead to its extinction.

Abstract

In Europe, the V. epipsila—V. palustris group comprises V. epipsila Ledeb., V. palustris L., V. pubifolia (Kuta) G. H. Loos (=V. palustris subsp. pubifolia Kuta), interspecific hybrids, and putative introgressants. The genetic affinity of V. pubifolia to V. palustris, and their shared origin via hybridization followed by polyploidization, were confirmed using inter simple sequence repeat (ISSR) markers, restriction site-associated DNA sequencing (RAD-Seq), and a low-copy nuclear gene, GPI, which encodes glucose-6-phosphate isomerase. The other taxa of subsect. Stolonosae were not identified as putative parents of V. pubifolia by GPI. Our analyses indicated that V. pubifolia can be included in the morphological and genetic variation of V. palustris. The ISSR, RAD-Seq, and genome size value separated well V. palustris from V. epipsila and hybrids. The results also reopen the discussion on intraspecific variation in the context of taxa ranks and species concepts. The reduced tolerance of V. epipsila in Europe to changing environmental conditions might result from low genetic differentiation and heterozygosity, as well as the increased number of interspecific hybrids (V. epipsila × V. palustris), and eventually can possibly lead to its extinction. The disappearance of populations/individuals of this species may indicate anthropogenic changes occurring in peatlands.

1. Introduction

Viola L. is one of the largest angiosperm genera, comprising ca. 658 recognized species; it consists of two sub-genera, 31 sections, and 20 subsections. It is distributed mainly in the temperate zones of both hemispheres and it occupies a high diversity of habitats and elevations [1]. The taxonomy of the genus is complicated due to interspecific hybridization commonly occurring between closely related species of the same section, especially in disturbed or transitional habitats, and polyploidization, which plays a key role in its evolution. Both processes have enhanced the population genetic variation, leading to intraspecific variability and speciation [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21].
European peatland violets form a taxonomically intricate group comprising the tetraploid V. epipsila Ledeb. (2n = 4x = 24), the octoploids V. palustris L. and V. pubifolia (Kuta) G. H. Loos (=V. palustris subsp. pubifolia Kuta; 2n = 8x = 48), the interspecific hexaploid (2n = 6x = 36) F1 hybrids (V. ruprechtiana Borb., syn. V. fennica F. Nyl.), and putative introgressive forms ([1] and references therein, [8,9,10,17,22]). These taxa belong to the subsect. Stolonosae Kupffer of the sect. Plagiostigma Godr., the oldest (crown node of 16.6 Ma) and the most species-rich (139) of all allopolyploid Viola sections [1]. The subsect. Stolonosae (crown node age c. 12.7 Ma) with 39 allopolyploid species (4x, 8x) has mainly a north-temperate distribution. The delimitation of this subsection is based on the occurrence of allopolyploids between distantly related internal lineages, one of which supposed to be V. palustris, the type of the subsection. Several allo-octoploids with boreal distributions are young taxa dated on 2.5–5 Ma, suggesting their origin is in response to the climate cooling and repeated glaciations in the Pleistocene [1].
Viola epipsila is a circumboreal species ranging from western Siberia to northwestern North America with scattered locations in Northern European countries (Norway, Finland, Iceland) [1,22,23,24,25,26,27,28]. Viola palustris is an amphi-Atlantic species and is distributed as far east as the Ural Mountains. The intraspecific ranks of species and new species delimitations in the subsect. Stolonosae are disputable and discussed in the revised phylogenetic classification of the genus Viola [1].
Viola epipsila and V. palustris both occur in wetlands, although V. epipsila prefers rather eutrophic groundwater-influenced fen habitats and is associated with wet alder stands; V. palustris, with a wider ecological tolerance, occurs in peatland vegetation, in wet meadows, and in pastures [10,17,29,30]. The overlapping ranges and flowering of chasmogamous (CH) flowers of these closely related allopolyploids, which share a genome, weakens the isolation barriers, creating suitable conditions for interspecific hybridization, and leading to the genetic diversity of the complex [1,9,10,11,30]. The wetland areas have drastically decreased because of the combined effect of climate change and drainage. As a consequence, the habitats of both species are disappearing and their ranges, especially that of V. epipsila, are declining in Central Europe [30]. These species may be considered as indicators of the state of the peatlands they occupy; the decreasing numbers of individuals or the disappearance of whole subpopulations of both species indicate a large-scale change in the wetland and peatland habitats. In sympatric European populations of both species, previous studies have identified interspecific hexaploid (2n = 6x = 36) F1 hybrids, putative introgressive forms, and the hybrid species V. pubifolia (Kuta) G.H. Loos [8,9,10,11,30,31]. Vigorous interspecific hybrids may be replacing pure individuals of V. epipsila in European populations because they may have adaptations which help them survive in a changing environment [1,9,10,30,31,32,33,34]. Hybrids with intermediate characters between parental species may be erroneously described as V. epipsila, as was confirmed by a critical revision of Polish and European herbarium specimens [10]. A similar difficulty concerns the designation of V. pubifolia individuals differing in some morphological features from V. palustris (e.g., scattered hairs on the lower leaf surface, location of bracts in the middle of the pedicel, leaf shape, flower size), described for the first time in Słowiński National Park [10] (Figure 1A–D). Based on the morphological and cytological (2n = 8x = 48) features and the reproduction system (fully fertile) [8,9], these forms were distinguished as a subspecies of V. palustris (V. palustris L. subsp. pubifolia Kuta) [10] and later named as V. pubifolia (Kuta) G. H. Loos [31]. Plants with some features of V. pubifolia have been identified from other localities in Poland and Germany. In some populations, they occur sympatrically with typical V. palustris [10]. Currently, V. pubifolia is easy to find in Słowiński National Park, where it grows in very wet, periodically flooded areas (Figure 1E–G), which are often associated with clumps of sedges and grasses (Figure 1F) or close to trees (Figure 1G), but also in less humid places (Figure 1H–K), close to rotten tree trunks (Figure 1J), and even growing on tree trunks partly covered in moss (Figure 1K). In Słowiński National Park, V. pubifolia is found in several vegetation assemblages that have been classified according to the GEST approach, linked to water table and greenhouse gas emissions before and after peatland restoration measures [35].
The origin and genetic relatedness of V. pubifolia to both putative parental species has never been confirmed with the use of molecular markers. As the taxonomic position of this taxon is still questionable, the present research focused on (1) evaluating the genetic diversity of V. pubifolia and its genetic affinity to V. palustris from Central and Northern Europe, using inter simple sequence repeat (ISSR) markers and next-generation sequencing technology (restriction site-associated DNA sequencing, RAD-Seq); (2) reconstructing the origin of V. pubifolia with the use of a low-copy nuclear gene, GPI, which encodes glucose-6-phosphate isomerase; and (3) establishing the relationship of V. pubifolia with closely related violets of subsect. Stolonosae.

2. Materials and Methods

2.1. Plant Material Collection

The plant material originated from 12 sites from 4 countries (Germany, Lithuania, Norway, Poland) in Central and Northern Europe (Table S1, Figure 2). For all sampling, legal permits by the authorities had been obtained. Viola pubifolia plants were randomly collected in the “Mierzeja” nature reserve (a dune forest strict reserve) in the Słowiński National Park (SNP), Poland. Plants of V. palustris, V. epipsila, interspecific hybrids (V. epipsila × V. palustris), and samples defined as an introgressive form towards V. palustris were also included in the molecular analysis. The sample identification was based on different criteria: pre-selected morphological features but also ISSR markers, pollen viability, genome size value, especially important in F1 hybrid, and introgressant identification (Table S1) [10,30]. Randomly selected plants of V. pubifolia and V. palustris were gathered in natural populations and transferred to the experimental garden condition (located in Cracow, Ugorek district; 50.078320; 19.986784) for observation and further investigation.
For molecular analysis, two to three healthy and fully developed leaves per plant of V. pubifolia and V. palustris were harvested randomly from plants growing in natural sites. Thirty samples of V. pubifolia and one sample of V. palustris were taken from plants located in the experimental garden (Table S1, Figure 2). The distance of a minimum ca. 4 m between the individuals growing in nature was kept to avoid clonality. The leaves were stored in sterile tubes (F.L. MEDICAL, Torreglia, Italy) filled with silica gel (F.H.U. “DOR-CHEM”, Kraków, Poland) at room temperature not exceeding 25°C. The DNA of six V. palustris (BAL_7, BAL_9, BAL_10, L_18, L_19, L_20), three V. epipsila (SZ_4, SZ_6, SZ_7), three hybrids (OST_1, OST_3, OST_5), and three V. pubifolia (N_B!2, N_B!3, N_B!5) samples were used from the previous research [30] (Table S1). Plants growing in nature reserves, national parks, and law-protected V. epipsila were collected with permission in accordance with the relevant institutions. The voucher specimens were deposited in the Herbarium of the Institute of Botany of the Jagiellonian University in Kraków, Poland (KRA, accession numbers: 0552067-0552072, 602281-602286).

2.2. Genome Size Assessment

In total, 2 to 3 fresh leaves per plant of 39 V. pubifolia samples were harvested and their nuclear DNA content was estimated using flow cytometry (FC). Genome size analyses were performed based on previously the described protocols ([30] and references therein). The genome size values of V. palustris, V. epipsila, and hybrids (V. epipsila × V. palustris) added to Table S2 were taken from Żabicka et al. [30].

2.3. DNA Extraction

DNA extractions from silica dried leaves, as well as quality assessments, were conducted following the protocol of Żabicka et al. [30]. In total, 121 samples of DNA were isolated and different number of samples were used for ISSR (83 samples), GPI analysis (one sample), RAD-Seq (21 samples), and genome size assessment (39 samples).

2.4. Morphological Features of V. epipsila—V. palustris Group

Based on different floras, published papers, and authors’ observations, the morphological characteristics of V. epipsila, V. palustris, interspecific hybrids (V. epipsila × V. palutris), and V. pubifolia were compiled (Table S3).

2.5. ISSR Analysis

Ten primers of ISSR markers were chosen based on amplification effectiveness and the number of polymorphic products [36,37] (Table S4). For the ISSR analysis, 83 samples were included in total: 62 samples of V. pubifolia; 15 samples of V. palustris; 3 samples of V. epipsila; 3 samples of hybrids (V. epipsila × V. palustris). To balance the sample size, two types of analysis were performed: (A) V. pubifolia from SNP (the number of samples was reduced to 20), V. palustris from different populations (Balinka, Poland; Floß, Grillenburg, Oberlausitz, Germany; Pravalas Botanical Reserve, Lithuania; Barmøya, Norway), V. epipsila (Szczupliny, Poland), and hybrids V. epipsila × V. palustris (Ostrów Tarczyński Nature Reserve, Poland); (B) 62 samples of V. pubifolia from SNP. PCRs and electrophoresis on agarose gel, band patterns observation, and capturing were conducted using chemicals, protocols, laboratory equipment, and software described in Żabicka et al. [30]. The annealing temperature was tested and depended on the primer (Table S4).
POPGENE v. 1.32 [38] and FAMD v. 1.31 [39] were used to analyze ISSR polymorphism and genetic diversity. A split phylogenetic network (NeighborNet) in SplitsTree v. 4.6 [40] based on the Dice coefficient was constructed to evaluate the relationships between V. pubifolia and other studied individuals, species, and populations (A), and also to examine the diversity of V. pubifolia populations (B). A bootstrap was calculated on 2000 replicates. The STRUCTURE analysis [41] assumed an admixture between populations, and correlated allele frequencies between the clusters. In total, 5 independent runs were performed for each K value (1–5) with burn-in of 105 and 106 Markov chain Monte Carlo replicates after burn-in. The optimal K value was chosen based on the mean logarithmic likelihood of K values and ΔK values [42], calculated using Structure Harvester v. 0.6.94 [43]. The clustering results were summed up in CLUMPAK [44] with LargeKGreedy search method and 2000 random input order repeats. To evaluate statistical significance of clustering, a hierarchical analysis of molecular variance (AMOVA) was performed on groups suggested by STRUCTURE using Arlequin v. 3.5.2.2 [45].

2.6. A Low-Copy Nuclear Gene GPI Analysis

To discover the phylogeny of V. pubifolia and its relations with V. palustris and other species from Plagiostogma section, highly conserved GPI gene was sequenced according to the previous studies on reconstructing reticulate phylogeny of allopolyploid violets [18] and to discriminate a new species [46].
The sequences of two homoeologs of GPI (CHAM—GPI-C, MELVIO—GPI-M) of V. pubifolia were obtained in two steps: (1) PCR amplification reactions with pairs of primers; sequencing of PCR product with the use of primers covering exon12–exon16 or exon13–exon18 of the GPI locus. The PCR and sequencing primers, composition of reaction mixture, and PCR program were taken from Marcussen et al. [18]. (2) Based on the sequences obtained in step one, we designed sixteen primers specific for two homoeologs according to procedure by Scheen et al. [47] (Table 1) covering exon12–exon16 and exon13–exon17 GPI locus. The amplifications were conducted according to the touchdown PCR program: initial denaturation at 94 °C for 5 min, 26 cycles: denaturation 94 °C, 30 s; annealing temperature starting from 62.5 °C (gradually decreased by 0.5 °C per cycle), 30 s; elongation at 72 °C, 60 s, and then 21 cycles: denaturation at 94 °C, 30 s; annealing temperature at 49 °C, 30 s; elongation at 72 °C, 60 s; final extending at 72 °C, 10 min and subsequent hold at 6 °C. The amplifications in steps 1 and 2 were conducted in Bio-Rad T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA) using Phusion HF buffer, Phusion polymerase, and dNTPs obtained from Thermo Scientific, Waltham, MA, USA. The PCR products were separated in 1% agarose gel with 1× TBE and SimplySafe (EURx Sp. z o.o., Gdańsk, Poland) for about 90 min at 120 V. Bands were observed and captured with a MultiDoc-It imaging system with VisionWorks® LS Analysis Software (UVP, Upland, CA, USA).
For the sequencing of a GPI, we have chosen only the samples which gave the best quality PCR products (Table S1). The sequencing was performed by Genomed SA, Warsaw, Poland. The sequences were manually checked for quality using BioEdit v. 7.2 [48], assembled into contigs using CAP [49], and aligned in MUSCLE [50]. The sequences of two homoeologs of GPI (GPI-C, GPI-M) of V. palustris, V. epipsila, V. pluviae, V. blanda, V. primulifolia, V. jalapaensis, V. lanceolata, V. minuscula [=V. pallens auct., non (Banks) Brainerd)], V. occidentalis, V. macloskeyi, V. renifolia, V. principis, V. vaginata, V. selkirkii, V. mirabilis, V. rubella, V. pusilla, and V. congesta were taken from GenBank accessions [18].
Phylogenetic inference was performed in MrBayes v. 3.2.6 [51]. Data were partitioned into GPI nucleotide sequences and indels and coded with a simple coding method [52] in SeqState v. 1.4.1 [53]. The HKY model was chosen based on the results of BIC calculation in jMODELTEST v. 2.1.10 [54]. The indels were treated as restriction data with variable coding. In total, 2 runs were performed (4 chains total) with 3 million MCMC generations, to ensure the analysis reached convergence, and 25% trees were discarded as burn-in. The final trees were visualized in FigTree v. 1.4.3 [55].

2.7. RAD Sequencing and Bioinformatics Analysis

In total, 21 selected samples of DNA (Table S1) were normalized to 10 ng/μL and submitted to Floragenex, Inc. (Eugene, OR, USA). RAD-Seq was performed according to the protocol by Baird et al. [56], with a single digestion of total DNA with SbfI restriction endonuclease enzyme. After digestion, the samples were heat-inactivated for 20 min at 80°C, followed by the addition of modified Solexa© adapters (Illumina, Inc., San Diego, CA, USA). The samples with ligated adapters were purified and amplified with 50 μL 2× Phusion Master Mix (NEB, Ipswich, MA, USA), 5 μL of 10 μM modified Solexa© Amplification primer mix (Illumina, Inc., San Diego, CA, USA) and up to 45 μL H2O. The library was quantified with a Qubit fluorometer and run on an Agilent Bioanalyzer with the High Sensitivity kit to determine the size distribution, which was 505 bp. Furthermore, 1 × 150 bp single-end sequencing was performed on the HighSeq 3000 at the Oregon State University Center for Quantitative Life Sciences.
Genotyping and SNP calling was performed in STACKS v. 1.44 [57]. Reads pre-processing and quality filtering was performed in the process_radtags module in STACKS with the default parameters. Loci assembly was conducted using denovo_map pipeline with the minimum number of matching raw reads set to 10 [58]. The maximum number of nucleotide mismatches within and between individuals was determined by testing for asymptotic distribution [59] and was set to 6. The loci present in at least 70% of the individuals were extracted using the populations program along with parametric data. An individual-level pairwise genetic distance matrix was generated and visualized in R v. 4.0.5, based on Peakall-Smouse coefficient, calculated using PopGenReport [60]. Additionally, we calculated the SNP-based pairwise Fst at the species level in the populations program. To evaluate the degree of shared ancestry between V. pubifolia, hybrids, and parental species, we performed an analysis based on a model of the nearest neighbor coancestry implemented in fineRADstructure [61]. The output data from Stacks de novo pipeline was reformatted for RADpainter using the Stacks2fineRAD.py script [61], allowing for a maximum of 10 SNPs per locus and 30% of the missing loci to be included in the analysis. To generate a coancestry matrix in RADpainter, we assumed an 8N ploidy for the studied species. A fineSTRUCTURE MCMC analysis was run with 100,000 burn-in and 1,000,000 sample iterations keeping every 1000th sample. The tree was built from the minimum state with burn-in set to 10,000. We developed a custom R script for the counting of common haplotypes between selected samples, based on the populations program output. Consensus haplotypes were filtered out and the remaining haplotypes intersected between V. epipsila, V. palustris, V. pubifolia, and hybrid samples.

3. Results

3.1. Genome Size and Genetic Differentiation of V. pubifolia vs. V. palustris

The genome size estimate for V. pubifolia was equal to 4.14 pg and thus was similar to the estimate obtained for V. palustris (4.26 pg). Viola epipsila had a smaller genome (2.52 pg) than V. palustris, confirming octoploid and tetraploid ploidy of the two closely related species, respectively. The genome size (3.42 pg) of the interspecific hybrid (V. epipsila × V. palustris) was intermediate between the parental species but differed significantly from the genome of V. pubifolia (Table S2).
The ISSR analysis of the selected 20 V. pubifolia specimens from SPN, 15 plants of V. palustris from different regions, 3 samples of V. epipsila × V. palustris hybrids, and 3 samples of V. epipsila resulted in 201 resolved bands. The analysis of 62 specimens from SPN resulted in 143 resolved bands. The number of polymorphic bands was higher in the group of all V. palustris (54 bands—26.87%) than in the remaining samples of V. pubifolia. Nei’s gene diversity (Hj) was higher for V. palustris (0.09) than for V. pubifolia (0.05). The total gene diversity (HT) reached 0.09 and the mean gene diversity (HS) within populations was slightly lower (0.07). The highest gene diversity (GST) was between the populations (0.21) (Table 2A). The group containing only V. pubifolia samples had 30.85% polymorphic bands and Nei’s gene diversity of Hj = 0.06 (Table 2B).
Based on NeighborNet analysis performed on the Dice coefficient genetic distance matrix, the V. epipsila, V. palustris, V. pubifolia, and hybrid (V. epipsila × V. palustris) samples formed three groups. The first group corresponded with V. palustris and V. pubifolia, the second with V. epipsila, and the third with the hybrid (V. epipsila × V. palustris). The split separating V. epipsila (BS 100) and both V. palustris and V. pubifolia (BS 99) showed high bootstrap values (BSs). The samples from different populations within groups were also separated by strongly supported splits (Figure 3A). NeighborNet analysis of 62 V. pubifolia samples resulted in weak differentiation within the group; only two small groups of the samples were separated and the distance between them and other samples was very low (Figure 3B).
STRUCTURE Bayesian analysis assumed there were three groups in all studied taxa, K = 3 (ΔK = 79.75; Figure S1). The first group contained all samples of V. pubifolia (SPN, N_B!) and V. palustris (N_E, NO, L, BAL). Viola epipsila (SZ) and V. epipsila × V. palustris hybrid (OST) formed two separate groups (Figure 4).

3.2. RAD-Seq Analysis Confirmed the Genetic Similarity of V. pubifolia and V. palustris

RAD sequencing yielded a total of 9.36 × 106 reads per sample (SD 4.43 × 106). The average sequencing coverage per individual was 1800.3×. After STACKS denovo analysis and filtering, 1109 loci were retained, including 689 SNPs. Missing data were present in 13 samples and its proportion did not exceed 30%. Heterozygosity (Ho) of hybrid was the highest (0.72), of European V. epipsila was the lowest (0.02), and V. pubifolia (0.48) and V. palustris (0.46) represented relatively high heterozygosity levels. The mean inbreeding coefficient of an individual relative to the subpopulation was positive only for V. epipsila (0.02; Table 3). The highest genetic distance (Fst) was between V. epipsila and V. palustris or V. pubifolia; the lowest was between V. palustris and V. pubifolia (Table 4).
The heatmap based on the pairwise Peakall-Smouse genetic distance clearly indicated low genetic distance between V. pubifolia and V. palustris (Figure 5). FineRADstructure results revealed two distinct groups, corresponding to V. epipsila and V. palustris, with average coancestry within groups of 105.0 and 39.7, respectively. Hybrid samples were more similar to the V. epipsila group (coancestry coefficient = 58.5) than V. palustris (coancestry coefficient = 30.3) (Figure 6).

3.3. Common Haplotypes of Studied Taxa

RAD-Seq analysis showed the mean number of shared haplotypes between the studied taxa: 93.00 for V. epipsila and hybrids; 48.00 for V. palustris and V. epipsila; 87.83 for V. pubifolia and V. epipsila.
More detailed analysis of the common haplotype number of V. pubifolia with other taxa, taking into account the origin of individual samples, indicated that the mean number of common haplotypes of V. pubifolia and V. epipsila was similar for Polish and Lithuanian specimens (113.54, 116.08 and 118.46). The differences in the mean common haplotype numbers between V. pubifolia and V. palustris were related to the origin of the material—514.46 with samples from Germany and 577.54 from Lithuania (Table 5).

3.4. GPI Homoeologs of V. pubifolia

The analysis of highly conserved GPI showed that V. pubifolia has two of the same homoeologs as V. palustris: (Figure 7). The first homoeolog is shared with V. epipsila subsp. epipsila (Cepi, Mepi), and second with V. minuscula (=V. pallens; Cpal, Mpal; Figure 8).

3.5. Phenotypic Plasticity of V. palustris vs. V. pubifolia Variability

Based on the literature and on the authors’ observation, the intraspecific morphological variability of V. palustris has been expressed by describing the subspecies, varietas, and forms [11,17,18,23,24,25,26,27,46,63]. The characteristics of V. palustris from the data in the Table S3 show the range of variability of qualitative and quantitative features of vegetative and generative organs. For leaves, the features include length/width ratio: 0.54–1.17; predominate forms with glabrous lower surface, but also specimens with hairy leaf lower surface (varying in hair number); shape of apex mostly obtuse, but also leaves with an acute or subacute apex; type of margin: crenate; petiole glabrous or sometimes slightly hairy. For flowers, the features include length of CH sepals with calycine appendages: 3.5–7.0 mm; length of CH spur: 0.5–1.5 mm; length of CH lower petal with spur: 8–14 mm; mostly hairy lateral petals but flowers with glabrous lateral petals also found; ratio of distance of bracts from rhizome to length of pedicel: 0.20–0.60, bracts located mostly in the lower half of pedicel but sometimes also in the middle of the pedicel or slightly above; pedicels of CH flowers glabrous or sometimes with scattered hairs; chromosome number/ploidy: 48/8x. Fruits (capsules) are filled with seeds (fully fertile), pollen is viable (Table S3).
The morphological characteristics of V. pubifolia can be included in V. palustris variability (Table S3).

4. Discussion

Based on ISSR, GPI, RAD-Seq, and genome size values, V. pubifolia can be included in the V. palustris genetic variation. The applied molecular techniques resolved the origin of V. pubifolia and reopened the questions of the taxonomical ranks of intraspecific variation and concept of species—are they morphological, molecular, or integrative? In this context, the rank of studied taxon V. pubifolia has to be revised. Neither the morphological nor the genetic intraspecific variation of V. palustris entitles the distinguishing of this variability in the rank of a subspecies (V. palustris subsp. pubifolia) or a species (V. pubifolia). These results are in line with the recent revision of the genus Viola, in which intraspecific taxa (subspecies, varietas) of V. epipsila—V. palustris group were considered as synonyms of these two species and were included into their variability or were delimitated as new species. Referring to the study of the V. epipsila—V. palustris group, phylogenetic studies indicate that a relatively narrow species concept coinciding with morphological geographic units best apply to the taxa of the Stolonosae subsect. of Viola [1].
Rapid advances in the development of DNA techniques have allowed researchers to propose a natural, genealogy-based classification of organisms. The use of molecular data may accelerate the discovery of species. It is recommended to use molecular tools for plant taxonomy, but integrative taxonomy is also important, based on evidence from multiple sources [64,65].

4.1. ISSR Markers and Rad-Seq Subsumed V. pubifolia into Genetic Variation of V. palustris

The genetic diversity of V. pubifolia results from its mixed reproductive system (cross-pollination via CH flowers, selfing via CL flowers, vegetative propagation by stolons) [9]. The low genetic diversity, confirmed in this study by ISSR markers, is a consequence of the predominance of vegetative propagation and selfing, in agreement with suggestions about the factors influencing the loss of intraspecific genetic diversity [66,67,68,69]. A comparison of the two groups showed that the gene diversity of V. palustris was only slightly higher than that of V. pubifolia (Table 2). NeighborNet, as well as structure Bayesian analysis, clearly indicated that all V. pubifolia samples grouped together with V. palustris (Figure 3 and Figure 4).
The previous hypothesis of the origin of V. palustris subsp. pubifolia via introgression [9] was not confirmed by RAD-Seq, showing the genetic similarity of this taxon to V. palustris. Theoretically, backcrosses of F1 hybrids (V. epipsila × V. palustris) to one or both parental species may occur in nature, as the hybrid produces a small percentage of viable pollen [9] (Figure S2).
The deeper insight into genetic population structures offered by RAD-Seq showed higher genetic diversity and heterozygosity in the group containing V. pubifolia and V. palustris than in the European V. epipsila (Table 3 and Table 4), a rare and endangered species in Central Europe and Fennoscandia [10,29,32,33,34,70]. This seems to confirm the hypothesis that the survival of a species in changing environmental conditions potentially declines if genetic diversity and heterozygosity are low [71,72].
The number of common haplotypes of V. pubifolia with V. epipsila indicates that individuals named V. pubifolia should be recognized as V. palustris. The origin of an octoploid V. palustris via hybridization of the two vicariant parental species—European V. epipsila and eastern North American V. minuscula (=V. pallens)—followed by genome multiplication is connected with climate cooling and glaciations (last 5 Ma). This was possibly able to occupy a new empty niche available after the glacier had receded [1,18]. As multiple origins of allopolyploids (polytopy) are a common phenomenon in nature [73], V. palustris may have been created in other regions of Europe, for example, in Lithuania and Germany, based on regional parental species.

4.2. What Does the GPI Gene Add to Our View of the Origin of V. pubifolia

GPI gene has been used successfully to reconstruct species phylogeny and polyploid evolution in the genus Viola L. [1,18,46]. Sequencing two homoeologs of this highly conserved gene from randomly selected samples of V. pubifolia subsumed this taxon into the V. palustris group (Figure 7). The relationship of V. pubifolia with the species of subsect. Stolonosae indicated that its origin was the same as V. palustris with the involvement of V. epipsila subsp. epipsila and V. minuscula (=V. pallens) as parents (Figure 8). Viola pubifolia, as well as V. palustris, shares homoeologs with both parental species.

4.3. Viola palustris—A Highly Morphologically Variable Species

This great morphological variability of V. palustris may have resulted from the hybrid origination of this species [V. epipsila × V. minuscula (=V. pallens)], followed by genome duplication [18]. In sexually reproducing V. palustris [9], new genotypes generated by meiotic recombination may have features predominantly of one species or the other. A more likely explanation is that parental phenotype A, expressed as a polymorphism in the allopolyploid V. palustris, is the result of the knockout or silencing of the B homoeolog. Polyploidization induces genetic and epigenetic processes, including DNA sequence elimination and gene silencing, contributing to the functional diversification or subfunctionalization of duplicated genes, and the genetic and cytological diploidization of allopolyploids. Epigenetic modifications may produce adaptive epimutations and novel phenotypes [74,75,76].
The hairy lower leaf surface and the location of bracts in the middle or even above the middle of the pedicel of V. pubifolia individuals observed at CH or CL blooming can lead to erroneous classification to V. epipsila or hybrid V. epipsila × V. palustris [9,10].
It is recommended to describe and classify specimens in the field during the period of CH or CL fruiting. Normally developed, the seed-filled capsules indicate V. palustris but not a hybrid, which is sterile. It should also be taken into account that the shape and hairiness of the leaf blade are seasonally variable; there are also differences between leaves developing on stolons and on rhizomes (stolon leaves are more acute and with a more open sinus). Herbarium specimens in the vegetative stage (only leaves and rhizomes) are impossible to be correctly identified in the V. epipsila—V. palustris group (Elżbieta Kuta and Thomas Marcussen, personal observations during a critical revision of herbarium specimens from Europe).
This study showed the usefulness of molecular markers in species delimitation of the European peatland Viola as important for biodiversity and nature conservation. The increased number of interspecific hybrids (V. epipsila × V. palustris), with a simultaneous reduction in the number of V. epipsila and/or V. palustris individuals or populations ([10,30] and references therein), can be considered as indicators of anthropogenic changes in the peatlands and their continued degradation.

5. Conclusions

(1)
Morphological characters of V. pubifolia fall well within the range of variability of V. palustris.
(2)
Genetically, V. pubifolia is V. palustris, based on ISSR, GPI, and RAD-Seq.
(3)
The low genetic diversity and heterozygosity of selected Central and Northern European populations of V. epipsila confirmed by RAD-Seq might explain its low tolerance to changing environments and the risk of extinction.
(4)
The declining number of V. epipsila populations and the disappearance of its natural habitats suggest that in some areas it might require effective conservation strategies.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biology12030362/s1, Table S1: Plant material of V. pubifolia, V. epipsila, V. palustris and hybrids V. epipsila × V. palustris for molecular analyses: genome size value; ISSR markers; GPI gene; RAD-Seq; Table S2: Comparison of genome size of selected specimens of V. pubifolia, V. palustris, hybrids V. epipsila × V. palustris, and V. epipsila; Table S3: Comparison of features of V. pubifolia, V. epipsila, V. palustris, interspecific hybrid (V. epipsila × V. palustris) based on selected European floras and publications; Table S4: Sequences of used ISSR primers and their annealing temperatures; Figure S1: Values of ΔK for each run with assumed K steps from 1 to 5; Figure S2: Hypothetical model of V. pubifolia origin.

Author Contributions

Conceptualization, J.Ż.; Data curation, J.Ż.; Formal analysis, J.Ż. and G.M.; Funding acquisition, J.Ż. and T.K.; Investigation, J.Ż.; Methodology, J.Ż.; Project administration, J.Ż.; Resources, J.Ż.; Supervision, E.K.; Validation, J.Ż.; Visualization, J.Ż., G.M., and E.K.; Writing—original draft, J.Ż.; Writing—review and editing, J.Ż., T.K., G.M., A.S., and E.K. All authors have read and agreed to the published version of the manuscript.

Funding

The research was funded by the National Science Centre, Poland, under project 2018/29/N/NZ8/01224 (collection of part plant material, ISSR analysis, genome size assessment) and by the NABU International Peatland Conservation Funds under project number N18/DBW/000003 (GPI gene analysis, RAD-Seq).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The sequences of two homoeologs of GPI (CHAM—GPI-C, MELVIO—GPI-M) of V. palustris were deposited in GenBank with accession numbers OM681348–OM681351. Raw RAD-seq reads were deposited in Sequence Read Archive and are available under NCBI BioProject with accession number PRJNA807904.

Acknowledgments

The authors thank Leszek Mackiewicz (Berlin, Germany), Rudolf Höcker (Eckenthal, Germany), Lenz Meierott (Gerbrunn, Germany), Zbigniew Celka (Department of Plant Taxonomy, Adam Mickiewicz University, Poznań, Poland), Piotr Szkudlarz (Department of Plant Taxonomy, Adam Mickiewicz University, Poznań, Poland), Piotr Żabicki (Cracow, Poland), Zigmantas Gudžinskas (Institute of Botany, Vilnius, Lithuania), and Andrzej Keczyński (Białowieża, Poland) for the collection of plant material. The authors also would like to thank Elwira Sliwinska (Laboratory of Molecular Biology and Cytometry, Department of Agricultural Biotechnology, Bydgoszcz University of Science and Technology, Poland) for genome size analysis. Our special thanks are given to Thomas Marcussen (CEES, Department of Biosciences, University of Oslo, Oslo, Norway) for long cooperation and for very important and fruitful discussions on the evolution of the Viola genus, in particular on the Viola epipsila—V. palustris group. We also thank Ryszard Ochyra (Institute of Botany of Polish Academy of Sciences, Kraków, Poland) for invaluable discussions on taxonomic nomenclature and Marcin Nobis, the curator of KRA Herbarium (Cracow, Poland), where the specimens were deposited.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Marcussen, T.; Ballard, H.E.; Danihelka, J.; Flores, A.R.; Nicola, M.V.; Watsonet, J.M. A revised phylogenetic classification for Viola (Violaceae). Plants 2022, 11, 2224. [Google Scholar] [CrossRef] [PubMed]
  2. Russell, N.H. Regional variation patterns in the stemless white violets. Am. Midl. Nat. 1956, 56, 491–503. [Google Scholar] [CrossRef]
  3. Russell, N.H. The taxonomy of the North American acaulescent white violets. Am. Midl. Nat. 1955, 54, 481–494. [Google Scholar] [CrossRef]
  4. Moore, D.M.; Harvey, M.J. Cytogenetic relationships of Viola lactea Sm. and other west European arosulate violets. New Phytol. 1961, 60, 85–95. [Google Scholar] [CrossRef]
  5. Valentine, D.H. Viola L. In Hybridization and the Flora of the British Isles; Stace, C., Ed.; Academic Press: London, UK; Cambridge, MA, USA, 1975. [Google Scholar]
  6. Kuta, E. Cyto-embryological studies on the species of the Viola L. genus., Nomimium Ging. section from the territory of Poland. Fragm. Florist. Geobot. 1978, 24, 23–91. [Google Scholar]
  7. Kuta, E. Further cyto-embryological studies on Viola L. section Viola L. Acta Biol. Cracov. Bot. 1981, 23, 69–82. [Google Scholar]
  8. Kuta, E. Biosystematic studies on the genus Viola L.; section Plagiostigma Godr. I. Karyological analysis of V. epipsila Ledeb.; V. palustris L. and their hybrids from Poland. Acta Biol. Cracov. Bot. 1989, 31, 29–44. [Google Scholar]
  9. Kuta, E. Biosystematic studies on the genus Viola L.; section Plagiostigma Godr. II. Embryological analysis of V. epipsila Ledeb.; V. palustris L. and their hybrids from Poland. Acta Biol. Cracov. Bot. 1989, 31, 45–62. [Google Scholar]
  10. Kuta, E. Biosystematic studies on Viola sect. Plagiostigma: III. Biometrical analysis of the Polish populations of V. epipsila, V. palustris and their spontaneous hybrids. Fragm. Florist. Geobot. 1991, 35, 5–34. [Google Scholar]
  11. Wang, J.-C.; Huang, T.-C. A natural hybrid of Viola from Taiwan with cytological evidence. Bot. Bull. Acad. Sin. 1992, 33, 105–110. [Google Scholar]
  12. Erben, M. The significance of hybridization on the forming of species in the genus Viola. Bocconea 1996, 5, 113–118. [Google Scholar]
  13. Neuffer, B.; Auge, H.; Mesch, H.; Amarell, U.; Brandl, R. Spread of violets in polluted pine forests: Morphological and molecular evidence for the ecological importance of interspecific hybridization. Mol. Ecol. 1999, 8, 365–377. [Google Scholar] [CrossRef]
  14. Malécot, V.; Marcussen, T.; Munzinger, J.; Yockteng, R.; Henry, M. On the origin of the sweet-smelling Parma violet cultivars (Violaceae): Wide intraspecific hybridization, sterility, and sexual reproduction. Am. J. Bot. 2007, 94, 29–41. [Google Scholar] [CrossRef] [PubMed]
  15. Conesa, M.À.; Mus, M.; Rosselló, J.A. Hybridization between insular endemic and widespread species of Viola in non-disturbed environments assessed by nuclear ribosomal and cpDNA sequences. Plant Syst. Evol. 2008, 273, 169–177. [Google Scholar] [CrossRef]
  16. van den Hof, K.; van den Berg, R.G.; Gravendeel, B. Chalcone synthase gene lineage diversification confirms allopolyploid evolutionary relationships of European rostrate violets. Mol. Biol. Evol. 2008, 25, 2099–2108. [Google Scholar] [CrossRef] [PubMed]
  17. Karlsson, T.; Marcussen, T. Violaceae. In Flora Nordica; Jonsell, B., Karlsson, T., Eds.; The Swedish Museum of Natural History: Stockholm, Sweden, 2010; Volume 6, pp. 12–52. [Google Scholar]
  18. Marcussen, T.; Jakobsen, K.S.; Danihelka, J.; Ballard, H.E.; Blaxland, K.; Brysting, A.K.; Oxelman, B. Inferring species networks from gene trees in high-polyploid North American and Hawaiian violets (Viola, Violaceae). Syst. Biol. 2012, 61, 107–126. [Google Scholar] [CrossRef]
  19. Marcussen, T.; Heier, L.; Brysting, A.K.; Oxelman, B.; Jakobsen, K.S. From gene trees to a dated allopolyploid network: Insights from the angiosperm genus Viola (Violaceae). Syst. Biol. 2015, 64, 84–101. [Google Scholar] [CrossRef]
  20. Toyama, H.; Kamiyama, T.; Yahara, T. A genome-wide AFLP replacement in a hybrid population derived from two closely related Viola species from contrasting habitats. Plant Syst. Evol. 2015, 301, 1073–1084. [Google Scholar] [CrossRef]
  21. Porter, M.; Foley, M. Violas of Britain & Ireland. Botanical Society of Britain and Ireland; BSBI: Durham, UK, 2017. [Google Scholar]
  22. Sorsa, M. Cytological and evolutionary studies on Palustres violets. Madroño 1968, 19, 165–179. [Google Scholar]
  23. Hegi, G. Viola L. In Illustrierte Flora von Mitteleuropa; J.F. Lehmann: München, Germany, 1925; Volume 5, pp. 586–656. [Google Scholar]
  24. Komarov, V.L. Flora URSS; Academia Scientiarum URSS: Leningrad, Moscow, 1949; Volume 15, p. 742. [Google Scholar]
  25. Anderson, J.P. Flora of Alaska and Adjacent Parts of Canada; University of Iowa Press: Iowa City, IA, USA, 1959; p. 543. [Google Scholar]
  26. Valentine, D.H.; Merxmüller, H.; Schmidt, A. Viola L. In Flora Europaea; Tutin, T.G., Heywood, V.H., Burges, N.A., Moore, D.M., Valentine, D.H., Eds.; Cambridge University Press: Cambridge, UK, 1968; Volume 2, pp. 270–282. [Google Scholar]
  27. Meusel, H.; Jäger, E.; Weinert, E. Vergleichende Chorologie der Zentraleuropäischen Flora; G. Fischer: Jena, Germany, 1978; Volume 2, p. 418. [Google Scholar]
  28. Wąsowicz, P. Annotated checklist of vascularplants of Iceland. Fjölrit Náttúrufræistofnunar 2020, 57, 1–193. [Google Scholar] [CrossRef]
  29. Kuta, E.; Pliszko, A. Viola epipsila Ledeb. In Polska Czerwona Księga Roślin, Paprotniki i Rośliny Kwiatowe; Kazimierczakowa, R., Zarzycki, K., Mirek, Z., Eds.; Instytut Ochrony Przyrody PAN: Kraków, Polska, 2014; Volume 3, pp. 329–331. [Google Scholar]
  30. Żabicka, J.; Migdałek, G.; Słomka, A.; Sliwinska, E.; Mackiewicz, L.; Keczyński, A.; Kuta, E. Interspecific hybridization and introgression influence biodiversity—Based on genetic diversity of Central European Viola epipsila—V. palustris complex. Diversity 2020, 12, 321. [Google Scholar] [CrossRef]
  31. Loos, G.H. Taxonomische Neukombinationen zur Flora Mittel-und Osteuropas, insbesondere Nordrhein-Westfalens. Online-Veröff. Boch. Bot. Ver. 2010, 2, 1–20. [Google Scholar]
  32. Eklund, O. Was ist eigentlich Viola ‘epipsila × palustris’? Memo. Soc. Fauna Flora Fenn. 1934, 10, 35–40. [Google Scholar]
  33. Eklund, O. Die Gefässpflanzenflora beiderseitis Skifted im Schärenarchipel Südwestfinnlands. Bidr. känn. Finl. nat. folk 1958, 101, 1–324. [Google Scholar]
  34. Brandrud, K.H.; Borgen, L. Viola epipsila, V. palustris and their hybrid in SE Norway. Acta Univ. Upsaliensis. Symb. Bot. Ups. 1986, 27, 19–24. [Google Scholar]
  35. Jarašius, L.; Etzold, J.; Truus, L.; Purre, A.H.; Sendžikaitė, J.; Strazdiņa, L.; Zableckis, N.; Pakalne, M.; Bociąg, K.; Ilomets, M.; et al. Handbook for Assessment of Greenhouse Gas Emissions from Peatlands: Applications of direct and indirect methods by LIFE Peat Restore; Lithuanian Fund for Nature: Vilnius, Lithuania, 2022. [Google Scholar]
  36. Gupta, M.; Chyi, Y.S.; Romero-Severson, J.; Owen, J.L. Amplification of DNA markers from evolutionary diverse genomes using single primers of simple-sequence repeats. Theor. Appl. Genet. 1994, 89, 998–1006. [Google Scholar] [CrossRef] [PubMed]
  37. Stepansky, A.; Kovalski, I.; Perl-Treves, R. Intraspecific classifcation of melons (Cucumis melo L.) in view of their phenotypic and molecular variation. Plant Syst. Evol. 1999, 217, 313–332. [Google Scholar] [CrossRef]
  38. Yeh, F.C.; Yang, R.C.; Boyle, T. POPGENE. In Microsoft Windows Based Freeware for Population Genetic Analysis. Release 1.31; University of Alberta: Edmonton, AB, Canada, 1999; Available online: https://sites.ualberta.ca/~fyeh/popgene.html (accessed on 18 August 2020).
  39. Schlüter, P.M.; Harris, S.A. Analysis of multilocus fingerprinting data sets containing missing data. Mol. Ecol. Notes 2006, 6, 569–572. [Google Scholar] [CrossRef]
  40. Huson, D.H.; Bryant, D. Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 2006, 23, 254–267. [Google Scholar] [CrossRef]
  41. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
  42. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
  43. Earl, D.A.; von Holdt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
  44. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef]
  45. Excoffier, L.; Lischer, H.E. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
  46. Blaxland, K.; Ballard, H.E.; Marcussen, T. Viola pluviae sp. nov. (Violaceae), a member of subsect. Stolonosae in the Pacific Northwest region of North America. Nord. J. Bot. 2018, 36, e01931. [Google Scholar] [CrossRef]
  47. Scheen, A.C.; Pfeil, B.E.; Petri, A.; Heidari, N.; Nylinder, S.; Oxelman, B. Use of allele-specific sequencing primers is an efficient alternative to PCR subcloning of low-copy nuclear genes. Mol. Ecol. Resour. 2012, 12, 128–135. [Google Scholar] [CrossRef] [PubMed]
  48. Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  49. Huang, X. A Contig Assembly Program Based on Sensitive Detection of Fragment Overlaps. Genomics 1992, 14, 18–25. [Google Scholar] [CrossRef] [PubMed]
  50. Edgar, R.C. MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinform. 2004, 5, 113. [Google Scholar] [CrossRef]
  51. Ronquist, F.; Teslenko, M.; Van Der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
  52. Simmons, M.P.; Ochoterena, H. Gaps as characters in sequence-based phylogenetic analyses. Syst. Biol. 2000, 49, 369–381. [Google Scholar] [CrossRef]
  53. Müller, K. SeqState—Primer design and sequence statistics for phylogenetic DNA data sets. Appl. Bioinform. 2005, 4, 65–69. [Google Scholar] [CrossRef]
  54. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef]
  55. Available online: https://github.com/rambaut/figtree/releases (accessed on 4 October 2016).
  56. Baird, N.A.; Etter, P.D.; Atwood, T.S.; Currey, M.C.; Shiver, A.L.; Lewis, Z.L.; Selker, E.U.; Cresko, W.A.; Johnson, E.A. Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers. Edited by Justin C. Fay. PLoS ONE 2008, 3, e3376. [Google Scholar] [CrossRef] [PubMed]
  57. Catchen, J.M.; Amores, A.; Hohenlohe, P.; Cresko, W.; Postlethwait, J.H. Stacks: Building and Genotyping Loci De Novo from Short-Read Sequences. G3 2011, 1, 171–182. [Google Scholar] [CrossRef] [PubMed]
  58. Gramlich, S.; Wagner, N.D.; Hörandl, E. RAD-seq reveals genetic structure of the F2-generation of natural willow hybrids (Salix L.) and a great potential for interspecific introgression. BMC Plant Biol. 2018, 18, 317. [Google Scholar] [CrossRef] [PubMed]
  59. Viricel, A.; Pante, E.; Dabin, W.; Simon-Bouhet, B. Applicability of RAD-Tag Genotyping for Interfamilial Comparisons: Empirical Data from Two Cetaceans. Mol. Ecol. Resour. 2013, 14, 597–605. [Google Scholar] [CrossRef] [PubMed]
  60. Adamack, A.T.; Gruber, B. PopGenReport: Simplifying Basic Population Genetic Analyses in R. Edited by Stephane Dray. Methods Ecol. Evol. 2014, 5, 384–387. [Google Scholar] [CrossRef]
  61. Malinsky, M.; Trucchi, E.; Lawson, D.J.; Falush, D. RADpainter and fineRADstructure: Population Inference from RADseq Data. Mol. Biol. Evol. 2018, 35, 1284–1290. [Google Scholar] [CrossRef]
  62. Nei, M. Analysis of Gene Diversity in Subdivided Populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef]
  63. Zabłocki, J. Dwuliścienne wolnopłatkowe: Dwuokwiatowe, rodzina: Violaceae, fiołkowate. In Flora Polska. Rośliny Naczyniowe Polski i Ziem Ościennych; Szafer, W., Ed.; Polska Akademia Umiejętności: Kraków, Polska, 1947; Volume 6, pp. 1–70. [Google Scholar]
  64. Seifert, B. The gene and gene expression (GAGE) species concept: An universal approach for all eukaryotic organisms. Syst. Biol. 2020, 69, 1033–1038. [Google Scholar] [CrossRef] [PubMed]
  65. Rouhan, G.; Gaudeul, M. Plant taxonomy: A historical perspective, current challenges, and perspectives. In Molecular Plant Taxonomy. Methods in Molecular Biology; Humana: New York, NY, USA, 2021; p. 2222. [Google Scholar]
  66. Hamrick, J.L.; Godt, M.J.W. Allozyme diversity in plant species. In Plant Population Genetics, Breeding, and Genetic Resources; Brown, A.H.D., Clegg, M.T., Kahler, A.L., Weir, B.S., Eds.; Sinauer Associates: Sunderland, MA, USA, 1990; pp. 43–63. [Google Scholar]
  67. Auge, H.; Neuffer, B.; Erlinghagen, F.; Grupe, R.; Brandl, R. Demographic and random amplified polymorphic DNA analyses reveal high levels of genetic diversity in a clonal violet. Mol. Ecol. 2001, 10, 1811–1819. [Google Scholar] [CrossRef] [PubMed]
  68. Cánovas, J.L.; Jimenez, J.F.; Mota, J.F.; Gomez, P.S. Genetic diversity of Viola cazorlensis Gand., an endemic species of Mediterranean dolomitic habitats: Implications for conservation. Syst. Biodivers. 2015, 13, 571–580. [Google Scholar] [CrossRef]
  69. Hatmaker, E.A.; Staton, M.E.; Dattilo, A.J.; Hadziabdic, D.; Rinehart, T.A.; Schilling, E.E.; Trigiano, R.N.; Wadl, P.A. Population Structure and Genetic Diversity Within the Endangered Species Pityopsis ruthii (Asteraceae). Front. Plant Sci. 2018, 9, 943. [Google Scholar] [CrossRef]
  70. Sorsa, M. Hybridization of Palustres violets in Finland. Ann. Acad. Sci. Fenn. A 4 Biol. 1965, 86, 4–18. [Google Scholar]
  71. Tansley, S.A.; Brown, C.R. RAPD variation in the rare and endangered Leucadendron elimense (Proteaceae): Implications for their conservation. Biol. Conserv. 2000, 95, 39–48. [Google Scholar] [CrossRef]
  72. Fridman, E. Consequences of hybridization and heterozygosity on plant vigor and phenotypic stability. Plant Sci. 2015, 232, 35–40. [Google Scholar] [CrossRef]
  73. Doyle, J.J.; Egan, A.N. Dating the origins of polyploidy events. New Phyt. 2010, 18, 73–85. [Google Scholar] [CrossRef]
  74. Pikaard, C.S. Genomic change and gene silencing in polyploids. Trends Genet. 2001, 17, 675–677. [Google Scholar] [CrossRef]
  75. Liu, B.; Wendel, J.F. Epigenetic phenomena and the evolution of plant allopolyploids. Mol. Phylogenet. Evol. 2003, 29, 365–379. [Google Scholar] [CrossRef]
  76. Adams, K.L.; Wendel, J.F. Novel patterns of gene expression in polyploid plants. Trends Genet. 2005, 21, 539–543. [Google Scholar] [CrossRef] [PubMed]
Biology 12 00362 g001 550
Figure 1. Morphological features of V. pubifolia and occupied habitats. Herbarium specimens of V. palustris L. subsp. pubifolia Kuta described for the first time from Słowiński National Park [10] (A). Face view of CH flower (B); capsule of CH flower (arrows), bud-like, fully developed CL flower (asterisks), visible bracts on the pedicel (arrowheads) (C); lower leaf surface with visible hairs marked with arrows (D). Occupied habitats: wet, periodically flooded areas (E–G) or less humid places (H–K): in clumps of grass (F), close to trees (G), close to rotten trunks (J), on growing tree trunks partly covered with moss (K). CH—chasmogamous flower; CL—cleistogamous flower; arrows—individuals on particular locality.
Figure 1. Morphological features of V. pubifolia and occupied habitats. Herbarium specimens of V. palustris L. subsp. pubifolia Kuta described for the first time from Słowiński National Park [10] (A). Face view of CH flower (B); capsule of CH flower (arrows), bud-like, fully developed CL flower (asterisks), visible bracts on the pedicel (arrowheads) (C); lower leaf surface with visible hairs marked with arrows (D). Occupied habitats: wet, periodically flooded areas (E–G) or less humid places (H–K): in clumps of grass (F), close to trees (G), close to rotten trunks (J), on growing tree trunks partly covered with moss (K). CH—chasmogamous flower; CL—cleistogamous flower; arrows—individuals on particular locality.
Biology 12 00362 g001
Biology 12 00362 g002 550
Figure 2. Geographical distribution of Central and Northern European studied populations of V. pubifolia, V. palustris, V. epipsila, and hybrids (V. epipsila × V. palustris): 1—Słowiński National Park (NW Poland), 2—Połajewo near Poznań (W Poland), 3—Ostrów Tarczyński Nature Reserve (NE Poland), 4—Szczupliny (NE Poland), 5—Balinka (NE Poland), 6—Białowieża National Park (NE Poland), 7—Pravalas Botanical Reserve (E Lithuania), 8—“Dormitzer Forst” Kalchreuth (SE Germany), 9—Floß (SE Germany), 10—Grillenburg (E Germany), 11—Oberlausitz (E Germany), 12—Barmøya (SW Norway). Detailed information of sample designation is in Table S1.
Figure 2. Geographical distribution of Central and Northern European studied populations of V. pubifolia, V. palustris, V. epipsila, and hybrids (V. epipsila × V. palustris): 1—Słowiński National Park (NW Poland), 2—Połajewo near Poznań (W Poland), 3—Ostrów Tarczyński Nature Reserve (NE Poland), 4—Szczupliny (NE Poland), 5—Balinka (NE Poland), 6—Białowieża National Park (NE Poland), 7—Pravalas Botanical Reserve (E Lithuania), 8—“Dormitzer Forst” Kalchreuth (SE Germany), 9—Floß (SE Germany), 10—Grillenburg (E Germany), 11—Oberlausitz (E Germany), 12—Barmøya (SW Norway). Detailed information of sample designation is in Table S1.
Biology 12 00362 g002
Biology 12 00362 g003 550
Figure 3. NeighborNet analysis of: (A)—V. pubifolia (SPN, N_B!), V. palustris (BAL, L, NO, N_E), V. epipsila (SZ), V. epipsila × V. palustris hybrid (OST); (B)—V. pubifolia (62 samples) based on Dice coefficient from ISSR data. Bootstrap analysis was performed on 2000 replicates. Origin of samples: Germany (N), Poland (SNP, BAL, OST, and SZ), Lithuania (L), and Norway (NO). Detailed information in Table S1.
Figure 3. NeighborNet analysis of: (A)—V. pubifolia (SPN, N_B!), V. palustris (BAL, L, NO, N_E), V. epipsila (SZ), V. epipsila × V. palustris hybrid (OST); (B)—V. pubifolia (62 samples) based on Dice coefficient from ISSR data. Bootstrap analysis was performed on 2000 replicates. Origin of samples: Germany (N), Poland (SNP, BAL, OST, and SZ), Lithuania (L), and Norway (NO). Detailed information in Table S1.
Biology 12 00362 g003
Biology 12 00362 g004 550
Figure 4. Results of ISSR analyses of 8 populations of V. pubifolia, V. epipsila, V. palustris, and V. epipsila × V. palustris hybrid STRUCTURE at K = 3. Origin of samples: Germany (N), Poland (SNP, BAL, OST, and SZ), Lithuania (L), and Norway (NO). Detailed information in Table S1.
Figure 4. Results of ISSR analyses of 8 populations of V. pubifolia, V. epipsila, V. palustris, and V. epipsila × V. palustris hybrid STRUCTURE at K = 3. Origin of samples: Germany (N), Poland (SNP, BAL, OST, and SZ), Lithuania (L), and Norway (NO). Detailed information in Table S1.
Biology 12 00362 g004
Biology 12 00362 g005 550
Figure 5. Heatmap based on RAD-Seq pairwise Peakall-Smouse genetic distance between V. epipsila, V. palustris, V. pubifolia, and interspecific hybrid (V. epipsila × V. palustris). Intensity of colors indicates the distance between taxa—the more intense the color, the higher the distance between taxa. Detailed information of sample designation in Table S1.
Figure 5. Heatmap based on RAD-Seq pairwise Peakall-Smouse genetic distance between V. epipsila, V. palustris, V. pubifolia, and interspecific hybrid (V. epipsila × V. palustris). Intensity of colors indicates the distance between taxa—the more intense the color, the higher the distance between taxa. Detailed information of sample designation in Table S1.
Biology 12 00362 g005
Biology 12 00362 g006 550
Figure 6. Heatmap based on a clustered coancestry matrix, generated during fineRADstructure analysis and showing clustering of individuals belonging to V. epipsila, V. palustris, and their hybrids. Darker colors denote increasing levels of coancestry.
Figure 6. Heatmap based on a clustered coancestry matrix, generated during fineRADstructure analysis and showing clustering of individuals belonging to V. epipsila, V. palustris, and their hybrids. Darker colors denote increasing levels of coancestry.
Biology 12 00362 g006
Biology 12 00362 g007 550
Figure 7. Phylogenetic tree of V. palustris and V. pubifolia based on sequences of two homoeologs of GPI (GPI-C, GPI-M) and constructed using Bayesian method. Node labels present clade support probability.
Figure 7. Phylogenetic tree of V. palustris and V. pubifolia based on sequences of two homoeologs of GPI (GPI-C, GPI-M) and constructed using Bayesian method. Node labels present clade support probability.
Biology 12 00362 g007
Biology 12 00362 g008 550
Figure 8. Phylogenetic tree of sect. Plagiostigma subsect. Stolonosae including V. pubifolia and the outgroups (V. selkirkii of subsect. Patellares; V. mirabilis of sect. Viola; V. rubella of sect. Rubellium; V. pusilla sect. Andinium; V. congesta of sect. Andinium) based on sequences of two homoeologs of GPI (GPI-C, GPI-M) and constructed using Bayesian method. Node labels present clade support probability. V. pallens = V. minuscula, according to Marcussen et al. [1].
Figure 8. Phylogenetic tree of sect. Plagiostigma subsect. Stolonosae including V. pubifolia and the outgroups (V. selkirkii of subsect. Patellares; V. mirabilis of sect. Viola; V. rubella of sect. Rubellium; V. pusilla sect. Andinium; V. congesta of sect. Andinium) based on sequences of two homoeologs of GPI (GPI-C, GPI-M) and constructed using Bayesian method. Node labels present clade support probability. V. pallens = V. minuscula, according to Marcussen et al. [1].
Biology 12 00362 g008
Table
Table 1. PCR and sequencing primers used in GPI analysis.
Table 1. PCR and sequencing primers used in GPI analysis.
PCR Primers (5’-3’) *Annealing Temperature °CSequencing Primers **Sequenced Gene RegionHomoeolog
Step 1
Gpi C12Fpcr (TCCAATATGGTTTCTCCATG)/
and Gpi C16Rpcr (AAGTGGTAGACCATCAATAGAA)/		49Gpi C13Rseq (GCATACACATGCACTTATACC);
Gpi cham15R (TAAGATGGCCTGTGAGCAC)		exon12–exon16-
Gpi M12F (CTCTCCAATATGGTTTCTCCATT)/
and Gpi melvio16R (GAAGTGGTAGACCATCAATAGAT)		58Gpi M12F; Gpi melvio16R
Gpi C13Fpcr (CGACTTTAGGTAGATTAAAGTG)
and Gpi cham17R (CAACTTCWTGAATCTAAATCTTG) 		49Gpi melvio13R (TTAAAAAACCATAAAGTGTGCATTCC);
Gpi melvio15R (TAAGATGGCCTGTGAGCAT)
Gpi melvio17R (AACTTMTKGAATCTAAAAYCCTC)
and Gpi melvio13F (GTCGTGTGGAATTTGCAGG)		49Gpi melvio17R; Gpi melvio13Fexon13–exon18-
Step 2
Gpi C12Fpcr and Gpi C16Rpcr62.5–49Cepi_0077F_T (TTCTGAAATTCAT);
Cpal_0077F_C (TTCTGAAATTCAC);
Cepi_1351R_A (AGAAAAGGAAGGAA);
Cpal_1351R_G (AGAAAAGGAAGGCG)		exon12–exon16CHAM
Gpi M12F and Gpi melvio16R62.5–49Mepi_0121F_C (TCATGAGACTAAGC);
Mpal_0121F_G (TCATGAGAATAAGG);
Mepi_1313R_T (CCTGTTGAATATGT);
Mpal_1313R_C (CCTGTTGAATATGC)		MELVIO
Gpi C13Fpcr and Gpi cham17R62.5–49Cepi_1079F_G (ATCTTGTCTTATTG);
Cpal_1079F_T (ATCTCGTCTTATTT);
Cepi_2065R_C (AAATCGGAGGGAAC);
Cpal_2065R_T (AAATCGGAGGGAAT)		exon13–exon17CHAM
Gpi melvio17R and Gpi melvio13F62.5–49Mepi_1083F_G
(TGTCGTATTGTTTG);
Mpal_1083F_T
(TGTCGTATTGTTTT);
Mepi_2030R_G (AGATGCGTTAACCG);
Mpal_2030R_A
(AGATACGTTAACCA)		MELVIO
* PCR primers from steps 1 and 2 according to Marcussen et al. [18]. ** Sequencing primers from step 1 according to Marcussen et al. [18]; sequencing primers from step 2 designed according to Scheen et al. [47] protocol.
Table
Table 2. Parameters of genetic diversity based on Dice coefficient from ISSR data: A—V. pubifolia (20 samples) and V. palustris (15 samples); B—V. pubifolia (62 samples); N—number of specimens used in genetic analyses; Npoly—number of polymorphic markers; %poly—proportion of polymorphic markers, Hj—Nei’s [62] gene diversity; HT—total gene diversity; HS—mean gene diversity within populations; GST—Nei’s [62] gene diversity between populations.
Table 2. Parameters of genetic diversity based on Dice coefficient from ISSR data: A—V. pubifolia (20 samples) and V. palustris (15 samples); B—V. pubifolia (62 samples); N—number of specimens used in genetic analyses; Npoly—number of polymorphic markers; %poly—proportion of polymorphic markers, Hj—Nei’s [62] gene diversity; HT—total gene diversity; HS—mean gene diversity within populations; GST—Nei’s [62] gene diversity between populations.
PopNNpoly%polyHjHTHSGST
ASPN203617.910.050.090.070.21
PAL *155426.870.09
BSPN626230.850.06
* PAL population contains V. palustris from Germany, Poland, Lithuania, and Norway. Detailed information in Table S1.
Table
Table 3. Marker parameters for all sites of studied Viola taxa based on RAD-Seq analysis results. Npriv—number of private alleles in population; NIndv—mean number of individuals per locus in population; Npoly—number of polymorphic sites; %poly—percentage of polymorphic sites; P—mean frequency of the most frequent allele at each locus in population; Ho—mean observed heterozygosity; Obs. Hom.—mean observed homozygosity; He—mean expected heterozygosity; Exp. Hom.—mean expected homozygosity; π—mean nucleotide diversity in population; FIS—mean inbreeding coefficient of an individual relative to the subpopulation.
Table 3. Marker parameters for all sites of studied Viola taxa based on RAD-Seq analysis results. Npriv—number of private alleles in population; NIndv—mean number of individuals per locus in population; Npoly—number of polymorphic sites; %poly—percentage of polymorphic sites; P—mean frequency of the most frequent allele at each locus in population; Ho—mean observed heterozygosity; Obs. Hom.—mean observed homozygosity; He—mean expected heterozygosity; Exp. Hom.—mean expected homozygosity; π—mean nucleotide diversity in population; FIS—mean inbreeding coefficient of an individual relative to the subpopulation.
Pop IDNprivNIndvNpoly%polyPHoObs. Hom.HeExp. Hom.πFIS
Vpub3112.164430.280.750.480.520.280.720.29−0.35
Vpal243.004170.270.750.460.540.280.720.33−0.21
Vepi143.00400.030.980.020.980.020.980.030.02
hybrid82.005810.370.640.720.280.390.610.52−0.29
Vpub—V. pubifolia, Vpal—V. palustris, Vepi—V. epipsila, hybrid—V. epipsila × V. palustris.
Table
Table 4. Pairwise SNP-level Fst distance between species and interspecific hybrids based on RAD-Seq analysis results.
Table 4. Pairwise SNP-level Fst distance between species and interspecific hybrids based on RAD-Seq analysis results.
VpubVpalVepiHybrids
Vpub-0.030.410.16
Vpal0.03-0.520.16
Vepi0.410.52-0.33
Vpub—V. pubifolia, Vpal—V. palustris, Vepi—V. epipsila, hybrid—V. epipsila × V. palustris.
Table
Table 5. Number of common haplotypes of Viola pubifolia with V. epipsila and V. palustris based on RAD-Seq analysis results.
Table 5. Number of common haplotypes of Viola pubifolia with V. epipsila and V. palustris based on RAD-Seq analysis results.
V. pubifolia Sample NameNo of Common Haplotypes with Selected Taxa or Sample
All
V. epipsila
Rs16–18		V. epipsila from Poland Rs16V. epipsila from Poland Rs18V. epipsila from Lithuania
Rs17		V. palustris from Germany Rs14V. palustris from Lithuania
Rs15		All
V. palustris
Rs14,15,21		All
Hybrids
Rs19,20
Rs1107122124127532605478302
Rs2110126126130536608481307
Rs390104105107485543434266
Rs4102118118122520587471288
Rs5101116118121526591472291
Rs687100105107502560454277
Rs799115115118495573448273
Rs892105110113511572459287
Rs996107115115516574465305
Rs10108121125127502569450277
Rs11106122122125496573450279
Rs1299113115118515572463279
Rs2493107111110552581472281
Mean99.23113.54116.08118.46514.46577.54461.31285.54
Rs1–Rs24—detailed information in Table S1.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Żabicka, J.; Kirschey, T.; Migdałek, G.; Słomka, A.; Kuta, E. Genetic Variation versus Morphological Variability in European Peatland Violets (Viola epipsila—V. palustris Group). Biology 2023, 12, 362. https://doi.org/10.3390/biology12030362

AMA Style

Żabicka J, Kirschey T, Migdałek G, Słomka A, Kuta E. Genetic Variation versus Morphological Variability in European Peatland Violets (Viola epipsila—V. palustris Group). Biology. 2023; 12(3):362. https://doi.org/10.3390/biology12030362

Chicago/Turabian Style

Żabicka, Justyna, Tom Kirschey, Grzegorz Migdałek, Aneta Słomka, and Elżbieta Kuta. 2023. "Genetic Variation versus Morphological Variability in European Peatland Violets (Viola epipsila—V. palustris Group)" Biology 12, no. 3: 362. https://doi.org/10.3390/biology12030362

APA Style

Żabicka, J., Kirschey, T., Migdałek, G., Słomka, A., & Kuta, E. (2023). Genetic Variation versus Morphological Variability in European Peatland Violets (Viola epipsila—V. palustris Group). Biology, 12(3), 362. https://doi.org/10.3390/biology12030362

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop