Next Article in Journal
Vitiligo: A Review of Aetiology, Pathogenesis, Treatment, and Psychosocial Impact
Next Article in Special Issue
Antioxidant Profile of Origanum dictamnus L. Exhibits Antiaging Properties against UVA Irradiation
Previous Article in Journal
Optimization of the Composition of a Cosmetic Formulation Containing Tremella fuciformis Extract (Fungi)
Previous Article in Special Issue
Chlorogenic Acid, a Component of Oenanthe javanica (Blume) DC., Attenuates Oxidative Damage and Prostaglandin E2 Production Due to Particulate Matter 10 in HaCaT Keratinocytes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cosmetics
Volume 10
Issue 3
10.3390/cosmetics10030083
cosmetics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Food Supplements for Skin Health: In Vitro Efficacy of a Combination of Rhodiola rosea, Tribulus terrestris, Moringa oleifera and Undaria pinnatifida on UV-Induced Damage

by
Alessia Paganelli
1,2,†,
Alessandra Pisciotta
3,†,
Giulia Bertani
2,3,
Rosanna Di Tinco
3,
Nadia Tagliaferri
3,
Giulia Orlandi
3,
Paola Azzoni
3 and
Laura Bertoni
3,*
1
Dermatologic Surgery Unit, Modena University Hospital, Via del Pozzo 71, 41124 Modena, Italy
2
PhD Course in Clinical and Experimental Medicine, University of Modena and Reggio Emilia, 41121 Modena, Italy
3
Department of Surgery, Medicine, Dentistry and Morphological Sciences with Interest in Transplant, Oncology and Regenerative Medicine, University of Modena and Reggio Emilia, 41124 Modena, Italy
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Cosmetics 2023, 10(3), 83; https://doi.org/10.3390/cosmetics10030083
Submission received: 21 April 2023 / Revised: 10 May 2023 / Accepted: 18 May 2023 / Published: 19 May 2023
(This article belongs to the Special Issue Bioactive Compounds From Natural Resources Against Skin Aging)
Browse Figures
Versions Notes

Abstract

:
An increasing number of people seek treatment for aging-related conditions. Plant-derived nutraceuticals are currently of great interest in the setting of dermo-cosmetic studies for their preventive role in photoaging. We conducted an in vitro study on the possible preventive properties against photoaging of a commercially available product (Venerinase®). A mixture of Rhodiola rosea, Tribulus terrestris, Moringa oleifera, Undaria pinnatifida, folic acid and vitamin B12 (Venerinase®) was tested for its potential anti-aging effects on the skin in vitro. Conventional histology, immunofluorescence and real time PCR were employed in the research protocol. The tested product was proven to prevent UV-induced morphological changes both in keratinocytes and fibroblasts. Moreover, senescence-related and proinflammatory pathways commonly triggered by UV exposure were demonstrated to be inhibited by Venerinase® pretreatment. Our results support the potential clinical benefits of oral supplements for the treatment and/or prevention of cutaneous photodamage.

1. Introduction

Skin aging is a complex biological process characterized by progressive skin changes, commonly further classified as intrinsic or extrinsic aging. Intrinsic skin aging, also known as chronological cutaneous aging, is due to the passing of time. Chrono-aging can be influenced by several factors including the skin phototype, ethnicity, telomere length and hormonal and genetic factors [1,2,3]. With regard to cutaneous pigmentation, for example, not only are non-melanoma skin cancers (NMSCs) far rarer in dark-skinned individuals, but a lower variability in terms of skin quality is also observed between sun-exposed and non-exposed areas. Taken together, these data emphasize the close relationship between intrinsic and extrinsic factors in cutaneous aging [1,2]. On the other hand, external factors play a pivotal role in extrinsic aging, with chronic sun exposure and ultraviolet (UV) irradiation determining progressive damage to the skin [4]. While UVB rays cause inflammatory changes and DNA damage in the epidermis and papillary dermis, UVA rays induce dermal elastosis through an oxidative-stress-mediated mechanism [5]. However, UVB and UVA rays often share common biological effects and frequent overlaps in terms of the clinical consequences of chronic exposure. Clinical manifestations of cutaneous aging include seborrheic keratoses, solar lentigo, wrinkles, yellowing of the skin, Favre–Racouchot disease, actinic keratoses and skin cancers [6,7].
From a more microscopic point of view, cutaneous aging is characterized by epidermal and dermal thinning, reduced cutaneous vascularization, loss and/or fragmentation of collagen, elastic fibres and proteoglycans [8].
Due to the recent increase in lifespan, not only do more and more patients seek treatment for cutaneous malignancies, but they also return to aesthetic procedures, cosmetic products and oral supplements to prevent and/or treat aging-related dermatological changes [9,10].
Oxidative stress has been demonstrated to play a key role in both skin photo- and chrono-aging; therefore, antioxidants are nowadays considered valid therapeutic tools in the field of skincare [11,12]. Ascorbic acid (commonly referred to as vitamin C) is probably the most renowned antioxidant worldwide and exerts a protective role on the skin from sun damage [13,14]. Vitamin C is present both in oral and topical formulations used for antiaging purposes.
An increasing body of evidence points at nutraceuticals for the prevention of aging-associated skin changes [15,16,17] and natural extracts are currently being investigated for their potential inhibiting action on aging [18,19]. Several natural leaves—including moringa, curry, guava, ginko biloba, olive, grape, green tea, Tribulus terrestris, wakame and roseroot leaves—have been widely studied for their benefits in the setting of aging science [20,21]. Their protective role against aging and age-related comorbidities is due to a large variety of bioactive components, the most well-known being quercetin, catechins, flavonoids, polyphenols, anthocyanins, terpenoids, tannins, glutathione, melatonin and other glycosides [12,21]. Various types of in vitro and animal models have already been employed so far with the aim of exploring the possible mechanisms of action of these substances [22,23]. However, current evidence is often limited to the study of a single anti-aging molecule and/or natural extract.
The reduced bioavailability of vitamin B12 and folic acid metabolism impairment have also been demonstrated in aging [24,25,26] and supplementation with folates and B12 has been demonstrated to possess anti-aging effects in experimental models [27,28,29]. Other proposed treatments for treating aging-associated manifestations include metformin, stem cells and hyaluronic acid (either injected or topically applied), as well as other cosmetic and aesthetic procedures [30,31,32,33].
The aim of the present study was to assess the in vitro effects of a commercially available over-the-counter dietary supplement containing a combination of four natural leaf extracts, vitamin B12 and folic acid on skin aging (Venerinase®; Cristalfarma srl, Milan, Italy). The ingredients of Venerinase® on their own have already been proposed as possible preventive tools against photoaging and the recent literature points at Moringa oleifera, Rhodiola rosea, Undaria pinnatifida and Tribulus terrestris as useful therapeutic tools based on in vitro evidence of their antiaging action [22,34,35,36,37]. However, similar scientific data are currently lacking for combinations of these products.

2. Materials and Methods

2.1. Experimental Device

A mixture of Rhodiola rosea, Tribulus terrestris, Moringa oleifera, Undaria pinnatifida, folic acid and vitamin B12 as an analogue to the commercially available Venerinase® (Cristalfarma srl, Milan, Italy; for final composition see Table 1) was prepared and tested for its potential anti-aging effects in vitro.

2.2. Fibroblast Culture and UV Irradiation Treatment with Venerinase®

Human fibroblasts (C0135C, Thermo Fisher Scientific, Waltham, MA, USA) were expanded up to passage 3, then culture medium was added with Venerinase® at different concentrations for 24 h to subsequently determine a suitable working dose without affecting cell viability and proliferation. To this purpose, human fibroblasts underwent a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric test [38]. With regard to this, cells were incubated for 3 h with MTT reagent at 37 °C. After incubation, the purple formazan crystals were dissolved in DMSO at room temperature, then the absorbance was measured at OD = 590 nm by using a multi-well plate reader (Thermo Scientific Appliskan, Thermo Fisher Scientific). The determined working concentration was applied for 24 h to fibroblast cultures, then cells underwent UV irradiation at a dose of UVB of 50 mJ/cm2 (Philips—TL 20W/12RS, 270–420 nm) [39,40].

2.3. Evaluation of Fibroblast Aging and Photodamage

In order to evaluate the effects of UV exposure on human fibroblasts, real time PCR (rt-PCR) analyses were performed to assess the mRNA levels of ACTA2, HDAC4, SPARC, p21, IL-6 and TNF-α, as previously described [41]. Cells were homogenized and the total RNA was extracted and purified using PureLink RNA columns (Thermo Fisher Scientific). The RNA integrity and quantification were analyzed via a spectrophotometric method by using a NanoDrop 2000 device (Thermo Fisher Scientific, Waltham, MA, USA). Total RNA (1 μg) was reverse transcribed to cDNA using a QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. The levels of mRNA were quantitatively determined (for PCR primer sequences see Table 2) on a QuantStudio 3 Real Time PCR system (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) using a QuantiFast SYBR Green PCR Kit according to the manufacturer’s instructions (Qiagen, Hilden, Germany). Furthermore, immunofluorescence (IF) staining for specific photodamage markers, such as p27, α-SMA and COX-1, was also performed. Cells were fixed with 4% para-formaldehyde at 4 °C for 15 min and then permeabilized with 0.3% Triton X-100 for 5 min. After blocking with 3% bovine serum albumin (BSA) in pH 7.4 phosphate-buffered saline (PBS) for 1 h, the cells were incubated at 4 °C overnight with the primary antibodies: rabbit anti-p27 (1:50; Abcam), mouse anti-α-SMA (1:100; Invitrogen, Waltham, MA, USA) and rabbit anti-COX-1 (1:50; StressMarq Biosciences, Victoria, BC, Canada). Then, after washing in BSA 1% in PBS, cells were subsequently incubated for 1 h at room temperature with the following secondary antibodies: goat anti-rabbit Alexa488 and goat anti-mouse Alexa546 (all diluted 1:200; Thermo Fisher Scientific). Nuclei were counterstained with 1 μM 4,6-diamidino- 2-phenylindole (DAPI) (Sigma-Aldrich, St. Louis, MO, USA). In parallel, the cell morphology was evaluated by immunolabeling with TRITC-conjugated anti-phalloidin antibody (Abcam, Cambridge, UK). Samples were observed with a Nikon A1 confocal laser scanning microscope (Nikon, Minato, Tokyo, Japan) and image rendering was performed using ImageJ 2.9.0 and Adobe Photoshop Software 7.0 [42].

2.4. Epidermal Aging Assay

Commercially available epidermis (EpiDerm™, Mattek, Ashland, MA, USA) was pre-treated with single (at t0) and double (at t0 and after 24 h, t24) doses of Venerinase® before UVB exposure, according to the aforementioned protocol. After 24 h, UVB-irradiated EpiDerm™ samples were processed for paraffin embedding. Briefly, samples were fixed in 4% paraformaldehyde in PBS, washed with PBS and dehydrated with graded ethanol, cleared and embedded in paraffin. Five-micrometre-thick serial cross-sections of the specimens from each experimental group were obtained. Routine haematoxylin/eosin staining was performed in order to analyse the morphological details of the EpiDerm samples from each group, i.e., epidermal stratification and differentiation.
Histological images were obtained using a Nikon Labophot-2 light microscope with a DS-5Mc CCD camera.
IF staining was performed by labelling epidermis sections with mouse anti-PCNA (Millipore, Burlington, MA, USA), rabbit anti-CK-1 (Abcam) and rabbit anti-Beclin-1 (StressMarq Biosciences) to assess proliferation, cytoskeleton integrity and cell damage, as described above. In order to evaluate the nuclear damage, the total RNA content was also measured for DNA transcription assessment. Finally, real-time PCR analyses of IL-6 and TNF-α expressions were repeated on epidermis samples after UV exposure to investigate the potential anti-inflammatory effects of Venerinase® (for PCR primer sequences see Table 2).

2.5. Statistical Analysis

Experiments were performed in triplicate and the results were expressed as means ± SD. A student’s t test was carried out to evaluate differences between two groups. Conversely, differences among three or more groups were analysed through an ANOVA, followed by a Newman–Keuls post hoc test. A p-value < 0.05 was considered statistically significant.

3. Results

3.1. Cell Viability

The MTT test showed good tolerability of the Venerinase® product, with only a slight (non-statistically significant) reduction in cell viability at high dose concentrations (1:50/2%). After evaluating different concentrations, 0.1% Venerinase® was proven to be the most suitable for the subsequent assays (Figure 1).

3.2. Venerinase®-Induced Changes in the Dermal Compartment

As shown in Figure 2A, UV exposure induced a shift in cell morphology of cultured fibroblasts, which became more dendritic and/or flattened (myofibroblast shape). Notably, 0.1% Venerinase® was able to revert UV-induced morphological changes and to restore the normal spindle shape fibroblasts. Pre-treatment of fibroblasts with the Venerinase® reference daily intake (see Table 1) also determined a statistically significant reduction in the expression of early fibrotic markers such as HDAC4 and SPARC when compared to the UV-treated group (° p < 0.05 vs. UV), as demonstrated by real-time PCR analyses, whereas no statistically significant changes were observed in the mRNA expression levels of ACTA2 (Figure 2B).
Moreover, Venerinase®-pretreated fibroblasts displayed a reduced α-SMA expression, with a parallel increase in P27 compared to non-treated UV-exposed cells, therefore suggesting Venerinase® possibly prevents the acquisition of a pro-fibrotic phenotype (Figure 2C).
At the same time, the expression of the senescence marker p21 assessed by a real-time PCR analysis was reduced by Venerinase® pretreatment (°° p < 0.01 vs. UV; Figure 2D).
With regard to inflammatory markers, real time PCR data confirmed statistically significant fold-change reductions in the mRNA levels of TNF-α and IL-6 (Figure 3A). In parallel, IF also showed a reduced expression of COX-1, thus confirming the possible anti-inflammatory role of Venerinase® (Figure 3B).

3.3. Venerinase®-Induced Changes in the Epidermis

The haematoxylin and eosin staining in Figure 4A shows that UV exposure induced cornification of the epidermis, with a significant reduction in the number of nuclei in the lower epidermal layers 24 h after UV irradiation. Normal stratification of the epidermis was restored by pre-treatment with Venerinase® at either a single or double dose (Figure 4A).
The IF analyses in Figure 4B show that CK1, normally expressed in epidermal suprabasal layers, is lost secondary to UV exposure, indicating a loss of normal cell morphology. Interestingly, a single dose of Venerinase® promoted an early reversion of UV-induced changes, which was more appreciable when a double dose was administered. PCNA, expressed by basal keratinocytes in control samples, was absent in UV-damaged skin. Epidermal exposure to Venerinase® before irradiation caused a significant enhancement in the PCNA expression in the basal layer both after single and double dose treatments (Figure 4B). Beclin-1, normally detected in the cytosol of healthy keratinocytes, reduced its expression following UVB exposure. Following Venerinase® pre-treatment with a double dose, beclin-1 nuclear translocation was observed in the epidermis.
As for DNA transcription, the total RNA concentration was higher in all Venerinase®-treated samples compared to non-treated UV-exposed skin (Table 3), suggesting the protective role of Venerinase® pre-treatment in terms of photodamage prevention at the nuclear level. Such evidence was also accompanied by statistically significant reductions in proinflammatory cytokine levels, including both IL6 and TNF-α (** p < 0.01 vs. ctrl; Figure 4C).

4. Discussion

The present study clearly demonstrates the beneficial effect in vitro on skin photoaging of pretreatment with a mixture of Rhodiola rosea, Tribulus terrestris, Moringa oleifera, Undaria pinnatifida, folic acid and vitamin B12.
Notably, UV exposure determines direct cell injury to keratinocytes and fibroblasts, mostly mediated by DNA damage. In line with this, our preliminary results on cell viability showed that UVB doses higher than 50 mJ/cm2 on cell monolayers determine cell damage and apoptosis after 24 h from exposure.
We then took into consideration the results collected after preventive treatment with Venerinase®. Interestingly, Venerinase® was able to reduce the pathological expressions of pro-fibrotic markers in fibroblasts induced by UV exposure, such as HDAC4 and SPARC, which are commonly produced upon pro-inflammatory stimuli and are therefore possibly associated with the so-called “inflammaging” [43,44]. The cytoprotective effects of Venerinase® were also confirmed by reduced myofibroblast phenotype acquisition by dermal fibroblasts, as shown by the decreased expression and cytoskeletal arrangement of α-SMA. Interestingly, Venerinase® pretreatment before UV exposure also reduced the expression of P21 in fibroblasts. It is well known that P21 is a powerful inhibitor of cyclin-dependent kinases, and is therefore considered a marker for cell senescence [45]. P21 also interacts with PCNA, a processivity factor for DNA polymerase with a regulatory function in DNA repair and replication during cell cycle; its enhanced expression is therefore possibly associated with DNA damage [46]. Even more importantly, pretreatment with Venerinase® determined significant reductions in the production of inflammaging-associated cytokines, such as TNFα and IL-6, compared to the non-treated controls after UV exposure both in the dermal and epidermal compartments [47]. A reduced COX-1 expression in the treatment group confirmed these results and indicated a reduced oxidative stress induction, thus highlighting the significant antioxidant action of this product [48]. In normal conditions, COX-1 displays mitochondrial expression, whereas a signal cytosolic translocation was observed after UV exposure [49]. Such a phenomenon was at least partially prevented by the use of Venerinase®.
When we looked more into detail at UV-induced changes in the epidermis, we noticed altered stratification and cell morphology, with cytoskeleton rearrangement possibly being a major contributing factor. A key role in the epidermal UV response is also played by beclin-1. Beclin-1 is a key activator in the initiation of autophagy and also seems to be involved in the regulation of skin pigmentation through melanosome degradation in both keratinocytes and melanocytes [50,51]. Not surprisingly, changes in the beclin-1 expression are observed after UV exposure.
All the aforementioned changes in the epidermal compartment are at least partially restored by pretreatment of keratinocyte sheets with Venerinase®.
Some evidence already exists on the efficacy of the single ingredients of the aforementioned formulation as antiaging therapeutic tools, the most studied certainly being Moringa oleifera.
A metabolomic analysis of Moringa oleifera leaves identified eight main groups of key metabolites, possibly explaining the moringa-mediated antiaging and anti-inflammatory action [52]. These include carotenoids, kaempferol, quercetin, glucosinolates, sulfolipids, fatty acyl amides and apigenin-O/C-glycosides.
Another recent publication revealed that M. oleifera leaf extracts possess good activities against skin-aging-related enzymes [53]. Elastase and collagenase inhibition was demonstrated through spectrophotometric and fluorometric assays, followed by ultrafiltration coupled to multi-target bio-affinity ultrafiltration and high-performance liquid chromatography–mass spectrometry for the identification of possible specific bioactive components with anti-aging properties.
Several authors have also tried to enhance Moringa’s bioavailability in order to boost its efficacy. With regard to this, flexible nanoliposome entrapment of isothiocyanates from the moringa tree demonstrated enhanced skin permeation and significant reductions in the expression of UVB-induced reactive oxygen species and matrix metalloproteinases [54].
The anti-aging effects of Moringa oleifera seem not to be limited to the skin. In a rat model, oral administration of an aqueous extract of M. oleifera leaves (200 mg/kg) for 30 days determined significant reductions in lipid peroxidation and lipofuscin pigmentation along with elevated serotonin and antioxidant enzymes in the brain tissue [55]. Other studies confirmed that Moringa alleviates stress and has a neuroprotective function in murine models [56]. These results suggest a beneficial role of oral supplementation with potential positive consequences far beyond the skin.
As for the other components of the Venerinase® product, the literature on natural remedies for preventing cutaneous aging also presents some evidence for this effect in Rhodiola and Undaria, while little is known with regard to Tribulus terrestris’ effects on the skin [22,36,37].
Plant extracts containing Rhodiola rosea have been demonstrated to extend lifespan in lower model organisms through IGF (insulin growth factor) signalling and have an antioxidant action [57,58,59]. Rhodiola-mediated antagonistic action on oxidative stress induced by UV has also been confirmed by in vitro studies on fibroblasts [35,36,60]. Last but not least, Undaria pinnatifida is a source of fucoidan, which has been shown to exert protective action against UV-induced photodamage in vitro due to inhibition of mitochondrial dysfunction mediated by the SIRT-1/PGC-1α signalling pathway [22,61].

5. Conclusions

The combination of Rhodiola rosea, Tribulus terrestris, Moringa oleifera, Undaria pinnatifida, vitamin B12 and folic acid was effective in the prevention of UV-mediated damage in vitro, thus supporting the potential clinical benefits of oral supplementation. Such extracts gave excellent results in vitro on cutaneous aging in terms of UV damage prevention both in the dermal and epidermal compartments. Further studies are needed to weigh the contribution of the single components in the global anti-aging effect and to possibly optimize and improve the efficacy of plant-based dietary supplements in this field.

Author Contributions

Methodology, investigation and data curation: A.P. (Alessia Paganelli), A.P. (Alessandra Pisciotta), G.B., R.D.T., N.T., G.O. and P.A.; data curation, A.P. (Alessia Paganelli), P.A. and L.B.; writing—original draft preparation, A.P. (Alessia Paganelli) and A.P. (Alessandra Pisciotta); writing—review and editing, P.A. and L.B.; supervision, project administration and funding acquisition, L.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research and the APC were funded by Cristalfarma srl.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are available from the authors upon reasonable request.

Conflicts of Interest

This research and the APC were funded by Cristalfarma srl. The authors declare no other conflicts of interest.

References

  1. Farage, M.A.; Miller, K.W.; Elsner, P.; Maibach, H.I. Intrinsic and Extrinsic Factors in Skin Ageing: A Review. Int. J. Cosmet. Sci. 2008, 30, 87–95. [Google Scholar] [CrossRef] [PubMed]
  2. Rees, J.L. The Genetics of Sun Sensitivity in Humans. Am. J. Hum. Genet. 2004, 75, 739–751. [Google Scholar] [CrossRef] [PubMed]
  3. Le Clerc, S.; Taing, L.; Ezzedine, K.; Latreille, J.; Delaneau, O.; Labib, T.; Coulonges, C.; Bernard, A.; Melak, S.; Carpentier, W.; et al. A Genome-Wide Association Study in Caucasian Women Points out a Putative Role of the STXBP5L Gene in Facial Photoaging. J. Investig. Dermatol. 2013, 133, 929–935. [Google Scholar] [CrossRef] [PubMed]
  4. Yaar, M.; Gilchrest, B.A. Photoageing: Mechanism, Prevention and Therapy. Br. J. Dermatol. 2007, 157, 874–887. [Google Scholar] [CrossRef] [PubMed]
  5. Lavker, R.M.; Gerberick, G.F.; Veres, D.; Irwin, C.J.; Kaidbey, K.H. Cumulative Effects from Repeated Exposures to Suberythemal Doses of UVB and UVA in Human Skin. J. Am. Acad. Dermatol. 1995, 32, 53–62. [Google Scholar] [CrossRef]
  6. Paganelli, A.; Mandel, V.D.; Kaleci, S.; Pellacani, G.; Rossi, E. Favre–Racouchot Disease: Systematic Review and Possible Therapeutic Strategies. J. Eur. Acad. Dermatol. Venereol. 2019, 33, 32–41. [Google Scholar] [CrossRef]
  7. Pezzini, C.; Ciardo, S.; Guida, S.; Kaleci, S.; Chester, J.; Casari, A.; Manfredini, M.; Longo, C.; Farnetani, F.; Brugués, A.O.; et al. Skin Ageing: Clinical Aspects and In Vivo Microscopic Patterns Observed with Reflectance Confocal Microscopy and Optical Coherence Tomography. Exp. Dermatol. 2022, 32, 348–358. [Google Scholar] [CrossRef]
  8. Kang, S. (Ed.) Fitzpatrick’s Dermatology, 9th ed.; McGraw-Hill Education: New York, NY, USA, 2019; ISBN 978-0-07-183779-8. [Google Scholar]
  9. Rossi, E.; Paganelli, A.; Mandel, V.D.; Pellacani, G. Favre-Racouchot Syndrome: Report of a Case Treated by Plasma Exeresis. J. Eur. Acad. Dermatol. Venereol. 2018, 32, e411–e413. [Google Scholar] [CrossRef]
  10. Paganelli, A.; Mandel, V.D.; Pellacani, G.; Rossi, E. Synergic Effect of Plasma Exeresis and Non-Cross-Linked Low and High Molecular Weight Hyaluronic Acid to Improve Neck Skin Laxities. J. Cosmet. Dermatol. 2020, 19, 55–60. [Google Scholar] [CrossRef]
  11. Ngoc, L.T.N.; Moon, J.-Y.; Lee, Y.-C. Antioxidants for Improved Skin Appearance: Intracellular Mechanism, Challenges, and Future Strategies. Int. J. Cosmet. Sci. 2023. online version of record before inclusion in an issue. [Google Scholar] [CrossRef]
  12. Qian, H.; Shan, Y.; Gong, R.; Lin, D.; Zhang, M.; Wang, C.; Wang, L. Mechanism of Action and Therapeutic Effects of Oxidative Stress and Stem Cell-Based Materials in Skin Aging: Current Evidence and Future Perspectives. Front. Bioeng. Biotechnol. 2022, 10, 1082403. [Google Scholar] [CrossRef]
  13. Cai, Y.; Zhong, Y.; Zhang, H.; Lu, P.-L.; Liang, Y.-Y.; Hu, B.; Wu, H. Association between Dietary Vitamin C and Telomere Length: A Cross-Sectional Study. Front. Nutr. 2023, 10, 1025936. [Google Scholar] [CrossRef]
  14. Ryu, T.K.; Lee, H.; Yon, D.K.; Nam, D.Y.; Lee, S.Y.; Shin, B.H.; Choi, G.W.; Jeon, D.S.; Oh, B.B.; Kim, J.H.; et al. The Antiaging Effects of a Product Containing Collagen and Ascorbic Acid: In Vitro, Ex Vivo, and Pre-Post Intervention Clinical Trial. PLoS ONE 2022, 17, e0277188. [Google Scholar] [CrossRef]
  15. Göllner, I.; Voss, W.; von Hehn, U.; Kammerer, S. Ingestion of an Oral Hyaluronan Solution Improves Skin Hydration, Wrinkle Reduction, Elasticity, and Skin Roughness: Results of a Clinical Study. J. Evid. Based Complement. Altern. Med. 2017, 22, 816–823. [Google Scholar] [CrossRef]
  16. Laing, S.; Bielfeldt, S.; Ehrenberg, C.; Wilhelm, K.-P. A Dermonutrient Containing Special Collagen Peptides Improves Skin Structure and Function: A Randomized, Placebo-Controlled, Triple-Blind Trial Using Confocal Laser Scanning Microscopy on the Cosmetic Effects and Tolerance of a Drinkable Collagen Supplement. J. Med. Food 2020, 23, 147–152. [Google Scholar] [CrossRef]
  17. Stephens, T.J.; Sigler, M.L.; Hino, P.D.; Moigne, A.L.; Dispensa, L. A Randomized, Double-Blind, Placebo-Controlled Clinical Trial Evaluating an Oral Anti-Aging Skin Care Supplement for Treating Photodamaged Skin. J. Clin. Aesthet. Dermatol. 2016, 9, 25–32. [Google Scholar]
  18. Reuter, J.; Merfort, I.; Schempp, C.M. Botanicals in Dermatology: An Evidence-Based Review. Am. J. Clin. Dermatol. 2010, 11, 247–267. [Google Scholar] [CrossRef]
  19. Liu, X.-X.; Chen, C.-Y.; Li, L.; Guo, M.-M.; He, Y.-F.; Meng, H.; Dong, Y.-M.; Xiao, P.-G.; Yi, F. Bibliometric Study of Adaptogens in Dermatology: Pharmacophylogeny, Phytochemistry, and Pharmacological Mechanisms. Drug Des. Devel. Ther. 2023, 17, 341–361. [Google Scholar] [CrossRef]
  20. Gopalakrishnan, L.; Doriya, K.; Kumar, D.S. Moringa oleifera: A Review on Nutritive Importance and Its Medicinal Application. Food Sci. Hum. Wellness 2016, 5, 49–56. [Google Scholar] [CrossRef]
  21. Bhattacharya, T.; Dey, P.S.; Akter, R.; Kabir, M.T.; Rahman, M.H.; Rauf, A. Effect of Natural Leaf Extracts as Phytomedicine in Curing Geriatrics. Exp. Gerontol. 2021, 150, 111352. [Google Scholar] [CrossRef]
  22. Jing, R.; Guo, K.; Zhong, Y.; Wang, L.; Zhao, J.; Gao, B.; Ye, Z.; Chen, Y.; Li, X.; Xu, N.; et al. Protective Effects of Fucoidan Purified from Undaria pinnatifida against UV-Irradiated Skin Photoaging. Ann. Transl. Med. 2021, 9, 1185. [Google Scholar] [CrossRef] [PubMed]
  23. Ajagun-Ogunleye, M.O.; Ebuehi, O.A.T. Evaluation of the Anti-Aging and Antioxidant Action of Ananas sativa and Moringa oleifera in a Fruit Fly Model Organism. J. Food Biochem. 2020, 44, e13426. [Google Scholar] [CrossRef] [PubMed]
  24. Choi, J.-Y.; Min, J.-Y.; Min, K.-B. Anti-Aging Protein Klotho Was Associated with Vitamin B12 Concentration in Adults. Medicine 2022, 101, e30710. [Google Scholar] [CrossRef] [PubMed]
  25. Sundarakumar, J.S.; Shahul Hameed, S.K.; SANSCOG Study Team; Ravindranath, V. Burden of Vitamin D, Vitamin B12 and Folic Acid Deficiencies in an Aging, Rural Indian Community. Front. Public Health 2021, 9, 707036. [Google Scholar] [CrossRef]
  26. Wong, C.W. Vitamin B12 Deficiency in the Elderly: Is It Worth Screening? Hong Kong Med. J. 2015, 21, 155–164. [Google Scholar] [CrossRef]
  27. Ye, S.; Zhou, X.; Chen, P.; Lin, J.-F. Folic Acid Attenuates Remodeling and Dysfunction in the Aging Heart through the ER Stress Pathway. Life Sci. 2021, 264, 118718. [Google Scholar] [CrossRef]
  28. Garcez, M.L.; Cassoma, R.C.S.; Mina, F.; Bellettini-Santos, T.; da Luz, A.P.; Schiavo, G.L.; Medeiros, E.B.; Campos, A.C.B.F.; da Silva, S.; Rempel, L.C.T.; et al. Folic Acid Prevents Habituation Memory Impairment and Oxidative Stress in an Aging Model Induced by D-Galactose. Metab. Brain Dis. 2021, 36, 213–224. [Google Scholar] [CrossRef]
  29. Li, Z.; Zhou, D.; Zhang, D.; Zhao, J.; Li, W.; Sun, Y.; Chen, Y.; Liu, H.; Wilson, J.X.; Qian, Z.; et al. Folic Acid Inhibits Aging-Induced Telomere Attrition and Apoptosis in Astrocytes In Vivo and In Vitro. Cereb. Cortex 2022, 32, 286–297. [Google Scholar] [CrossRef]
  30. Yusharyahya, S.N.; Japranata, V.V.; Sitohang, I.B.S.; Legiawati, L.; Novianto, E.; Suseno, L.S.; Rachmani, K. A Comparative Study on Adipose-Derived Mesenchymal Stem Cells Secretome Delivery Using Microneedling and Fractional CO2 Laser for Facial Skin Rejuvenation. Clin. Cosmet. Investig. Dermatol. 2023, 16, 387–395. [Google Scholar] [CrossRef]
  31. Gouveri, E.; Papanas, N. Τhe Endless Beauty of Metformin: Does It Also Protect from Skin Aging? A Narrative Review. Adv. Ther. 2023, 40, 1347–1356. [Google Scholar] [CrossRef]
  32. Trotzier, C.; Sequeira, I.; Auxenfans, C.; Mojallal, A.A. Fat Graft Retention: Adipose Tissue, Adipose-Derived Stem Cells, and Aging. Plast Reconstr. Surg. 2023, 151, 420e–431e. [Google Scholar] [CrossRef]
  33. Miatmoko, A.; Hariawan, B.S.; Cahyani, D.M.; Dewangga, S.S.; Handoko, K.K.; Purwati, N.; Sahu, R.K.; Hariyadi, D.M. Prospective Use of Amniotic Mesenchymal Stem Cell Metabolite Products for Tissue Regeneration. J. Biol. Eng. 2023, 17, 11. [Google Scholar] [CrossRef]
  34. Baldisserotto, A.; Buso, P.; Radice, M.; Dissette, V.; Lampronti, I.; Gambari, R.; Manfredini, S.; Vertuani, S. Moringa oleifera Leaf Extracts as Multifunctional Ingredients for “Natural and Organic” Sunscreens and Photoprotective Preparations. Molecules 2018, 23, 664. [Google Scholar] [CrossRef]
  35. Fu, H.; Zhang, Y.; An, Q.; Wang, D.; You, S.; Zhao, D.; Zhang, J.; Wang, C.; Li, M. Anti-Photoaging Effect of Rhodiola rosea Fermented by Lactobacillus Plantarum on UVA-Damaged Fibroblasts. Nutrients 2022, 14, 2324. [Google Scholar] [CrossRef]
  36. Schriner, S.E.; Avanesian, A.; Liu, Y.; Luesch, H.; Jafari, M. Protection of Human Cultured Cells against Oxidative Stress by Rhodiola rosea without Activation of Antioxidant Defenses. Free. Radic. Biol. Med. 2009, 47, 577–584. [Google Scholar] [CrossRef]
  37. Sisto, M.; Lisi, S.; D’Amore, M.; Lucro, R.D.; Carati, D.; Castellana, D.; Pesa, V.L.; Zuccarello, V.; Lofrumento, D.D. Saponins from Tribulus terrestris L. Protect Human Keratinocytes from UVB-Induced Damage. J. Photochem. Photobiol. B Biol. 2012, 117, 193–201. [Google Scholar] [CrossRef]
  38. Pisciotta, A.; Bertani, G.; Bertoni, L.; Di Tinco, R.; De Biasi, S.; Vallarola, A.; Pignatti, E.; Tupler, R.; Salvarani, C.; de Pol, A.; et al. Modulation of Cell Death and Promotion of Chondrogenic Differentiation by Fas/FasL in Human Dental Pulp Stem Cells (HDPSCs). Front. Cell Dev. Biol. 2020, 8, 279. [Google Scholar] [CrossRef]
  39. Luangpraditkun, K.; Charoensit, P.; Grandmottet, F.; Viennet, C.; Viyoch, J. Photoprotective Potential of the Natural Artocarpin against In Vitro UVB-Induced Apoptosis. Oxid. Med. Cell. Longev. 2020, 2020, 1042451. [Google Scholar] [CrossRef]
  40. Kang, Y.-M.; Hong, C.-H.; Kang, S.-H.; Seo, D.-S.; Kim, S.-O.; Lee, H.-Y.; Sim, H.-J.; An, H.-J. Anti-Photoaging Effect of Plant Extract Fermented with Lactobacillus Buchneri on CCD-986sk Fibroblasts and HaCaT Keratinocytes. J. Funct. Biomater. 2020, 11, 3. [Google Scholar] [CrossRef]
  41. Di Tinco, R.; Bertani, G.; Pisciotta, A.; Bertoni, L.; Pignatti, E.; Maccaferri, M.; Bertacchini, J.; Sena, P.; Vallarola, A.; Tupler, R.; et al. Role of PD-L1 in Licensing Immunoregulatory Function of Dental Pulp Mesenchymal Stem Cells. Stem. Cell Res. Ther. 2021, 12, 598. [Google Scholar] [CrossRef]
  42. Bertani, G.; Di Tinco, R.; Bertoni, L.; Orlandi, G.; Pisciotta, A.; Rosa, R.; Rigamonti, L.; Signore, M.; Bertacchini, J.; Sena, P.; et al. Flow-Dependent Shear Stress Affects the Biological Properties of Pericyte-like Cells Isolated from Human Dental Pulp. Stem. Cell Res. Ther. 2023, 14, 31. [Google Scholar] [CrossRef] [PubMed]
  43. Maltzman, J.S. A SPARC-Ling Link to Inflammaging. Sci. Immunol. 2022, 7, eade5698. [Google Scholar] [CrossRef] [PubMed]
  44. Paluvai, H.; Di Giorgio, E.; Brancolini, C. Unscheduled HDAC4 Repressive Activity in Human Fibroblasts Triggers TP53-Dependent Senescence and Favors Cell Transformation. Mol. Oncol. 2018, 12, 2165–2181. [Google Scholar] [CrossRef] [PubMed]
  45. Chen, A.; Huang, X.; Xue, Z.; Cao, D.; Huang, K.; Chen, J.; Pan, Y.; Gao, Y. The Role of P21 in Apoptosis, Proliferation, Cell Cycle Arrest, and Antioxidant Activity in UVB-Irradiated Human HaCaT Keratinocytes. Med. Sci. Monit. Basic Res. 2015, 21, 86–95. [Google Scholar] [CrossRef]
  46. Karimian, A.; Ahmadi, Y.; Yousefi, B. Multiple Functions of P21 in Cell Cycle, Apoptosis and Transcriptional Regulation after DNA Damage. DNA Repair 2016, 42, 63–71. [Google Scholar] [CrossRef]
  47. Michaud, M.; Balardy, L.; Moulis, G.; Gaudin, C.; Peyrot, C.; Vellas, B.; Cesari, M.; Nourhashemi, F. Proinflammatory Cytokines, Aging, and Age-Related Diseases. J. Am. Med. Dir. Assoc. 2013, 14, 877–882. [Google Scholar] [CrossRef]
  48. Mahmoud, Y.I.; Abd El-Ghffar, E.A. Spirulina Ameliorates Aspirin-Induced Gastric Ulcer in Albino Mice by Alleviating Oxidative Stress and Inflammation. Biomed. Pharmacother. 2019, 109, 314–321. [Google Scholar] [CrossRef]
  49. Patel, N.; Ivantsova, E.; Konig, I.; Souders, C.L.; Martyniuk, C.J. Perfluorotetradecanoic Acid (PFTeDA) Induces Mitochondrial Damage and Oxidative Stress in Zebrafish (Danio rerio) Embryos/Larvae. Toxics 2022, 10, 776. [Google Scholar] [CrossRef]
  50. Kim, J.Y.; Kim, J.; Ahn, Y.; Lee, E.J.; Hwang, S.; Almurayshid, A.; Park, K.; Chung, H.-J.; Kim, H.J.; Lee, S.-H.; et al. Autophagy Induction Can Regulate Skin Pigmentation by Causing Melanosome Degradation in Keratinocytes and Melanocytes. Pigment Cell Melanoma Res. 2020, 33, 403–415. [Google Scholar] [CrossRef]
  51. Wang, J.; Kaplan, N.; Wang, S.; Yang, W.; Wang, L.; He, C.; Peng, H. Autophagy Plays a Positive Role in Induction of Epidermal Proliferation. FASEB J. 2020, 34, 10657–10667. [Google Scholar] [CrossRef]
  52. Abdel Shakour, Z.T.; El-Akad, R.H.; Elshamy, A.I.; El Gendy, A.E.-N.G.; Wessjohann, L.A.; Farag, M.A. Dissection of Moringa oleifera Leaf Metabolome in Context of Its Different Extracts, Origin and in Relationship to Its Biological Effects as Analysed Using Molecular Networking and Chemometrics. Food Chem. 2023, 399, 133948. [Google Scholar] [CrossRef]
  53. Xu, Y.; Chen, G.; Guo, M. Potential Anti-Aging Components From Moringa oleifera Leaves Explored by Affinity Ultrafiltration With Multiple Drug Targets. Front. Nutr. 2022, 9, 854882. [Google Scholar] [CrossRef]
  54. Wang, Y.; Ouyang, Q.; Chang, X.; Yang, M.; He, J.; Tian, Y.; Sheng, J. Anti-Photoaging Effects of Flexible Nanoliposomes Encapsulated Moringa oleifera Lam. Isothiocyanate in UVB-Induced Cell Damage in HaCaT Cells. Drug Deliv. 2022, 29, 871–881. [Google Scholar] [CrossRef]
  55. Nair, D.A.; James, T.J.; Sreelatha, S.L.; Kariyil, B.J.; Nair, S.N. Moringa oleifera (Lam.): A Natural Remedy for Ageing? Nat. Prod. Res. 2021, 35, 6216–6222. [Google Scholar] [CrossRef]
  56. Purwoningsih, E.; Arozal, W.; Lee, H.J.; Barinda, A.J.; Sani, Y.; Munim, A. The Oil Formulation Derived from Moringa oleifera Seeds Ameliorates Behavioral Abnormalities in Water-Immersion Restraint Stress Mouse Model. J. Exp. Pharmacol. 2022, 14, 395–407. [Google Scholar] [CrossRef]
  57. Chattopadhyay, D.; Thirumurugan, K. Longevity Promoting Efficacies of Different Plant Extracts in Lower Model Organisms. Mech. Ageing Dev. 2018, 171, 47–57. [Google Scholar] [CrossRef]
  58. Jafari, M.; Felgner, J.S.; Bussel, I.I.; Hutchili, T.; Khodayari, B.; Rose, M.R.; Vince-Cruz, C.; Mueller, L.D. Rhodiola: A Promising Anti-Aging Chinese Herb. Rejuvenation Res. 2007, 10, 587–602. [Google Scholar] [CrossRef]
  59. Rutledge, G.A.; Phang, H.J.; Le, M.N.; Bui, L.; Rose, M.R.; Mueller, L.D.; Jafari, M. Diet and Botanical Supplementation: Combination Therapy for Healthspan Improvement? Rejuvenation Res. 2021, 24, 331–344. [Google Scholar] [CrossRef]
  60. Agapouda, A.; Grimm, A.; Lejri, I.; Eckert, A. Rhodiola rosea Extract Counteracts Stress in an Adaptogenic Response Curve Manner via Elimination of ROS and Induction of Neurite Outgrowth. Oxidative Med. Cell. Longev. 2022, 2022, 1–19. [Google Scholar] [CrossRef]
  61. Pangestuti, R.; Shin, K.-H.; Kim, S.-K. Anti-Photoaging and Potential Skin Health Benefits of Seaweeds. Mar. Drugs 2021, 19, 172. [Google Scholar] [CrossRef]
Cosmetics 10 00083 g001 550
Figure 1. Evaluation of cell viability in fibroblasts. Cell viability (expressed as % of viable cells) in fibroblasts treated with different concentrations of Venerinase® (2%, 1%, 0.1%, 0.01%, 0.005%) was investigated to define the working concentration to be used for the subsequent experimental evaluations. Data are expressed as means ± standard deviation (SD) and analysed by a one-way analysis of variance (ANOVA) followed by a Newman–Keuls post hoc test. Statistically significant differences were set at p < 0.05.
Figure 1. Evaluation of cell viability in fibroblasts. Cell viability (expressed as % of viable cells) in fibroblasts treated with different concentrations of Venerinase® (2%, 1%, 0.1%, 0.01%, 0.005%) was investigated to define the working concentration to be used for the subsequent experimental evaluations. Data are expressed as means ± standard deviation (SD) and analysed by a one-way analysis of variance (ANOVA) followed by a Newman–Keuls post hoc test. Statistically significant differences were set at p < 0.05.
Cosmetics 10 00083 g001
Cosmetics 10 00083 g002 550
Figure 2. Evaluation of Venerinase® pre-treatment effects on UV-exposed human fibroblasts. (A) A cell morphology analysis was carried out through phalloidin staining. Nuclei were counterstained with DAPI (blue). Scale bar: 10 μm. (B) Real time PCR analyses of fibrosis-associated markers ACTA2, HDAC4 and SPARC. Histograms report the percentage fold change in the mean values of mRNA levels ± standard deviation (SD). One-way analysis of variance (ANOVA) followed by Newman–Keuls post hoc test. ° p < 0.05 vs. UV. (C) Confocal immunofluorescence analysis for p27 and α-SMA. Scale bar: 10 μm. (D) Real time PCR analysis of mRNA levels of p21. Histograms represent mean values ± standard deviation (SD). One-way ANOVA followed by Newman–Keuls post hoc test. °° p < 0.01 vs. UV.
Figure 2. Evaluation of Venerinase® pre-treatment effects on UV-exposed human fibroblasts. (A) A cell morphology analysis was carried out through phalloidin staining. Nuclei were counterstained with DAPI (blue). Scale bar: 10 μm. (B) Real time PCR analyses of fibrosis-associated markers ACTA2, HDAC4 and SPARC. Histograms report the percentage fold change in the mean values of mRNA levels ± standard deviation (SD). One-way analysis of variance (ANOVA) followed by Newman–Keuls post hoc test. ° p < 0.05 vs. UV. (C) Confocal immunofluorescence analysis for p27 and α-SMA. Scale bar: 10 μm. (D) Real time PCR analysis of mRNA levels of p21. Histograms represent mean values ± standard deviation (SD). One-way ANOVA followed by Newman–Keuls post hoc test. °° p < 0.01 vs. UV.
Cosmetics 10 00083 g002
Cosmetics 10 00083 g003 550
Figure 3. Inflammatory cytokines and oxidative stress in human fibroblasts after Venerinase® pre-treatment and UV exposure. (A) Real-time PCR analyses of inflammatory cytokines TNFα and IL-6 in human fibroblasts. Histograms report the percentage fold change in mean values of mRNA levels ± standard deviation (SD). One-way analysis of variance (ANOVA) followed by Newman–Keuls post hoc test. °° p < 0.01, °°° p < 0.001 vs. UV; ** p < 0.01 vs. ctrl. (B) Confocal immunofluorescence analysis of COX-1. Nuclei were counterstained with DAPI (blue). Scale bar: 10 μm.
Figure 3. Inflammatory cytokines and oxidative stress in human fibroblasts after Venerinase® pre-treatment and UV exposure. (A) Real-time PCR analyses of inflammatory cytokines TNFα and IL-6 in human fibroblasts. Histograms report the percentage fold change in mean values of mRNA levels ± standard deviation (SD). One-way analysis of variance (ANOVA) followed by Newman–Keuls post hoc test. °° p < 0.01, °°° p < 0.001 vs. UV; ** p < 0.01 vs. ctrl. (B) Confocal immunofluorescence analysis of COX-1. Nuclei were counterstained with DAPI (blue). Scale bar: 10 μm.
Cosmetics 10 00083 g003
Cosmetics 10 00083 g004 550
Figure 4. Protective effects of Venerinase® pre-treatment on UV-exposed epidermis. (A) Histological analysis of EpiDerm samples from each experimental group. H&E staining showing the effects of Venerinase® pre-treatments (Venerinase® 1, corresponding to t0 administration and Venerinase® 2 corresponding to t0 and t24 h administration) on UV-irradiated EpiDerm stratification. Scale bar: 50 μm. (B) Confocal analysis of CK1, PCNA and beclin-1. Nuclei were counterstained with DAPI (blue). Scale bar: 20 μm. (C) Real-time PCR analyses of IL-6 and TNFα in UV-exposed EpiDerm previously treated with a double dose of Venerinase®. Histograms report the fold change in mRNA levels indicated as means ± standard deviation (SD). One-way analysis of variance (ANOVA) followed by Newman–Keuls post hoc test. ** p < 0.01 vs. ctrl.
Figure 4. Protective effects of Venerinase® pre-treatment on UV-exposed epidermis. (A) Histological analysis of EpiDerm samples from each experimental group. H&E staining showing the effects of Venerinase® pre-treatments (Venerinase® 1, corresponding to t0 administration and Venerinase® 2 corresponding to t0 and t24 h administration) on UV-irradiated EpiDerm stratification. Scale bar: 50 μm. (B) Confocal analysis of CK1, PCNA and beclin-1. Nuclei were counterstained with DAPI (blue). Scale bar: 20 μm. (C) Real-time PCR analyses of IL-6 and TNFα in UV-exposed EpiDerm previously treated with a double dose of Venerinase®. Histograms report the fold change in mRNA levels indicated as means ± standard deviation (SD). One-way analysis of variance (ANOVA) followed by Newman–Keuls post hoc test. ** p < 0.01 vs. ctrl.
Cosmetics 10 00083 g004
Table
Table 1. Venerinase® composition corresponding to the reference daily intake. Each component was dissolved in its solvent as indicated.
Table 1. Venerinase® composition corresponding to the reference daily intake. Each component was dissolved in its solvent as indicated.
ComponentsmgSolvent
Rhodiola rosea400EtOH 50%
Tribulus terrestris350H2O
Moringa oleifera150H2O
Undaria pinnatifida50H2O
Folic acid0.2NaOH 0.1 N
Vitamin B120.0025EtOH 50%
Table
Table 2. List of PCR primers sequences used.
Table 2. List of PCR primers sequences used.
Target GeneForward SequenceReverse Sequence
ACTA2AATGCAGAAGGAGATCACGGTCCTGTTTGCTGATCCACATC
HDAC4ACAAGGAGAAGGGCAAAGAGGCGTTTTCCCGTACCAGTAG
SPARCCAAGAAGCCCTGCCTGATGATGGGAGAGGTACCCGTCAAT
p21AGGTGGACCTGGAGACTCTCAGTCCTCTTGGAGAAGATCAGCCG
IL-6AGACAGCCACTCACCTCTTCAGTTCTGCCAGTGCCTCTTTGCTG
TNF-αCTCTTCTGCCTGCTGCACTTTGATGGGCTACAGGCTTGTCACTC
Table
Table 3. Extraction and quantification of RNA from EpiDerm samples. CTRL: untreated EpiDerm; UV: UV-exposed EpiDerm; UV + Venerinase® 1: UV-exposed EpiDerm pre-treated with a single dose of Venerinase®; UV + Venerinase® 2: UV-exposed EpiDerm pre-treated with a double dose of Venerinase®.
Table 3. Extraction and quantification of RNA from EpiDerm samples. CTRL: untreated EpiDerm; UV: UV-exposed EpiDerm; UV + Venerinase® 1: UV-exposed EpiDerm pre-treated with a single dose of Venerinase®; UV + Venerinase® 2: UV-exposed EpiDerm pre-treated with a double dose of Venerinase®.
Tissue Weight (mg)RNA Concentration (ng/μL)
CTRL3136
UV3.12.4
UV + Venerinase® 14.539.1
UV + Venerinase® 24.7133.2
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Paganelli, A.; Pisciotta, A.; Bertani, G.; Di Tinco, R.; Tagliaferri, N.; Orlandi, G.; Azzoni, P.; Bertoni, L. Food Supplements for Skin Health: In Vitro Efficacy of a Combination of Rhodiola rosea, Tribulus terrestris, Moringa oleifera and Undaria pinnatifida on UV-Induced Damage. Cosmetics 2023, 10, 83. https://doi.org/10.3390/cosmetics10030083

AMA Style

Paganelli A, Pisciotta A, Bertani G, Di Tinco R, Tagliaferri N, Orlandi G, Azzoni P, Bertoni L. Food Supplements for Skin Health: In Vitro Efficacy of a Combination of Rhodiola rosea, Tribulus terrestris, Moringa oleifera and Undaria pinnatifida on UV-Induced Damage. Cosmetics. 2023; 10(3):83. https://doi.org/10.3390/cosmetics10030083

Chicago/Turabian Style

Paganelli, Alessia, Alessandra Pisciotta, Giulia Bertani, Rosanna Di Tinco, Nadia Tagliaferri, Giulia Orlandi, Paola Azzoni, and Laura Bertoni. 2023. "Food Supplements for Skin Health: In Vitro Efficacy of a Combination of Rhodiola rosea, Tribulus terrestris, Moringa oleifera and Undaria pinnatifida on UV-Induced Damage" Cosmetics 10, no. 3: 83. https://doi.org/10.3390/cosmetics10030083

APA Style

Paganelli, A., Pisciotta, A., Bertani, G., Di Tinco, R., Tagliaferri, N., Orlandi, G., Azzoni, P., & Bertoni, L. (2023). Food Supplements for Skin Health: In Vitro Efficacy of a Combination of Rhodiola rosea, Tribulus terrestris, Moringa oleifera and Undaria pinnatifida on UV-Induced Damage. Cosmetics, 10(3), 83. https://doi.org/10.3390/cosmetics10030083

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop