Next Article in Journal
Phytochemical Constituents and Allelopathic Potential of Parthenium hysterophorus L. in Comparison to Commercial Herbicides to Control Weeds
Previous Article in Journal
Growth Promotion or Osmotic Stress Response: How SNF1-Related Protein Kinase 2 (SnRK2) Kinases Are Activated and Manage Intracellular Signaling in Plants
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 10
Issue 7
10.3390/plants10071444
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri)

by
Kaijie Qi
1,†,
Xiaofei Song
1,†,
Yazhou Yuan
1,
Jianping Bao
2,
Xin Gong
1,
Xiaosan Huang
1,
Shahrokh Khanizadeh
3,
Shaoling Zhang
1 and
Shutian Tao
1,*
1
Pear Engineering Research Centre, College of Horticulture, Nanjing Agricultural University, 1 Weigang, Nanjing 210095, China
2
College of Plant Science, Tarim University, Ala’er City 843300, China
3
ELM Consulting Inc., St-Lazare, QC J7T, Canada
*
Author to whom correspondence should be addressed.
†
Kaijie Qi and Xiaofei Song are contributed equally to this work.
Plants 2021, 10(7), 1444; https://doi.org/10.3390/plants10071444
Submission received: 26 June 2021 / Revised: 12 July 2021 / Accepted: 13 July 2021 / Published: 15 July 2021
Browse Figures
Review Reports Versions Notes

Abstract

:
The synthetic enzyme cinnamyl alcohol dehydrogenase (CAD) is involved in responses to various stresses during plant growth. It regulates the monolignol biosynthesis and catalyzes hydroxyl cinnamaldehyde reduction to the corresponding alcohols. Although the CAD gene families have been explored in some species, little known is in Rosaceae. In this study, we identified 149 genes in Pyrus bretschneideri (PbrCAD), Malus domestica (MDPCAD), Prunus mume (PmCAD) and Fragaria vesca (mrnaCAD). They were phylogenetically clustered into six subgroups. All CAD genes contained ADH-N and ADH-zinc-N domains and were distributed on chromosomes unevenly. Dispersed and WGD/segmental duplications accounted the highest number of evolutionary events. Eight collinear gene pairs were identified among the four Rosaceae species, and the highest number was recorded in pear as five pairs. The five PbrCAD gene pairs had undergone purifying selection under Ka/Ks analysis. Furthermore, nine genes were identified based on transcriptomic and stone cell content in pear fruit. In qRT-PCR, the expression patterns of PbrCAD1, PbrCAD20, PbrCAD27, and PbrCAD31 were consistent with variation in stone cell content during pear fruit development. These results will provide valuable information for understanding the relationship between gene expressions and stone cell number in fruit.

1. Introduction

In plants, the phenolic polymer lignin plays crucial roles in water retention, mechanical support, and protection [1,2,3]. However, the content of lignin also greatly affects the quality of some fruits, reducing the flavor and quality [4,5]. The process of cell wall lignification involves in many enzymes and corresponding genes [6,7]. Cinnamyl alcohol dehydrogenase (CAD) is a key enzyme in the lignin biosynthesis, and the activity of CAD affects the lignin content and monomer composition [8,9]. CAD catalyzes the reduction of p-coumaraldehyde, coniferaldehyde, and sinapaldehyde to the corresponding hydroxycinnamyl alcohols (monolignols) under the NADPH, then further transformed into lignin as p-hydroxyphenyl (H), guaiacyl (G), and syringyl (S) units [10,11,12,13]. Until now, the CAD gene families and their homologs have been identified in various plants [12,14,15,16,17,18].
Pear (Pyrus) is the third largest species of fruit tree and is very popular among consumers. Pear fruits have high nutritional value and many medicinal properties [19]. The presence of sclereids is an important factor that affects the pear quality [20]. The deposition of lignin in the cell wall forms the stone cells in pear, and the lignin content in stone cells is over 29.8% [5]. More and more genes in the lignin synthesis have been identified in pears after the completion of pear genome sequencing and assembly, such as cinnamate 4-hydroxylase base pai (C4H), hydroxycinnamoyl-coenzyme A shikimate/quinate hydroxycinnamoyl transferase (HCT), cinnamoyl-CoA reductase (CCR), etc. Furthermore, no studies have identified the CAD gene family in lignin biosynthesis in pear.
In this study, we identified the members of the CAD gene family in the pear and three other Rosaceae species. We also analyzed the phylogenetic relationships, structures, conserved motifs, synteny, ontology and expression patterns of these genes with the transcriptomic data of PbrCAD gene family.

2. Results

2.1. Identification of the CAD Gene Family in Rosaceae

In this study, a total of 234 candidate CAD genes were identified. However, 85 candidate genes without CAD domains were discarded using the Pfam and SMART databases. Consequently, 149 CAD genes were identified in Rosaceae, including 57 in pear, 34 in Chinese plum, 42 in apple, and 16 in strawberry, named as PbrCAD1-PbrCAD57, MDPCAD1-MDPCAD42, PmCAD1-PmCAD34, and mrnaCAD1-mrnaCAD16, respectively (Table 1 and Supplementary Table S1).

2.2. Phylogenetic Analysis of the CAD Genes

The CAD proteins were classified into six main families (Figure 1), designated as clade 1 to 6: C1 (35 proteins), C2 (30), C3 (27), C4 (25), C5 (18), and C6 (14). Furthermore, we detected the specific domains in different colors to mark the branches of genes with particular domains (Figure 1). Each subgroup harbored at least one specific domain without C5. The C1 subgroup also harbored four specific domains and the percentage of members in this group was higher than other subgroups. Three genes in C3 contained the same specific domain (adh short) and they were adjacent in the phylogenetic tree. The remaining two subgroups only contained one specific domain (Figure 1).

2.3. Expansion and Evolution of the CAD Gene Family

Each member was assigned to one of the five different categories, as WGD/segmental, singleton, tandem, proximal, or dispersed. In this study, three types of duplication events contributed to the expansion of CAD gene family (Table 2 and Supplementary Table S2). There were three duplication modes in the pear and only two duplication types in other three Rosaceae species. The dispersed CAD genes in apple (95.2%), Chinese plum (58.8%), pear (43.9%), and strawberry (43.8%) accounted for more than half of the total number of genes. However, 56.2% (9) CAD genes in strawberry and 42.1% (24) in pear were duplicated and retained from WGD/segmental duplication compared with only 38.2% (13) and 4.8% (two) in apple. The higher proportion of WGD/segmental duplication in pear and strawberry might be attributed to the recent lineage-specific WGD events (30–45 MYA) [21]. Thus, dispersed and WGD/segmental duplications played critical roles in the expansion of CAD gene family.

2.4. Chromosome Distribution and Synteny Events

Here, the PbrCAD genes were distributed randomly on the 11 of 17 pear chromosomes (Figure 2 and Supplementary Table S3). A total of 53 PbrCAD genes were mapped on chromosomes and four on scaffolds. Chromosome 10 contained the highest number of PbrCAD genes (10 genes), whereas chromosomes 3 and 14 exhibited only one. Similar to the PbrCAD genes, the distributions of the CAD genes in other three Rosaceae genomes were non-uniform (Figure 2 and Supplementary Table S3).
In this study, we segmentally searched the duplicated blocks within the genomes of four Rosaceae species. There were eight collinear gene pairs in the four Rosaceae species, including five pairs in pear (PbrCAD19-PbrCAD22, PbrCAD24-PbrCAD35, PbrCAD25-PbrCAD27, PbrCAD26-PbrCAD29, and PbrCAD39-PbrCAD50), three pairs in apple (MDPCAD3-MDPCAD20, MDPCAD10-MDPCAD23, and MDPCAD11-MDPCAD24), and one pair in Chinese plum (PmCAD15-PmCAD29). However, the MDPCAD3 was located on an unanchored scaffold (Figure 2).
Furthermore, we calculated the Ka/Ks ratio for the five PbrCAD gene pairs to assess the selection pressure among the duplicated PbrCAD genes. All the Ka/Ks ratios were <1 (Table 3), implying that they had undergone strong purifying selection and played a critical role in evolution of the CAD genes [22].

2.5. CAD Gene Structure and CAD Protein Motif Analyses in Pear

In this study, the PbrCAD genes were divided into seven subgroups (A1–A7) with high bootstrap support. The 57 PbrCAD genes were unequally distributed in each subgroup (Figure 3a). For instance, the A5 subgroup was the largest with 13 members, whereas the A6 subgroup only included four members (Figure 3a).
An exon-intron analysis was performed on the PbrCAD genes to gain insight into the diversity of the structure of these genes (Figure 3b and Supplementary Table S4). All of the PbrCAD genes contained both exons and introns. Moreover, the majority members in the same subgroup contained the similar exon-intron organizations. Most PbrCAD genes in subgroup A2 contained five exons and four introns, while those in subgroup A3 contained six exons and five introns. The PoptrCAD gene family exhibited three different gene structures [14]. These three patterns (I, II, III) were composed of 5, 5, and 6 exons, respectively, and patterns I and II differred in the length of exons 3 and 4, with exon 3 being longer than exon 4 belongs in pattern I. Patterns I and II were generally present in eudicots and monocots, while pattern III was found in eudicots and magnolia plants, as well as in gymnosperms [14]. We discovered that eight genes belonged to pattern I, 10 genes belonged to pattern II, and 13 genes belonged to pattern III in the PbrCAD gene family (Figure 3b and Supplementary Table S4), accounting for more than 50% of all genes.
Subsequently, a total of 25 conserved motifs were identified, and the logos of these motifs were showed in Supplementary Table S5. Most of the closely related members within the same subgroup had a similar motif composition and arrangement (Figure 3c). Among these motifs, motifs 1, 6, and 8 were detected in most of the PbrCAD genes, indicating that these motifs were the major conserved domains of the PbrCAD family.

2.6. Histochemical Test and the Content of Stone Cells during Fruit Development

The pear contained a low stone cell content at the early stage of fruit development (Figure 4). Subsequently, it reached a peak at the middle stage of development, and finally declined gradually over the course of fruit maturation. The stone cell clusters were mainly distributed in the fruit core and pericarp through the staining of longitudinal and transverse sections of fruit revealed (Figure 5). Similar to the trend of stone cell contents, the distribution of stone cell clusters reached the maximum at the middle stage of development. It can be inferred that the middle stage of fruit development is a key period for the formation of lignin and stone cell.

2.7. Expression Patterns of the PbrCAD Genes

In this study, 51 PbrCAD genes were expressed in pear fruit through the development transcriptome sequencing (RNA-Seq) data (Supplementary Table S6) [19,20]. Nine genes exhibited high and stage-specific expressions during the development of the pear fruit (Figure 6 and Supplementary Table S6). Subsequently, four of the seven genes were consistent with the RNA-Seq data (without PbrCAD39, PbrCAD41, and PbrCAD43) by the qRT-PCR analysis (Figure 7).
PbrCAD1, PbrCAD20, PbrCAD27, and PbrCAD31 were expressed at lower levels during the early stage of fruit development, achieved the highest levels of expression at the middle stage, and decreased gradually at the fruit-ripening stage. Furthermore, compared with the physiological data (Figure 5 and Figure 6), the relative expressions of the four genes were in agreement with the changes in lignin physiology. These results demonstrated that these four genes may be involved in the regulation of lignin synthesis in pear fruit.

3. Discussion

In our study, the distribution of the CAD genes identified from Rosaceae was unequal. A total of 57 PbrCAD genes, 42 MDPCAD genes, 36 PmCAD genes, and 16 mrnaCAD genes were discovered. The CAD gene family in pear was larger than that of the three other Rosaceae species, which may be related to the peculiar traits of the presence of stone cells in pear.
The phylogenetic tree classified the CAD proteins into six subgroups: C1–C6. Interestingly, each subgroup involved at least one specific domain, with the exception of clade 5. The different modes of gene duplications were important for genomic rearrangement and expansion, and the diversification of gene function [23]. The dispersed duplication and WGD/segmental duplication played critical roles in the expansion of the CAD gene family. The insertion and mediation of transposons on distant single-gene translocations may explain the wide spread of the dispersed duplicates [24], which accounted for 43.9% (25) of the PbrCAD genes. Our chromosomal-location analysis showed that the distribution of the CAD genes in Rosaceae genomes had different densities. The Ka/Ks ratios of five collinear CAD gene pairs were <1, suggesting that these genes were evolved under the influence of purifying selection.
We explored the phylogenetic tree, gene structure, and conserved motifs to identify the evolutionary relationship of the CAD gene family in pear. These PbrCAD genes were classified into seven subgroups, most of the adjacent members contained similar exon-intron organizations and motifs in the same subgroups. Populus exhibits three different CAD gene structure patterns [14], and PbrCAD gene structures accounted for more than 50%. Otherwise, the PbrCAD genes contained an additional seven gene structures. In addition, Oryza had fewer CAD genes than Populus and exhibited the greatest number of intron-exon structure variants, which may be attributed to the insertion of transposable elements [17]. This was demonstrated by the dating of the great number of dispersed duplication events in the PbrCAD genes, as the transposons increased the dispersed duplication events by regulating distant single-gene translocations [24].
The content of stone cells reached a maximum value and the distribution of the stone cell mass also reached a maximum density at the middle development stage. According to previous research, more than 75% of the total lignin content in fruit pulp is located in mature stone cells [5]. In our study, the stone cell content exhibited a rise-fall tendency, which was consistent with the results reported by Tao et al. (2015) and Ma et al. (2017) [22,25]. The inhibition of the synthesis of lignin in pear fruit may reduce the content of stone cells [26]. Members of the CAD gene family have been identified in many species, such as the observation of nine CAD genes in Arabidopsis [16], 12 in rice [17], 15 in hybrid Populus (Populus deltoides × Populus Nigra) [14], and five in Cucumis melo [27]. However, few AtCAD genes are directly involved in lignification [10]. Indeed, only AtCAD4 and AtCAD5 are related to lignification [16]. In the present study, we combined the results pertaining to the physiological changes of stone cells with transcriptome data to identify nine genes that might be involved in lignin biosynthesis during pear fruit development. The nine candidate PbrCAD genes were confirmed by qPCR analysis, indicating that the expression levels of four genes were consistent with the changes in stone cell content. Therefore, we speculated that these four genes may participate in the regulation of lignin synthesis in pear fruit.

4. Materials and Methods

4.1. Collection and Identification of the CAD Genes

Chinese white pear (Pyrus bretschneideri) genome was retrieved from the Pear Genome Project (http://peargenome.njau.edu.cn/, 25 September 2019). Chinese plum (Prunus mume) sequence was obtained from the Prunus mume Genome Project (http://prunusmumegenome.bjfu.edu.cn/index.jsp, 25 September 2019). Apple (Malus domestica) and strawberry (Fragaria vesca) sequences were obtained from the Genome Database for Rosaceae (http://www.rosaceae.org/, 25 September 2019). Nine CAD protein sequences of Arabidopsis (AT1G72680, AT2G21730, AT2G21890, AT3G19450, AT4G34230, AT4G37970, AT4G37980, AT4G37990, and AT4G39330) were downloaded from The Arabidopsis Information Resource (http://www.arabidopsis.org/, 25 September 2019) and used as queries to perform a BLAST search against the four Rosaceae genome databases. Additionally, the CAD domains (PF08240 and PF00107) obtaining from the Pfam database (http://pfam.sanger.ac.uk/, 25 September 2019) were used to build an HMM file with HMMER3 (http://hmmer.org/, 25 September 2019). Subsequently, HMM searches were performed against the local protein databases of the four Rosaceae species using HMMER3. A total of 234 candidate CAD genes were identified from the four Rosaceae species. Then, the Pfam and SMART databases (http://smart.embl-heidelberg.de/, 25 September 2019) were used to check each candidate CAD-related protein sequence as a member of the CAD gene family. At last, the candidate genes which did not harbor the CAD domains or exhibit the domains with an incomplete structure were removed.

4.2. Phylogenetic Analysis

The CAD proteins of pear, Chinese plum, apple, and strawberry were aligned using ClustalX2.1 (http://clustalx.software.informer.com/2.1/, 25 September 2019). MEGA 7.0 was used to generate a phylogenetic tree of the CAD genes in Rosaceae [28]. The neighbor-joining (NJ) method was applied to construct various CAD trees. The bootstrap analysis was conducted with 1000 replicates.

4.3. Chromosomal Locations and Duplication Analysis

Chromosomal locations of the CAD genes were obtained on the basis of genome annotation data. The location data were plotted using Circos [29]. A method similar to PGDD (http://chibba.agtec.uga.edu/duplication/, 25 September 2019) was used to analyze the synteny [30,31]. BLASTP was used to search for potential homologous gene pairs (E < 1 × 10−5, top five matches) across multiple genomes. Finally, the homologous pairs were input in MCScanX to identify syntenic chains [32,33].

4.4. Calculation of Non-Synonymous (Ks) and Synonymous (Ka) Substitutions

To annotate the Ka and Ks substitution rates of syntenic gene pairs, the downstream analysis tools of MCScanX were used [34]. The Ka/Ks ratios were calculated using the toolbox KaKs_Calculator 2.0 and the Nei-Gojobori (NG) method [35,36].

4.5. Gene Structure and Motif Analyses in Pear

Structures of the CAD genes were obtained through alignment of ORFs and genomic sequences using the Gene Structure Display Server (http://gsds.chi.pku.edu.cn/, 25 September 2019) [37]. Sequences of PbrCAD proteins were elucidated using the online MEME website (http://meme-suit.org/tools/meme, 25 September 2019) [38]. The parameters were as follows: maximum number of motifs, 25; minimum motif width, 6; and maximum motif width, 200.

4.6. Plant Materials

This research used 40-year-old pear (Pyrus bretschneideri ‘Dangshansuli’) trees cultivating in a commercial orchard in Gaoyou, Jiangsu Province, China. A total of 10 strong and healthy trees were selected. On April 4th, 2016 (when the fruit trees were in the full-bloom stage), the branches with consistent bud growth and size in the middle of the canopy were selected and labeled. Fruit samples were collected every 8 days (starting at 15 days after flowering), and 30 fruits with a relatively consistent size were collected every time. All fruits were placed into ice box and transferred to the laboratory for further experimentation.

4.7. Measurement of Stone Cell Number

Stone cells were separated and counted using the method reported by Tao et al. (2009) and Cai et al. (2010) [5,20]. A 100-g sample of pear flesh was collected and stored at −20 °C for 24 h, followed by homogenization at 18,000 rpm for 5 min in distilled water. The suspension was stirred for 3 min, then precipitated at room temperature for 30 min. The supernatant was discarded, and the precipitate was suspended in 0.5 mol/L HCl for 30 min and washed with distilled water. This process was repeated several times until the stone cells separating from impurities. The assay was repeated three times.

4.8. Histochemical Staining

Freehand sections of fruit material were stained with 1% (w/v) phyloroglucinol dissolved in 95% ethanol. After 2 min, a drop of 35% HCl was added. The section was placed into a shadowless light box and photographed by a digital camera [5].

4.9. Expression Analysis Based on Transcriptomic Data

To further investigate the role of CAD family genes in the formation of pear stone cells, we analyzed the expression patterns of the PbrCAD genes based on transcriptome sequencing (RNA-Seq) data from previous studies [19,20,39]. The accession number of the transcriptomic data is PRJNA185970 on NCBI. We used the samples of 21, 35, 48, 55, 68, 85, and 114 days after full bloom (DAFB) to examine the expressions of PbrCAD genes. Total RNAs were extracted for RNA sequencing, and a sequencing library was constructed according to the manufacturer’s instructions (Illumina). The cDNA library was sequenced on an Illumina HiSeq™ 2000 sequencer (San Diego, CA, USA) without biological replicates.

4.10. Quantitative Real-Time PCR (qRT-PCR)

According to the manufacturer’s instructions, gene quantifications were performed using the SYBR Green Master Mix (SYBR Premix EX Taq, TaKaRa, Dalian, China). The mixture comprised 5.5 µL of nuclease-free water, 12.5 µL of 10× buffer, 0.5 M of each primer, and 1 µL of diluted cDNA. Each 20-µL reaction was run in triplicate. PCR was performed as follows: 5 min of incubation at 95 °C, followed by 45 cycles of 94 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s, and final extension at 72 °C for 3 min. TUB-b2 (accession number, AB239681) was used to evaluate qRT-PCR. The relative mRNA levels were calculated using the relative 2−ΔΔCT method [40]. The primers used to investigate the gene expression patterns in fruit tissues were listed in Table 4. Each RT-qPCR was performed in triplicate. Statistical analyses were performed using SPSS. In graphs, each bar represents the mean and standard error (SE) (n = 3).

5. Conclusions

In summary, a comprehensive analysis of the CAD gene family in Rosaceae was performed. A total of 149 full-length genes were identified and classified into six subgroups. A chromosome distribution analysis showed that the CAD genes were unevenly distributed in Rosaceae. Dispersed duplication and WGD/segmental duplication played the most important role in the expansion of the CAD gene family. The Ka/Ks ratio showed that five collinear PbrCAD gene pairs were under positive selection. PbrCAD1, PbrCAD20, PbrCAD27, and PbrCAD31 were identified using qPCR may be involved in lignin synthesis in pear. Future research needs to identify the functions of these genes, and this study will be useful for elucidating functions of the CAD genes in pear.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/plants10071444/s1, Table S1 The gene name of four Rosaceae species, Table S2 Different duplication events in Rosaceae, Table S3 Information of chromosome location in Rosaceae, Table S4 The different gene structure in PbrCAD genes, Table S5 The entire of sequence logos of motifs (Followed by motif 1 to motif 25), Table S6 The RPKM value of 51 PbrCAD genes.

Author Contributions

S.T. contributed to the experimental design and management, data analysis, and paper review. K.Q. and X.S. contributed to the performance of laboratory work and manuscript preparation. Y.Y., J.B., and X.G. prepared the plant materials and performed tissue collection. K.Q. and X.S. contributed to the data analysis. X.S. prepared laboratory materials during the experiments. X.H., S.K., and S.Z. provided suggestions and reviewed and modified this paper. All authors have read and agreed to the published version of the manuscript.

Funding

The authors would like to acknowledge the support that they received from Major Science and Technology Project of Corps (2017DB006), the National Natural Science Foundation of China (31672105 and 31372044), the National High-Technology Research and Development Program (2011AA10020602).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data, tables, figures, and results in paper are our own and original.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Bhuiyan, N.H.; Selvaraj, G.; Wei, Y.D.; King, J. Role of lignification in plant defense. Plant Signal. Behav. 2009, 4, 158–159. [Google Scholar] [CrossRef] [Green Version]
  2. Deng, W.W.; Zhang, M.; Wu, J.Q.; Jiang, Z.Z.; Tang, L.; Li, Y.Y.; Wei, C.L.; Jiang, C.J.; Wan, X.C. Molecular cloning, functional analysis of three cinnamyl alcohol dehydrogenase (CAD) genes in the leaves of tea plant, Camellia sinensis. J. Plant Physiol. 2013, 170, 272–282. [Google Scholar] [CrossRef]
  3. Frost, C.J.; Mescher, M.C.; Carlson, J.E.; De Moraes, C.M. Plant defense priming against herbivores: Getting ready for a different battle. Plant Physiol. 2008, 146, 818–824. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Cai, C.; Xu, C.J.; Li, X.; Ferguson, I.; Chen, K.S. Accumulation of lignin in relation to change in activities of lignification enzymes in loquat fruit flesh after harvest. Postharvest Biol. Technol. 2006, 40, 163–169. [Google Scholar] [CrossRef]
  5. Tao, S.T.; Khanizadeh, S.; Zhang, H.; Zhang, S.L. Anatomy, ultrastructure and lignin distribution of stone cells in two Pyrus species. Plant Sci. 2009, 176, 413–419. [Google Scholar] [CrossRef]
  6. Anterola, A.M.; Lewis, N.G. Trends in lignin modification: A comprehensive analysis of the effects of genetic manipulations/mutations on lignification and vascular integrity. Phytochemistry 2002, 61, 221–294. [Google Scholar] [CrossRef]
  7. Whetten, R.; Sederoff, R. Lignin biosynthesis. Plant Cell 1995, 7, 1001–1013. [Google Scholar] [CrossRef]
  8. Chabannes, M.; Barakate, A.; Lapierre, C.; Marita, J.M.; Ralph, J.; Pean, M.; Danoun, S.; Halpin, C.; Grima-Pettenati, J.; Boudet, A.M. Strong decrease in lignin content without significant alteration of plant development is induced by simultaneous down-regulation of cinnamoyl CoA reductase (CCR) and cinnamyl alcohol dehydrogenase (CAD) in tobacco plants. Plant J. 2001, 28, 257–270. [Google Scholar] [CrossRef] [PubMed]
  9. Pilate, G.; Guiney, E.; Holt, K.; Petit-Conil, M.; Lapierre, C.; Leplé, J.C.; Pollet, B.; Mila, I.; Webster, E.A.; Marstorp, H.G.; et al. Field and pulping performances of transgenic trees with altered lignification. Nat. Biotechnol. 2002, 20, 607–612. [Google Scholar] [CrossRef]
  10. Kaur, H.; Shaker, K.; Heinzel, N.; Ralph, J.; Gális, I.; Baldwin, I.T. Environmental Stresses of Field Growth Allow Cinnamyl Alcohol Dehydrogenase-Deficient Nicotiana attenuata Plants to Compensate for their Structural Deficiencies1. Plant Physiol. 2012, 159, 1545–1570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  11. Kim, H.; Ralph, J.; Lu, F.; Pilate, G.; Leple’, J.C.; Pollet, B.; Lapierre, C. Identification of the structure and origin of thioacidolysis marker compounds for cinnamyl alcohol dehydrogenase deficiency in angiosperms. J. Biol. Chem. 2002, 277, 47412–47419. [Google Scholar] [CrossRef] [Green Version]
  12. Saballos, A.; Ejeta, G.; Sanchez, E.; Kang, C.H.; Vermerris, W. A genomewide analysis of the cinnamyl alcohol dehydrogenase family in sorghum [Sorghum bicolor (L.) Moench] identifies SbCAD2 as the Brown midrib6 gene. Genetics 2009, 181, 783–795. [Google Scholar] [CrossRef] [Green Version]
  13. Van Acker, R.; Dejardin, A.; Desmet, S.; Hoengenaert, L.; Vanholme, R.; Morreel, K.; Laurans, F.; Kim, H.; Santoro, N.; Foster, C.; et al. Different Routes for Conifer- and Sinapaldehyde and Higher Saccharification upon Deficiency in the Dehydrogenase CAD1. Plant Physiol. 2017, 175, 1018–1039. [Google Scholar] [CrossRef] [PubMed]
  14. Barakat, A.; Bagniewska-Zadworna, A.; Choi, A.; Plakkat, U.; DiLoreto, D.S.; Yellanki, P.; Carlson, J.E. The cinnamyl alcohol dehydrogenase gene family in Populus: Phylogeny, organization, and expression. BMC Plant. Biol. 2009, 9, 26. [Google Scholar] [CrossRef] [Green Version]
  15. Gross, G.G.; Stöckigt, J.; Mansell, R.L.; ZENK, M.H. Three novel enzymes involved in the reduction of ferulic acid to coniferyl alcohol in higher plants: Ferulate: Co a ligase, feruloyl-Co a reductase and coniferyl alcohol oxidoreductase. FEBS Lett. 1973, 31, 283–286. [Google Scholar] [CrossRef] [Green Version]
  16. Kim, S.J.; Kim, M.R.; Bedgar, D.L.; Moinuddin, S.G.A.; Cardenas, C.L.; Davin, L.B.; Kang, C.H.; Lewis, N.G. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 2004, 101, 1455–1460. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Tobias, C.M.; Chowk, E.K. Structure of the cinnamylalcohol dehydrogenase gene family in rice and promoter activity of a member associated with lignification. Planta 2005, 220, 678–688. [Google Scholar] [CrossRef] [PubMed]
  18. Zhang, J.B.; Li, B.; Yang, Y.; Hu, W.R.; Chen, F.Y.; Xie, L.X.; Fan, L. Genomi-wide Investigation and Expression Analysis of CAD Gene Family in Gossypium hirsutum. Xinjiang Agric. Sci. 2016, 53, 1177–1187. [Google Scholar]
  19. Wu, J.; Wang, Z.W.; Shi, Z.B.; Zhang, S.; Ming, R.; Zhu, S.L.; Khan, M.A.; Tao, S.T.; Korban, S.S.; Wang, H.; et al. The genome of the pear (Pyrus bretschneideri Rehd.). Genome Res. 2013, 23, 396–408. [Google Scholar] [CrossRef] [Green Version]
  20. Cai, Y.P.; Li, G.Q.; Nie, J.Q.; Lin, Y.; Nie, F.; Zhang, J.Y.; Xu, Y.L. Study of the structure and biosynthetic pathway of lignin in stone cells of pear. Sci. Hortic. 2010, 125, 374–379. [Google Scholar] [CrossRef]
  21. Ganko, E.W.; Meyers, B.C.; Vision, T.J. Divergence in Expression between Duplicated Genes in Arabidopsis. Mol. Biol. Evol. 2007, 24, 2298–2309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Tao, S.T.; Wang, D.Y.; Jin, C.; Sun, W.; Liu, X.; Zhang, S.L. Cinnamate-4-Hydroxylase Gene Is Involved in the Step of Lignin Biosynthesis in Chinese White Pear. J. Am. Soc. Hortic. 2015, 140, 573–579. [Google Scholar] [CrossRef] [Green Version]
  23. Freeling, M. Bias in plant gene content following different sorts of duplication: Tandem, whole-genome, segmental, or by transposition. Annu. Rev. Plant Biol. 2009, 60, 433–453. [Google Scholar] [CrossRef] [PubMed]
  24. Cheng, H.; Li, L.L.; Xu, F.; Cheng, S.Y.; Cao, F.L.; Wang, Y.; Yuan, H.H.; Jiang, D.Z.; Wu, C.H. Expression patterns of a cinnamyl alcohol dehydrogenase gene involved in lignin biosynthesis and environmental stress in Ginkgo biloba. Mol. Biol. Rep. 2013, 40, 707–721. [Google Scholar] [CrossRef]
  25. Ma, C.; Zhang, H.P.; Li, J.M.; Tao, S.T.; Qiao, X.; Korban, S.S.; Zhang, S.L.; Wu, J. Genome-wide analysis and characterization of molecular evolution of the HCT gene family in pear (Pyrus bretschneideri). Plant Syst. Evol. 2017, 303, 71–90. [Google Scholar] [CrossRef]
  26. Gong, X.; Xie, Z.; Qi, K.; Zhao, L.; Yuan, Y.; Xu, J.; Rui, W.; Shiratake, K.; Bao, J.; Khanizadeh, S.; et al. PbMC1a/1b regulates lignification during stone cell development in pear (Pyrus bretschneideri) fruit. Hortic. Res.-Engl. 2020, 7, 59. [Google Scholar] [CrossRef]
  27. Jin, Y.Z.; Zhang, C.; Liu, W.; Qi, H.Y.; Chen, H.; Cao, S.X. The Cinnamyl Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.): Bioinformatic Analysis and Expression Patterns. PLoS ONE 2014, 9, e101730. [Google Scholar]
  28. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
  29. Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef] [Green Version]
  30. Lee, T.H.; Tang, H.B.; Wang, X.Y.; Paterson, A.H. PGDD: A database of gene and genome duplication in plants. Nucleic Acids Res. 2013, 41, D1152–D1158. [Google Scholar] [CrossRef]
  31. Qiao, X.; Li, M.; Li, L.T.; Yin, H.; Wu, J.Y.; Zhang, S.L. Genome-wide identification and comparative analysis of the heat shock transcription factor family in Chinese white pear (Pyrus bretschneideri) and five other Rosaceae species. BMC Plant. Biol. 2015, 15, 12. [Google Scholar] [CrossRef] [Green Version]
  32. Huang, X.S.; Li, K.Q.; Xu, X.Y.; Yao, Z.H.; Jin, C.; Zhang, S.L. Genome-wide analysis of WRKY transcription factors in white pear (Pyrus bretschneideri) reveals evolution and patterns under drought stress. BMC Genom. 2015, 16, 1104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Wang, Y.P.; Tang, H.B.; DeBarry, J.D.; Tan, X.; Li, J.P.; Wang, X.Y.; Lee, T.H.; Jin, H.Z.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucl. Acids Res. 2012, 40, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Wang, D.P.; Zhang, Y.B.; Zhang, Z.; Zhu, J.; Yu, J. KaKs_Calculator 2.0: A Toolkit Incorporating Gamma-Series Methods and Sliding Window Strategies. Genom. Proteom. Bioinform. 2010, 8, 77–80. [Google Scholar] [CrossRef] [Green Version]
  35. Zhang, Z.; Li, J.; Zhao, X.Q.; Wang, J.; Wong, G.K.S.; Yu, J. Kaks_calculator: Calculating ka and ks through model selection and model averaging. Genom. Proteom. Bioinform. 2006, 4, 259–263. [Google Scholar] [CrossRef] [Green Version]
  36. Hu, B.; Jin, J.P.; Guo, A.Y.; Zhang, H.; Luo, J.G.; Gao, G. GSDS 2.0: An upgraded gene features visualization server. Bioinformatics 2015, 31, 1296–1297. [Google Scholar] [CrossRef] [Green Version]
  37. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [Green Version]
  38. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Green Version]
  39. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  40. Li, M.; Li, L.T.; Dunwell, J.M.; Qiao, X.; Liu, X.; Zhang, S.L. Characterization of the lipoxygenase (LOX) gene family in the Chinese white pear (Pyrus bretschneideri) and comparison with other members of the Rosaceae. BMC Genom. 2013, 15, 444. [Google Scholar] [CrossRef] [Green Version]
Plants 10 01444 g001 550
Figure 1. Neighbor-joining tree of CAD proteins in Rosaceae. The phylogenetic tree was constructed using the MEGA 7.0 based on the full-length amino-acid sequences encoded by CAD genes from Pyrus bretschneideri (57), Malus domestica (42), Prunus mume (34), and Fragaria vesca (16). A bootstrap analysis was performed with 1000 replicates.
Figure 1. Neighbor-joining tree of CAD proteins in Rosaceae. The phylogenetic tree was constructed using the MEGA 7.0 based on the full-length amino-acid sequences encoded by CAD genes from Pyrus bretschneideri (57), Malus domestica (42), Prunus mume (34), and Fragaria vesca (16). A bootstrap analysis was performed with 1000 replicates.
Plants 10 01444 g001
Plants 10 01444 g002 550
Figure 2. Chromosomal distribution and synteny of the CAD genes in Rosaceae genomes. The CAD genes in pear (Pbr), apple (MDP), Chinese plum (Pm), and strawberry (mrna) were mapped onto different chromosomes. Gene pairs with a syntenic relation-ship were joined by a line.
Figure 2. Chromosomal distribution and synteny of the CAD genes in Rosaceae genomes. The CAD genes in pear (Pbr), apple (MDP), Chinese plum (Pm), and strawberry (mrna) were mapped onto different chromosomes. Gene pairs with a syntenic relation-ship were joined by a line.
Plants 10 01444 g002
Plants 10 01444 g003 550
Figure 3. Phylogenetic tree, exon-intron structure, and conserved motifs of PbrCAD genes and proteins. (a) Unrooted neighbor-joining phylogeny of PbrCADs, with bootstrap values >50. (b) The exon-intron structure is presented by yellow boxes corresponding to exons and the linking black lines corresponding to introns, while the blue line indicates the 5′-UTR and 3′-UTR. (c) Twenty-five conserved motifs identified by MEME tools in PbrCAD genes. Each colored box represents conservation (color figure online).
Figure 3. Phylogenetic tree, exon-intron structure, and conserved motifs of PbrCAD genes and proteins. (a) Unrooted neighbor-joining phylogeny of PbrCADs, with bootstrap values >50. (b) The exon-intron structure is presented by yellow boxes corresponding to exons and the linking black lines corresponding to introns, while the blue line indicates the 5′-UTR and 3′-UTR. (c) Twenty-five conserved motifs identified by MEME tools in PbrCAD genes. Each colored box represents conservation (color figure online).
Plants 10 01444 g003
Plants 10 01444 g004 550
Figure 4. Changes in the stone cell content during fruit development. All data are reported as the average of three repeated exper-iments. Different letters indicate a difference of 5% in the significance levels. The vertical bars represent the SE.
Figure 4. Changes in the stone cell content during fruit development. All data are reported as the average of three repeated exper-iments. Different letters indicate a difference of 5% in the significance levels. The vertical bars represent the SE.
Plants 10 01444 g004
Plants 10 01444 g005 550
Figure 5. Histochemical staining with phloroglucinol-HCl. A-G correspond to the seven fruit developmental stages. (A) 21 days after full bloom (DAFB); (B) 35 DAFB; (C) 48 DAFB; (D) 55 DAFB; (E) 70 DAFB; (F) 85 DAFB; and (G) 114 DAFB. Red color indicates lignin deposition in pear fruit.
Figure 5. Histochemical staining with phloroglucinol-HCl. A-G correspond to the seven fruit developmental stages. (A) 21 days after full bloom (DAFB); (B) 35 DAFB; (C) 48 DAFB; (D) 55 DAFB; (E) 70 DAFB; (F) 85 DAFB; and (G) 114 DAFB. Red color indicates lignin deposition in pear fruit.
Plants 10 01444 g005
Plants 10 01444 g006 550
Figure 6. Heatmap of the expression levels of PbrCAD genes in Chinese white pear. Transcriptome sequencing was used to measure the expression levels of PbrCAD genes. S1-S5 correspond to the five fruit developmental stages: 15 days after full bloom (DAFB) (S1), 36 DAFB (S2), 81 DAFB (S3), 110 DAFB (S4), and 145 DAFB (S5). The color scale presented at the top of the figure represents the log2-transformed RPKM values. The light-green color indicates a low expression level and the red color indicates a high ex-pression level.
Figure 6. Heatmap of the expression levels of PbrCAD genes in Chinese white pear. Transcriptome sequencing was used to measure the expression levels of PbrCAD genes. S1-S5 correspond to the five fruit developmental stages: 15 days after full bloom (DAFB) (S1), 36 DAFB (S2), 81 DAFB (S3), 110 DAFB (S4), and 145 DAFB (S5). The color scale presented at the top of the figure represents the log2-transformed RPKM values. The light-green color indicates a low expression level and the red color indicates a high ex-pression level.
Plants 10 01444 g006
Plants 10 01444 g007 550
Figure 7. Quantitative real-time PCR was used to detect the expression of nine PbrCAD genes during fruit development. All data are reported as the average of three repeated experiments. The different letters indicate a difference of 5% in the level of sig-nificance. The vertical bars represent the SE.
Figure 7. Quantitative real-time PCR was used to detect the expression of nine PbrCAD genes during fruit development. All data are reported as the average of three repeated experiments. The different letters indicate a difference of 5% in the level of sig-nificance. The vertical bars represent the SE.
Plants 10 01444 g007
Table
Table 1. Genome information and number of CAD genes in Rosaceae species.
Table 1. Genome information and number of CAD genes in Rosaceae species.
Common NameSpecies NameChromoSome NumberRelease VersionGenome Gene NumberIdentified CAD GenesGene Name Prefix
PearPyrus bretschneideri34NJAU, v1.04234157Pbr
AppleMalus domestica34GDR, v1.06354142MDP
Chinese plumPrunus mume16BFU, v1.03139034Pm
StrawberryFragaria vesca14GDR, v1.03283116mrna
Table
Table 2. The numbers of CAD genes of different origins in four Rosaceae species.
Table 2. The numbers of CAD genes of different origins in four Rosaceae species.
SchemeNumber of CAD GenesNumber of CAD Genes of Different Origins (Percentage)
SingletonWGDTandemProximalDispersed
Pear578 (14.0)24 (42.1)0025 (43.9)
Apple4202 (4.8)0040 (95.2)
Chinese Plum34013 (38.2)0020 (58.8)
Strawberry1609 (56.2)007 (43.8)
Table
Table 3. Estimated divergence period of the PbrCAD gene pairs. Ks, synonymous substitution rate; Ka, non-synonymous substitution rate; MYA, million years ago; NG, Nei-Gojobori.
Table 3. Estimated divergence period of the PbrCAD gene pairs. Ks, synonymous substitution rate; Ka, non-synonymous substitution rate; MYA, million years ago; NG, Nei-Gojobori.
Common NameMethodKaKsKa/Ksp Value (Fisher’s Test)
PbrCAD19-
PbrCAD22		NG0.0305180.03316180.9202780.822196
PbrCAD24-
PbrCAD35		NG0.036530.2947490.1239351.02 × 10−21
PbrCAD25-
PbrCAD27		NG0.0147960.1860260.07953628.38 × 10−18
PbrCAD26-
PbrCAD29		NG0.0198420.2496290.07948578.57 × 10−24
PbrCAD39-
PbrCAD50		NG0.0369990.2357590.1569361.28 × 10−16
Table
Table 4. List of primers used for quantitative real-time PCR analyses of PbrCAD and internal control genes.
Table 4. List of primers used for quantitative real-time PCR analyses of PbrCAD and internal control genes.
Gene NameForward Primer Sequence (5′ → 3′)Reverse Primer Sequence (5′ → 3′)Amplicon Length (bp)
PbrCAD1TGACCTTGGCACGTCAAACTCAGTACTGCTCGTTGTCCGT174
PbrCAD11CGGAACAAAGGACACGCAAGTCGAGCGCTTCAGTTGCATA102
PbrCAD20CCAGGCCGGAAATTCACTGTGCCGTAAAGAGTTGTATCAGC221
PbrCAD27GGGCCCATGATGTTCGAGTAACTTCATGTCCGGGCAAAGA245
PbrCAD31TGTTAGAGACGCCAAACCTGCTCCGATCACCATCGGATCCTTA195
PbrCAD37GTCTACAGCTGGTCAGGTTATCAGATGCCACAACTCCTCCAGCTTCATGA202
PbrCAD39GATGGCCAGTCCAGGTTCTCAGCAAGGGAACCAACATGAC102
PbrCAD41TCAGCTCACTTGTGCCTCTGCACCTTGTGCAACGGAAAGG153
PbrCAD43GTCCAAGTCGAGGTGGCACCTGCATTCTCCTGTGAACACTGGCA203
TUB-b2TGGGCTTTGCTCCTCTTACCCTTCGTGCTCATCTTACC169
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Qi, K.; Song, X.; Yuan, Y.; Bao, J.; Gong, X.; Huang, X.; Khanizadeh, S.; Zhang, S.; Tao, S. CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri). Plants 2021, 10, 1444. https://doi.org/10.3390/plants10071444

AMA Style

Qi K, Song X, Yuan Y, Bao J, Gong X, Huang X, Khanizadeh S, Zhang S, Tao S. CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri). Plants. 2021; 10(7):1444. https://doi.org/10.3390/plants10071444

Chicago/Turabian Style

Qi, Kaijie, Xiaofei Song, Yazhou Yuan, Jianping Bao, Xin Gong, Xiaosan Huang, Shahrokh Khanizadeh, Shaoling Zhang, and Shutian Tao. 2021. "CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri)" Plants 10, no. 7: 1444. https://doi.org/10.3390/plants10071444

APA Style

Qi, K., Song, X., Yuan, Y., Bao, J., Gong, X., Huang, X., Khanizadeh, S., Zhang, S., & Tao, S. (2021). CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri). Plants, 10(7), 1444. https://doi.org/10.3390/plants10071444

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop