Electrophysiological, Morphologic, and Transcriptomic Profiling of the Ogura-CMS, DGMS and Maintainer Broccoli Lines
Abstract
:1. Introduction
2. Results
2.1. Investigation of Agronomic Traits and the Nectary Morphology
2.2. Genomic Characteristicsand SNP Distribution
2.3. Gene Optimization and Correlation Test for Each Sample
2.4. DEGs Analysis
2.5. Genes Related to Plant Hormones
2.6. Genes Related to Oxidative Phosphorylation and Photosynthesis
2.7. Real-Time qPCR Validation of Gene Expression Patterns
3. Discussion
3.1. Male Sterility in Brassica Crops
3.2. Plant Hormone Signal Transduction and ABC Transporters Affected the Growth Performance and Reproductive Traits
3.3. The DGMS Line Responds to Plant Hormone Signal Transduction
4. Materials and Methods
4.1. Plant Materials and Investigation of Agronomic Traits
4.2. Scanning Electron Microscopy
4.3. RNA Extraction and Illumina Sequencing
4.4. Quality Control and Transcriptome Analysis
4.5. Quantitative qRT-PCR Analysis
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bai, Y.; Wang, X.; Zhao, S.; Ma, C.; Cui, J.; Zheng, Y. Sulforaphane Protects against Cardiovascular Disease via Nrf2 Activation. Oxidative Med. Cell. Longev. 2015, 2015, 407580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Z.; Liu, Y.; Yuan, S.; Han, F.; Fang, Z.; Yang, L.; Zhuang, M.; Zhang, Y.; Lv, H.; Wang, Y.; et al. Fine mapping of the major QTLs for biochemical variation of sulforaphane in broccoli florets using a DH population. Sci. Rep. 2021, 11, 9004. [Google Scholar] [CrossRef] [PubMed]
- Kensler, T.W.; Egner, P.A.; Agyeman, A.S.; Visvanathan, K.; Groopman, J.D.; Chen, J.G.; Chen, T.Y.; Fahey, J.W.; Talalay, P. Keap1-nrf2 signaling: A target for cancer prevention by sulforaphane. Top. Curr. Chem. 2013, 329, 163–177. [Google Scholar] [PubMed] [Green Version]
- Appendino, G.; Bardelli, A. Broccoli, PTEN deletion and prostate cancer: Where is the link? Mol. Cancer 2010, 9, 1–3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Z.; Zheng, S.; Liu, Y.; Fang, Z.; Yang, L.; Zhuang, M.; Zhang, Y.; Lv, H.; Wang, Y.; Xu, D. Characterization of glucosinolates in 80 broccoli genotypes and different organs using UHPLC-Triple-TOF-MS method. Food Chem. 2021, 334, 127519. [Google Scholar] [CrossRef]
- Li, Z.S.; Mei, Y.J.; Liu, Y.M.; Fang, Z.Y.; Yang, L.M.; Zhuang, M.; Zhang, Y.Y.; Lv, H.H. The evolution of genetic diversity of broccoli cultivars in China since 1980. Sci. Hortic. Amst. 2019, 250, 69–80. [Google Scholar] [CrossRef]
- Huang, J.; Liu, Y.; Han, F.; Fang, Z.; Yang, L.; Zhuang, M.; Zhang, Y.; Lv, H.; Wang, Y.; Ji, J.; et al. Genetic diversity and population structure analysis of 161 broccoli cultivars based on SNP markers. Hortic. Plant J. 2021, 7, 423–433. [Google Scholar] [CrossRef]
- Fang, Z.Y.; Sun, P.T.; Liu, Y.M.; Yang, L.M.; Wang, X.W.; Hou, A.F.; Bian, C.S. A male sterile line with dominant gene (Ms) in cabbage (Brassica oleracea var. capitata) and its utilization for hybrid seed production. Euphytica 1997, 97, 265–268. [Google Scholar] [CrossRef]
- Kaminski, P.; Podwyszynska, M.; Starzycki, M.; Starzycka-Korbas, E. Interspecific hybridisation of cytoplasmic male-sterile rapeseed with Ogura cytoplasm and Brassica rapa var. pekinensis as a method to obtain male-sterile Chinese cabbage inbred lines. Euphytica 2016, 208, 519–534. [Google Scholar] [CrossRef] [Green Version]
- Kirti, P.B.; Banga, S.S.; Prakash, S.; Chopra, V.L. Transfer of Ogu Cytoplasmic Male-Sterility to Brassica-Juncea and Improvement of the Male-Sterile Line through Somatic-Cell Fusion. Appl. Genet. 1995, 91, 517–521. [Google Scholar] [CrossRef]
- Chamola, R.; Balyan, H.S.; Bhat, S.R. Transfer of cytoplasmic male sterility from alloplasmic Brassica juncea and B. napus to cauliflower (B. oleracea var. botrytis) through interspecific hybridization and embryo culture. Indian J. Genet. Plant Breed. 2013, 73, 203–210. [Google Scholar] [CrossRef]
- Shu, J.S.; Zhang, L.L.; Liu, Y.M.; Li, Z.S.; Fang, Z.Y.; Yang, L.M.; Zhuang, M.; Zhang, Y.Y.; Lv, H.H. Normal and Abortive Buds Transcriptomic Profiling of Broccoli ogu Cytoplasmic Male Sterile Line and Its Maintainer. Int. J. Mol. Sci. 2018, 19, 2501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, F.Q.; Zhang, X.L.; Yang, L.M.; Zhuang, M.; Zhang, Y.Y.; Li, Z.S.; Fang, Z.Y.; Lv, H.H. iTRAQ-Based Proteomic Analysis of Ogura-CMS Cabbage and Its Maintainer Line. Int. J. Mol. Sci. 2018, 19, 3180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xing, M.M.; Sun, C.; Li, H.L.; Hu, S.L.; Lei, L.; Kang, J.G. Integrated analysis of transcriptome and proteome changes related to the Ogura cytoplasmic male sterility in cabbage. PLoS ONE 2018, 13, e0193462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Wang, Y.; Wu, M.; Li, L.H.; Jin, C.; Zhang, Q.L.; Chen, C.B.; Song, W.Q.; Wang, C.G. Small RNA Sequencing Reveals Differential miRNA Expression in the Early Development of Broccoli (Brassica oleracea var. italica) Pollen. Front. Plant Sci. 2017, 8, 404. [Google Scholar] [CrossRef] [Green Version]
- Luo, F.; Cai, J.H.; Kong, X.M.; Zhou, Q.; Zhou, X.; Zhao, Y.B.; Ji, S.J. Transcriptome profiling reveals the roles of pigment mechanisms in postharvest broccoli yellowing. Hortic. Res.-Engl. 2019, 6, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Li, Z.S.; Liu, Y.M.; Li, L.Y.; Fang, Z.Y.; Yang, L.M.; Zhuang, M.; Zhang, Y.Y.; Lv, H.H. Transcriptome reveals the gene expression patterns of sulforaphane metabolism in broccoli florets. PLoS ONE 2019, 14, e0213902. [Google Scholar] [CrossRef]
- Ku, K.M.; Becker, T.M.; Juvik, J.A. Transcriptome and Metabolome Analyses of Glucosinolates in Two Broccoli Cultivars Following Jasmonate Treatment for the Induction of Glucosinolate Defense to Trichoplusia ni (Hubner). Int. J. Mol. Sci. 2016, 17, 1135. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Yuan, J.Y.; Wu, M.; Han, Z.P.; Li, L.H.; Jiang, H.M.; Jia, Y.L.; Han, X.; Liu, M.; Sun, D.L.; et al. Transcriptome and DNA methylome reveal insights into yield heterosis in the curds of broccoli (Brassica oleracea L var. italic). Bmc Plant Biol. 2018, 18, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Jiang, Z.; Guo, H. A comparative genomic analysis of plant hormone related genes in different species. J. Genet. Genom. 2010, 37, 219–230. [Google Scholar] [CrossRef]
- Muto, H.; Nagao, I.; Demura, T.; Fukuda, H.; Kinjo, M.; Yamamoto, K.T. Fluorescence cross-correlation analyses of the molecular interaction between an Aux/IAA protein, MSG2/IAA19, and protein-protein interaction domains of auxin response factors of Arabidopsis expressed in HeLa cells. Plant Cell Physiol. 2006, 47, 1095–1101. [Google Scholar] [CrossRef] [PubMed]
- Braun, H.P. The Oxidative Phosphorylation system of the mitochondria in plants. Mitochondrion 2020, 53, 66–75. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.Y.; Shen, J.R.; Mao, X.Z.; Liu, K.D.; Wei, L.P.; Liu, P.W.; Yang, G.S. Isolation and analysis of differentially expressed genes in dominant genic male sterility (DGMS) Brassica napus L. using subtractive PCR and cDNA microarray. Plant Sci. 2007, 172, 204–211. [Google Scholar] [CrossRef]
- Wei, X.C.; Zhang, X.H.; Yao, Q.J.; Yuan, Y.X.; Li, X.X.; Wei, F.; Zhao, Y.Y.; Zhang, Q.; Wang, Z.Y.; Jiang, W.S.; et al. The miRNAs and their regulatory networks responsible for pollen abortion in Ogura-CMS Chinese cabbage revealed by high-throughput sequencing of miRNAs, degradomes, and transcriptomes. Front. Plant Sci. 2015, 6, 894. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdelhafiz, A.T.; Muhamad, J.A. Midcycle pericoital intravaginal bee honey and royal jelly for male factor infertility. Int. J. Gynaecol. Obs. 2008, 101, 146–149. [Google Scholar] [CrossRef] [PubMed]
- Hao, P.; Xia, J.; Liu, J.; Di Donato, M.; Pakula, K.; Bailly, A.; Jasinski, M.; Geisler, M. Auxin-transporting ABC transporters are defined by a conserved D/E-P motif regulated by a prolylisomerase. J. Biol. Chem. 2020, 295, 13094–13105. [Google Scholar] [CrossRef] [PubMed]
- Naramoto, S. Polar transport in plants mediated by membrane transporters: Focus on mechanisms of polar auxin transport. Curr. Opin. Plant Biol. 2017, 40, 8–14. [Google Scholar] [CrossRef]
- Müller, K.; Hošek, P.; Laňková, M.; Vosolsobě, S.; Malínská, K.; Čarná, M.; Fílová, M.; Dobrev, P.I.; Helusová, M.; Hoyerová, K.; et al. Transcription of specific auxin efflux and influx carriers drives auxin homeostasis in tobacco cells. Plant J. Cell Mol. Biol. 2019, 100, 627–640. [Google Scholar] [CrossRef]
- Lee, S.H.; Cho, H.-T. PINOID positively regulates auxin efflux in Arabidopsis root hair cells and tobacco cells. Plant Cell 2006, 18, 1604–1616. [Google Scholar] [CrossRef] [Green Version]
- Anfang, M.; Shani, E. Transport mechanisms of plant hormones. Curr Opin Plant Biol 2021, 63, 102055. [Google Scholar] [CrossRef]
- Grones, P.; Friml, J. Auxin transporters and binding proteins at a glance. J. Cell Sci. 2015, 128, 1–7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Skokan, R.; Medvecká, E.; Viaene, T.; Vosolsobě, S.; Zwiewka, M.; Müller, K.; Skůpa, P.; Karady, M.; Zhang, Y.; Janacek, D.P.; et al. PIN-driven auxin transport emerged early in streptophyte evolution. Nat. Plants 2019, 5, 1114–1119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, H.; Wu, N.; Fu, J.; Wang, S.P.; Li, X.H.; Xiao, J.H.; Xiong, L.Z. A GH3 family member, OsGH3-2, modulates auxin and abscisic acid levels and differentially affects drought and cold tolerance in rice. J. Exp. Bot. 2012, 63, 6467–6480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, J.H.; Han, S.J.; Yoon, E.K.; Lee, W.S. Evidence of an auxin signal pathway, microRNA167-ARF8-GH3, and its response to exogenous auxin in cultured rice cells. Nucleic Acids Res. 2006, 34, 1892–1899. [Google Scholar] [CrossRef]
- Xu, N.F.; Hagen, G.; Guilfoyle, T. Multiple auxin response modules in the soybean SAUR 15A promoter. Plant Sci. 1997, 126, 193–201. [Google Scholar] [CrossRef]
- Spartz, A.K.; Ren, H.; Park, M.Y.; Grandt, K.N.; Lee, S.H.; Murphy, A.S.; Sussman, M.R.; Overvoorde, P.J.; Gray, W.M. SAUR Inhibition of PP2C-D Phosphatases Activates Plasma Membrane H+-ATPases to Promote Cell Expansion in Arabidopsis. Plant Cell 2014, 26, 2129–2142. [Google Scholar] [CrossRef] [Green Version]
- Nic-Matos, G.; Narvaez, M.; Peraza-Echeverria, S.; Saenz, L.; Oropeza, C. Molecular cloning of two novel NPR1 homologue genes in coconut palm and analysis of their expression in response to the plant defense hormone salicylic acid. Genes Genom. 2017, 39, 1007–1019. [Google Scholar] [CrossRef]
- Chen, J.; Mohan, R.; Zhang, Y.; Li, M.; Chen, H.; Palmer, I.A.; Chang, M.; Qi, G.; Spoel, S.H.; Mengiste, T.; et al. NPR1 Promotes Its Own and Target Gene Expression in Plant Defense by Recruiting CDK8. Plant Physiol. 2019, 181, 289–304. [Google Scholar] [CrossRef]
- Menges, M.; Samland, A.K.; Planchais, S.; Murray, J.A.H. The D-type cyclin CYCD3;1 is limiting for the G1-to-S-phase transition in Arabidopsis. Plant Cell 2006, 18, 893–906. [Google Scholar] [CrossRef] [Green Version]
- Dong, X.; Kim, W.K.; Lim, Y.P.; Kim, Y.K.; Hur, Y. Ogura-CMS in Chinese cabbage (Brassica rapa ssp. pekinensis) causes delayed expression of many nuclear genes. Plant Sci. 2013, 199–200, 7–17. [Google Scholar] [CrossRef]
- Yu, H.L.; Fang, Z.Y.; Liu, Y.M.; Yang, L.M.; Zhuang, M.; Lv, H.H.; Li, Z.S.; Han, F.Q.; Liu, X.P.; Zhang, Y.Y. Development of a novel allele-specific Rfo marker and creation of Ogura CMS fertility-restored interspecific hybrids in Brassica oleracea. Appl. Genet. 2016, 129, 1625–1637. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Zhuang, M.; Fang, Z.Y.; Wang, Q.B.; Zhang, Y.Y.; Liu, Y.M.; Yang, L.M.; Cheng, F. A Co-Dominant Marker BoE332 Applied to Marker-Assisted Selection of Homozygous Male-Sterile Plants in Cabbage (Brassica oleracea var. capitata L.). J. Integr. Agric. 2013, 12, 596–602. [Google Scholar] [CrossRef]
- Solís, S.M.; Zini, L.M.; González, V.V.; Ferrucci, M.S. Floral nectaries in Sapindaceae s.s.: Morphological and structural diversity, and their systematic implications. Protoplasma 2017, 254, 2169–2188. [Google Scholar] [CrossRef] [PubMed]
- Zini, L.M.; Solís, S.M.; Ferrucci, M.S. Anatomical and developmental studies on floral nectaries in Cardiospermum species: An approach to the evolutionary trend in Paullinieae. Plant Syst. Evol. 2014, 300, 1515–1523. [Google Scholar] [CrossRef]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [Green Version]
- Brysbaert, G.; Lorgouilloux, K.; Vranken, W.F.; Lensink, M.F. RINspector: A Cytoscape app for centrality analyses and DynaMine flexibility prediction. Bioinformatics 2018, 34, 294–296. [Google Scholar] [CrossRef]
- Li, Z.S.; Liu, Y.M.; Fang, Z.Y.; Yang, L.M.; Zhuang, M.; Zhang, Y.Y.; Zhao, W.; Sun, P.T. Variation of Sulforaphane Levels in Broccoli (Brassica Oleracea Var. Italica) during Flower Development and the Role of Gene Aop2. J. Liq. Chromatogr. Relat. Technol. 2014, 37, 1199–1211. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Trait Name | 2019 | 2020 | ||||
---|---|---|---|---|---|---|
T54S | T54M | T54C | T54S | T54M | T54C | |
Plant height (cm) * | 72.48 ± 4.25 b | 70.33 ± 4.29 c | 73.27 ± 3.14 a | 68.67 ± 3.65 a | 65.39 ± 3.74 c | 68.18 ± 2.85 b |
Length of the largest leaf (cm) * | 60.37 ± 2.49 b | 58.56 ± 3.87 c | 61.48 ± 3.04 a | 58.88 ± 3.07 b | 56.49 ± 2.28 c | 59.71 ± 3.63 a |
Width of the largest leaf (cm) | 25.28 ± 2.79 a | 24.17 ± 1.89 b | 25.08 ± 2.12 a | 24.22 ± 1.75 b | 24.01 ± 2.01 b | 25.53 ± 2.28 a |
Plant spread angle (cm) * | 91.04 ± 5.85 b | 86.34 ± 6.15 c | 92.86 ± 6.19 a | 88.18 ± 5.35 b | 86.27 ± 6.05 c | 90.84 ± 7.56 a |
Single head weight (kg) * | 0.24 ± 0.04 b | 0.23 ± 0.07 c | 0.26 ± 0.04 a | 0.22 ± 0.05 b | 0.21 ± 0.08 c | 0.24 ± 0.05 a |
Head height (cm) | 15.24 ± 1.16 a | 15.26 ± 2.06 a | 15.36 ± 2.18 a | 15.11 ± 1.89 a | 14.84 ± 1.78 a | 15.26 ± 2.24 a |
Head width (cm) * | 15.37 ± 1.55 b | 15.22 ± 2.08 b | 16.04 ± 2.57 a | 15.08 ± 1.87 a | 14.39 ± 2.06 b | 15.53 ± 3.15 a |
Stem diameter (cm) * | 5.12 ± 0.18 a | 4.98 ± 0.27 b | 5.16 ± 0.42 a | 4.87 ± 0.38 a | 4.35 ± 0.18 b | 4.96 ± 0.49 a |
Stem hollow/solid | Solid | Solid | Solid | Solid | Solid | Solid |
Leaf number | 10 ± 2 a | 9 ± 2 a | 10 ± 2 a | 9 ± 1 a | 10 ± 3 a | 9 ± 2 a |
Leaf color | Green | Green | Green | Green | Green | Green |
Leaf waxiness | High | High | High | High | High | High |
Flower color | Yellow | Yellow | Yellow | Yellow | Yellow | Yellow |
Days to maturity (day)* | 105 ± 3 b | 109 ± 4 a | 106 ± 4 b | 126 ± 3 b | 134 ± 4 a | 128 ± 4 b |
Days to flowering (day) * | 126 ± 3 b | 129 ± 3 a | 126 ± 4 b | 143 ± 2 b | 147 ± 3 a | 142 ± 2 b |
Seeds yield per plant (g) * | 4.13 ± 0.24 a | 3.52 ± 0.58 b | 2.41 ± 0.27 c | 2.86 ± 0.29 a | 2.21 ± 0.56 b | 1.74 ± 0.36 c |
Seeds germination rate (%) * | 86.58 ± 3.77 a | 83.04 ± 4.18 b | 71.76 ± 2.47 c | 85.03 ± 2.61 a | 79.59 ± 2.92 b | 71.46 ± 2.88 c |
Serial Number | Sample Name | Linear Equation | Pearson Test (R2) |
---|---|---|---|
1 | T54C-1 vs. T54C-2_FPKM | Y = 0.965*X + 0.025 | 0.943 |
2 | T54C-1 vs. T54M-1_FPKM | Y = 0.939*X − 0.053 | 0.918 |
3 | T54C-1 vs. T54M-2_FPKM | Y = 0.915*X + 0.046 | 0.875 |
4 | T54C-1 vs. T54S-1_FPKM | Y = 0.913*X + 0.177 | 0.867 |
5 | T54C-1 vs. T54S-2_FPKM | Y = 0.937*X + 0.150 | 0.890 |
6 | T54C-2 vs. T54M-1_FPKM | Y = 0.945*X − 0.073 | 0.918 |
7 | T54C-2 vs. T54M-2_FPKM | Y = 0.917*X + 0.028 | 0.867 |
8 | T54C-2 vs. T54S-1_FPKM | Y = 0.918*X + 0.158 | 0.867 |
9 | T54C-2 vs. T54S-2_FPKM | Y = 0.946*X + 0.130 | 0.905 |
10 | T54M-1 vs. T54M-2_FPKM | Y = 0.960*X + 0.099 | 0.925 |
11 | T54M-1 vs. T54S-1_FPKM | Y = 0.947*X + 0.231 | 0.896 |
12 | T54M-1 vs. T54S-2_FPKM | Y = 0.973*X + 0.205 | 0.973 |
13 | T54M-2 vs. T54S-1_FPKM | Y = 0.947*X + 0.141 | 0.894 |
14 | T54M-2 vs. T54S-2_FPKM | Y = 0.967*X + 0.013 | 0.917 |
15 | T54S-1 vs. T54S-2_FPKM | Y = 0.966*X − 0.013 | 0.919 |
Gene | Function Description | Chromosome | Forward Primer 5′-3′ | Reverse Primer 5′-3′ | Ta (°C) |
---|---|---|---|---|---|
LOC106318096 | Chlorophyll a-b binding protein 13, chloroplastic | C9 | TCTCCACCAAACCAGCAAAG | TCAAGACCGTTGATGCGGAA | 59 |
LOC106313340 | Auxin-responsive protein IAA4 | C9 | CTTGGGTTTTCGGGGGAAGA | CCGTTTAAGCCTCTCACTGGT | 60 |
LOC106316002 | Ethylene receptor 2 (BO-ETR2) | C1 | TGGGTTTAAGCATTTTCATGGGA | GAAAGGGTGGGGACCGTAAG | 60 |
LOC106296937 | Cinnamoyl-CoA reductase 2-like | C6 | AACGGAGCCAAGTTCGTGAT | CGAAAAGAAGAGGGCATTCAGC | 60 |
LOC106299021 | Cytochrome P450 98A8-like | C6 | TGGTGGGCATCCAACATACC | TTGTCGCTAACGAGCCACTT | 60 |
LOC106307625 | ABC transporter B family member 2 | C1 | GGAGGCGTCCAGTGATCC | TCCAACGAGTACTTGGCGAC | 60 |
LOC106305741 | ABC transporter B family member 19 | C7 | AGATCATCCGGGGAGGTGAA | TCATCAAGCATCAAATCATAAGCGT | 60 |
LOC106312287 | 3-ketoacyl-CoA synthase 1 (KCS) | C8 | GCCGTCTCTATCGGCAATGA | CACTCCACATATCCGGTCCA | 60 |
LOC106304303 | Palmitoyl-protein thioesterase 1 | C7 | TTCGGGTTTTACCCGGATGG | TACGCAAAGGCTCCTTGGTT | 60 |
LOC106325611 | 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic-like | C2 | TGGCTGCCTCTTCCTGTTAC | CCGGAGTTAGTTGCTCGGTT | 59 |
LOC106328481 | Chalcone synthase 3-like | C3 | CCAAGCTCCTTGGTCTTCGT | ACGATGCTGGGAAGTATGTGT | 59 |
LOC106298325 | Chalcone--flavonone isomerase-like | C6 | TTGGCTACCTACCTCCTCCC | TCAAACGAACCCGTGACGAT | 60 |
LOC106306241 | Cytochrome P450 81D11 | C7 | ACGAATCTGCGAAGGTGGAG | TGCCTGCATCTGCGGAATAA | 61 |
LOC106298990 | Cytochrome P450 71B5 | C6 | CCGACCTAAGACGGTAGGGA | CCGGAGATCCGGTCAATGAG | 60 |
β-actin | Beta-actin | ATCTGGCATCACACTTTCTAC | ATCTCTTTGCTCATACGGTCT | 55 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Z.; Song, L.; Liu, Y.; Han, F.; Liu, W. Electrophysiological, Morphologic, and Transcriptomic Profiling of the Ogura-CMS, DGMS and Maintainer Broccoli Lines. Plants 2022, 11, 561. https://doi.org/10.3390/plants11040561
Li Z, Song L, Liu Y, Han F, Liu W. Electrophysiological, Morphologic, and Transcriptomic Profiling of the Ogura-CMS, DGMS and Maintainer Broccoli Lines. Plants. 2022; 11(4):561. https://doi.org/10.3390/plants11040561
Chicago/Turabian StyleLi, Zhansheng, Lixiao Song, Yumei Liu, Fengqing Han, and Wei Liu. 2022. "Electrophysiological, Morphologic, and Transcriptomic Profiling of the Ogura-CMS, DGMS and Maintainer Broccoli Lines" Plants 11, no. 4: 561. https://doi.org/10.3390/plants11040561
APA StyleLi, Z., Song, L., Liu, Y., Han, F., & Liu, W. (2022). Electrophysiological, Morphologic, and Transcriptomic Profiling of the Ogura-CMS, DGMS and Maintainer Broccoli Lines. Plants, 11(4), 561. https://doi.org/10.3390/plants11040561