Next Article in Journal
The Role of Chromatin Modifications in the Evolution of Giant Plant Genomes
Previous Article in Journal
Pigment Biosynthesis and Molecular Genetics of Fruit Color in Pepper
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 11
10.3390/plants12112157
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Abiotic-Stress-Responsive Expression of CKX Gene Family in Liriodendron chinense

by
Xiao Sun
1,2,
Liming Zhu
1,2,
Zhaodong Hao
1,2,
Weihuang Wu
1,2,
Lin Xu
1,2,
Yun Yang
1,2,
Jiaji Zhang
1,2,
Ye Lu
1,2,
Jisen Shi
1,2 and
Jinhui Chen
1,2,*
1
State Key Laboratory of Tree Genetics and Breeding, Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China
2
Key Laboratory of Forest Genetics and Biotechnology, Ministry of Education, Nanjing Forestry University, Nanjing 210037, China
*
Author to whom correspondence should be addressed.
Plants 2023, 12(11), 2157; https://doi.org/10.3390/plants12112157
Submission received: 16 April 2023 / Revised: 17 May 2023 / Accepted: 19 May 2023 / Published: 30 May 2023
(This article belongs to the Section Plant Genetics, Genomics and Biotechnology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Liriodendron chinense is a tree species of the Magnoliaceae family, an ancient relict plant mainly used for landscaping and timber production due to its excellent material properties and ornamental value. The cytokinin oxidase/dehydrogenase (CKX) enzyme regulates cytokinin levels and plays an important role in plant growth, development, and resistance. However, too-high or too-low temperatures or soil drought can limit the growth of L. chinense, representing a key issue for research. Here, we identified the CKX gene family in the L. chinense genome and examined its transcriptional responses to cold, drought, and heat stresses. A total of five LcCKX genes, distributed on four chromosomes and divided into three phylogenetic groups, were identified across the whole L. chinense genome. Further analysis showed that multiple hormone- and stress-responsive cis-acting elements are located in the promoter regions of LcCKXs, indicating a potential role of these LcCKXs in plant growth, development, and response to environmental stresses. Based on existing transcriptome data, LcCKXs, especially LcCKX5, were found to transcriptionally respond to cold, heat, and drought stresses. Furthermore, quantitative reverse-transcription PCR (qRT-PCR) showed that LcCKX5 responds to drought stress in an ABA-dependent manner in stems and leaves and in an ABA-independent manner in roots. These results lay a foundation for functional research on LcCKX genes in the resistance breeding of the rare and endangered tree species of L. chinense.

1. Introduction

Cytokinins (CKs) are a group of plant hormones that play an important role in all aspects of plant growth and development, including apical dominance, stem or root branching, leaf spreading, lateral shoot growth, photosynthesis, seed germination, flower transition, and leaf senescence [1,2]. Cytokinins play opposite roles in shoot apical meristems (SAMs) and root apical meristems (RAMs). Plants with lowered cytokinin signal output or cytokinin content form larger RAMs and exhibit more rapidly growing roots [3,4]. Plant CKs promote developmental and physiological processes, drought tolerance, root architecture, and ultimately, crop productivity. CKs are degraded by cytokinin oxidases/dehydrogenases (CKXs), and CKs are precisely maintained in dynamic CK balance in nutritional tissues with the developmental regulation of the CKX-led irreversible degradation of catabolic CKs [5]. Studies have shown that the enhanced expression of CKX in roots to enhance cytokinin degradation leads to the formation of larger root systems in Arabidopsis, barley, oilseed rape, and rice [6].
The CKX gene family has been studied in a variety of plants, such as Arabidopsis, rice, wheat, tobacco, cotton, maize, soybean, chickpea, and others. For example, 7 CKXs (AtCKX1-AtCKX7) have been identified in Arabidopsis; a total of 13 CKXs (ZmCKX1-ZmCKX13) have been identified in maize; and 18 CKXs (GmCKX01-GmCKX18) have been identified in soybean [7,8]. Plants are affected by a variety of environmental abiotic factors, including internal flooding, soil salinity, temperature, and drought, which can interfere with all the metabolic activities of plants. The expression profiles of most miRNAs involved in plant growth and development are altered under abiotic and biotic stresses. These latter observations suggest that plant growth and development impaired under stress may be controlled by different stress-responsive miRNAs [9,10]. Recently, several reports have suggested that CKXs play an important role in stress response, especially under abiotic stress [11]. The expression profiles of GmCKX genes with respect to different stress treatments and tissues were different. Stress treatments significantly up-regulated the expression levels of GmCKX13 in leaves and roots but down-regulated the expression levels of GmCKX3 and GmCKX8; the GmCKX14 gene was highly up-regulated in soybean leaves under three stress treatments, while its expression levels in roots were significantly down-regulated [11]. In a related study on tobacco, gene expression analysis revealed that each NtCKX gene responded differently to salt stress and exogenous abscisic acid treatment. The four NtCKX genes studied showed an ABA-induced expression trend with different peak times. Under salt stress, NtCKX expression was significantly repressed in two genes and up-regulated in the others [12].
Priyanka Jain et al. studied the expression pattern of CKX genes in wheat. CKX7 was expressed at low levels in leaf, inflorescence, and spike tissues. CKX4 and CKX5 were expressed at higher levels in leaf tissues [13]. CKX3 and CKX11 were expressed at different levels in all the tissues studied, while CKX10 was expressed at lower levels in all tissues except leaves [13]. BjuCKX11 and BjuCKX13 were significantly up-regulated in the S2 phase, which had the highest expression levels among the four periods, while the highest expression levels of BjuCKX12 and BjuCKX14 occurred in the S4 phase [14]. The expression of both genes in subpopulation V showed the same trend, i.e., it increased, then decreased, and then increased in the four periods (S1–S4), with a peak in S2 [14].
Liriodendron chinense (Hemsl.) Sarg. is a relict tree species that is native to southern China. It is a rare Tertiary relict tree species belonging to the magnolia family (Magnoliaceae) [15]. It is famous for its unique leaf shape, rapid growth, and soft texture, so it is often used as an ornamental tree and in wood production. However, the underlying genetic mechanisms of leaf development and morphogenesis remain poorly understood. As it is a valuable ornamental plant, it is meaningful to understand the development and morphogenesis of L. chinense leaves, and L. chinense genome and transcriptome information has recently been released [16]. Yang et al. performed transcriptome sequencing and comparative transcriptome analysis of the petals and sepals of L. chinense. in 2014 and found that carotenoid-biosynthesis-related genes were significantly differentially expressed between the petals and sepals of L. chinense [17]. Zhong et al. conducted a preliminary investigation of the genome of L. chinense rowanii in 2017 based on the Illumina sequencing platform, which showed that the genome of L. chinense rowanii belongs to a highly repetitive and highly heterozygous genome [18].
In this study, the genomic data of L. chinense were analyzed to identify members of the CKX gene family at the genome-wide level and to characterize their physical and chemical properties, basic features, gene structure, evolutionary relationships, chromosomal positioning, protein tertiary structure, and cis-acting elements. To determine the gene expression patterns of the CKX gene family members, we analyzed transcriptome data relative to different organs; somatic embryogenesis; and cold, heat, and drought stress conditions. Finally, quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis further confirmed the differential expression patterns of LcCKX5 genes in multiple organs and under drought abiotic stress. Evolutionary analysis helped to provide a comprehensive understanding of the origin and evolution of CKX in L. chinensis and laid the foundation for the study of its gene function. Many gene structures and promoter analyses also provided the basis for exploring their gene regulatory networks. This research targeted the study and transformation of abiotic-stress-related genes in the L. chinense genome, and the results provide a valuable basis for further functional studies of LcCKX in the context of cytokinin dynamic balance and abiotic stress, which could help improve adaptation to drought environments and lay the foundation for the further development of the quality-timber industry.

2. Results

2.1. Identification of CKX Gene Family in L. chinense Genome

A total of five CKX genes were identified in the genome of L. chinense and were named LcCKX1-LcCKX5 according to the nomenclature of the CKX gene family in Arabidopsis (Table 1 and Table S1). CDD analysis showed that these five LcCKX proteins all possess two domains, i.e., an FAD-binding domain and a cytokin-binding domain. Physicochemical property analysis showed that the molecular weight of these five CKX proteins ranged from 45,216.77 to 59,699.25, while the isoelectric point ranged from 5.7 to 8.8. In addition, the hydrophilic index (GRAVY) of LcCKXs was less than 0, except for LcCKX2, indicating that most LcCKXs are mostly hydrophilic proteins.

2.2. Phylogenetic Analysis of LcCKX Proteins

To further explore the phylogenetic relationships and evolutionary history of the LcCKX gene family, we constructed a phylogenetic tree containing CKX proteins from the basal angiosperm Amborella trichopoda, the magnoliophyte L. chinense, the monocotyledons Oryza sativa and Zea mays, and the dicotyledon Arabidopsis thaliana. A total of 44 CKXs were used to construct a phylogenetic evolutionary tree using the maximum-likelihood (ML) method, leading to three main phylogenetic groups (I, II, and III), two of which could be further divided into two subgroups (IIa and IIb, and IIIa and IIIb) (Figure 1). Among them, group I comprises only three AmCKXs, while the rest of the groups contain CKXs from all five examined species. Specifically, LcCKX1 and -2 were grouped in IIIb, and LcCKX3, -4, and -5 were grouped in II (Figure 1).

2.3. Analysis of Structure and Conserved Motifs of LcCKX Genes

Based on the analysis of the gene structure (Figure 2), we found that LcCKX1, LcCKX2, and LcCKX5 have four exons, while LcCKX3 and LcCKX4 have six and five exons, respectively. The identification of conserved motifs showed that all five LcCKXs protein sequences contain motifs 1, 3, 4, 6, 8, and 9 in the same order, hinting at the conserved function of these LcCKX proteins. Meanwhile, motifs 2 and 7 were only absent in LcCKX2 and -7, respectively, while motif 5 was present in LcCKX3-5, implying the functional differentiation of these LcCKXs.

2.4. Chromosome Localization and Tertiary Structure of LcCKX Genes

The chromosomal localization analysis showed that members of the LcCKX gene family are unevenly distributed on 13 L. chinense chromosomes (Figure 2a). Four CKX genes are distributed on three chromosomes, i.e., Chr2, -6, and -7, and the remaining one is located on a scaffold. The tertiary structure of a protein is the three-dimensional conformation of a protein molecule in its natural folded state. The tertiary structure is formed by further coiling and folding on the basis of the secondary structure, and the characterization of the tertiary structure of proteins is of great importance for the study of the functional properties of proteins. The predictions of the 3D structures of LcCKXs (Figure 3b) show that LcCKX1 and LcCKX2 have a heart-shaped structure and a smaller mass. The LcCKX3, LcCKX4, and LcCKX5 models are more similar in structure and have a butterfly shape, and the protein structure morphologies show a high degree of similarity. These proteins all have one or several grooved structures. The grooved structures may provide the conditions for them to bind substrates to exert enzymatic activity, and the center of enzymatic activity may be located in these structures.

2.5. Prediction of Cis-Acting Elements in LcCKX Promoter Regions

The cis-acting elements in the gene promoter region can be bound by specific transcription factors, thus regulating the expression of downstream genes. The prediction of cis-acting elements suggested that there are three main classes in the LcCKX family (Table 2), i.e., phytohormone signaling, environmental stress, and MYB binding sites. All LcCKX promoters contain abscisic acid (ABA) response elements, indicating that the LcCKX gene family might be sensitive to ABA. However, part of the LcCKX gene family also potentially responds to other phytohormones, such as ZT, MeJA, GA, and SA, indicating that these LcCKXs might be extensively involved in plant growth and development. Furthermore, most LcCKXs contain cis-elements that are related to cold and/or drought stress, implying a potential function of these LcCKXs in abiotic stress response.

2.6. Gene Expression Pattern Analysis of LcCKX Family

The transcriptome sequence data of L. chinense were downloaded from the NCBI SRA database, and the expression level of the genes was obtained using salmonid analysis. We determined the expression patterns of the LcCKX gene family in leaves under drought, cold (4 °C), and heat (40 °C) stresses (Figure 4a). LcCKX5 showed a strong transcriptional response under all three stresses. Specifically, the expression of LcCKX5 was up-regulated and peaked after 12 h and 3 d in response to heat and drought stresses, respectively. In contrast, the expression level of LcCKX5 decreased under cold stress. In comparison, LcCKX1, -3, and -4 responded to these abiotic stresses, but less strongly, while LcCKX2 seemed not to be expressed at all. The above results indicate that LcCKX genes differentially responded to different stresses and that LcCKX5 might be a valuable target for further research on the resistance breeding of L. chinense.
To elucidate the expression pattern of LcCKXs in the growth and development of L. chinense, we constructed gene expression profiles for different stages of the somatic embryogenesis of L. chinense (Figure 4b). LcCKX2, LcCKX3, and LcCKX5 were found to be involved in the process from embryonic callus to regeneration plantlet; LcCKX3 showed a transcriptional association during somatic embryo development, while LcCKX5 might be involved in somatic embryo maturation.
Meanwhile, when comparing the expression of the LcCKX gene family in different organs of L. chinense (Figure 4c), the analysis showed that LcCKX1 was highly expressed in different organs of the petals, especially in the shoot apex, while LcCKX2 was more expressed in bracts and stamens than in other parts. In contrast, LcCKX3 and LcCKX4 had low or no expression in different tissues. The above results suggest that LcCKX genes are extensively involved in plant growth and development, as well as responses to abiotic stresses, in L. chinense.

2.7. Expression Analysis of LcCKX5 under Abiotic Stress

To further investigate the expression pattern of LcCKX5 under drought stress, 20% PEG8000 was used to treat L. chinensis seedlings to simulate drought conditions, and the transcriptional response of LcCKX5 was quantified using qRT-PCR. The internal reference genes and related primers are shown in the Table 3. The results show that the expression change of LcCKX5 differed between roots and shoots in response to drought stress. Specifically, under drought stress, the expression of LcCKX5 decreased and then increased over time in roots, while there were no significant changes in pairs of stems, and there was a gradual decrease in leaves (Figure 5 PEG). Increasing ABA treatment in parallel with drought stress showed a decreasing trend in LcCKX5 in roots for a short period of time which subsequently appeared to increase (Figure 5 PEG+ABA-Root); while overall expression was suppressed in stems and leaves, no significant effect on roots under drought stress was observed (Figure 5 PEG+ABA-Stem and PEG+ABA-Leaf). Interestingly, the exogenous application of the ABA biosynthesis inhibitor Fluidon (Flu) completely disrupted the expression pattern of LcCKX5 in both stems and leaves while still showing a decreasing trend and then an increasing trend in roots under drought stress (Figure 5 PEG+Flu). The expression of LcCKX5 decreased and then increased with the increase in stress time in roots and stems, while the opposite was true in leaves.

3. Discussion

Cytokinin dehydrogenase regulates the content of cytokinin and plays an important role in balancing the synthesis and degradation of cytokinin in plants [19,20]. CKX plays a very important role in balancing the synthesis and degradation of cytokinins in plants. With the continuous development of plant genomics and reverse genetics, we can provide powerful tools to study CKX genes [21]. The decipherment of the genome of L. chinensis, a representative species of the Liriodendron genus in the Magnoliophyta family, provides new insights into the phylogenetic position of magnoliophytes in angiosperms [22]. CKX gene families have been identified or deduced in Arabidopsis, rice, wheat (Triticum aestivum L.), maize (Zea mays L.), cotton (Gossypium hirsutum L.), and alfalfa (Medicago sativa L.) [23,24,25]. The CKX gene family was identified or deduced in different plants, such as Arabidopsis, maize, cotton, and alfalfa. There are 7 AtCKX genes in Arabidopsis, 13 ZmCKXs in maize, 11 OsCKXs in rice, 8 VvCKXs in grape (Vitis vinifera L.), and 5 MnCKXs in mulberry (Morus notabilis) [7,26,27,28,29]. In this study, five LcCKX genes were identified in L. chinensis. The number of genes in other species was small, which showed that CKX is a gene family with a small number of members. The five LcCKX genes identified fall into three subgroups, and the genes in each subgroup are highly conserved in terms of protein physicochemical properties, conserved motifs, and gene structure.
The identification of members of a species-specific gene family using the conserved structural domains of a particular gene family is an accurate and efficient method. Analysis of the conserved structural domains showed that most of them are relatively conserved in the family genes, and only some of them show some specificity; for example, motif 5 is only present in group II (LcCKX3~5) and motif 10 is only present in group IIa (LcCKX3~4). This specificity may be related to the functions assumed by different groups of CKX and to the differences in the higher structure of the proteins. Analysis of the 3D structure of the proteins showed that the butterfly-shaped protein structure corresponds to three members of group II, while the protein with a heart-shaped tertiary structure corresponds to two members of group I.
Cis-regulatory elements are specific motifs located in the promoter region of genes that act as binding sites for genes and play an important role in stress response by regulating the transcription of downstream genes [30]. In addition, some phytohormones, such as abscisic acid, salicylic acid, jasmonic acid, and ethylene, are also involved in regulating the adaptive response of plants to abiotic stresses [31]. According to the results of the predicted cis-acting elements, the LcCKX gene mainly responds to plant hormones, light, and abiotic stress. In other plant species, such as in maize, these cis-acting elements are also present in large numbers in the promoter regions of the CKX gene [32]. These results further suggest that the LcCKX gene may be important and involved in the plant response to abiotic stress. As the promoter regions of the five LcCKXs contain different types, numbers, and distributions of cis-acting elements, but also share the same characteristics, it is assumed that the different LcCKXs have different expression patterns.
The cytokinin group of plant hormones is involved in regulating several aspects of plant growth and development [33], many of which have direct effects on crop improvement, such as the regulation of the root crown structure [34], the regulation of inflorescence meristem tissue activity and seed yield [35,36], the regulation of leaf senescence and photosynthesis, and response to biotic and abiotic stresses [27,37,38]. According to the RNA-Seq data, under abiotic stress conditions such as drought, low-temperature treatments, and high-temperature treatments, the expression of some LcCKX genes can be changed, thus playing a defensive and protective role in plant growth and development processes, which may also be related to the resistance of goosefoot, but the exact mechanism of this effect needs to be studied in the future.
In other species, CKXs have diverse expression patterns, even when they are tandemly repeated. In maize, for example, ZmCKX1, ZmCKX6, and ZmCKX10 are expressed in all tissues, while ZmCKX7 and ZmCKX8 are only expressed in male ears and are clearly tissue-specific. ZmCKXs differ in number and expression in different tissues under the same stress conditions [32]. In Plasmodiophora brassicae, CKXs show different expression patterns in different tissues, indicating different functions [39]. Under normal conditions, three of these genes were highly expressed in all tissues studied, which is characteristic of the expression pattern of housekeeping genes [39].
Among tree species, CKXs have different expression patterns in different tissues. In studies related to CKX in Jatropha curcas, it was found that JcCKX1 is mainly expressed in flower buds, roots, and female flowers, while JcCKX2 shows very strong expression in female flowers and seeds. JcCKX3 is highly expressed in male flowers, and JcCKX4 shows high expression levels in mature leaves and female flowers, and extremely high expression in seeds. JcCKX5 is mainly expressed in stems, tender leaves, and fruits, while JcCKX6 is expressed in all tissues, and JcCKX7 is mainly expressed in roots [40]. In Malus domestica, the expression of CKX is significantly higher in leaves than in other tissues; MdCKX1, MdCKX7, MdCKX9, and MdCKX11/12 have high levels of expression in roots. In addition, compared with other tissues, all MdCKX levels are lower in the stem and axillary buds, indicating that CK accumulation is naturally limited to the stem and axillary buds. At the same time, Ming Tan et al. treated the experimental materials with 6-BA, and throughout the sampling time, MdCKX1, MdCKX2, MdCKX5, and MdCKX10 were significantly up-regulated, especially MdCKX10, whose transcription level increased by more than 100 times in 48 h. The MdCKX2, MdCKX4, MdCKX6, MdCKX7, and MdCKX8 transcripts did not respond to 6-BA treatment, and their expression levels were similar to those in untreated control buds after 24 and 48 h [41]. Combined with the relevant results of this study, it can be found that the expression pattern of CKX in different tissues of trees is similar and that there are also different expression locations. In general, the expression amount of CKX in roots is relative, while under non-biotic stress, the response of CKX in roots is faster and the response in leaves and stems is slower.
In summary, this research focused on LcCKX5 RNA-Seq data, namely the expression pattern of LcCKXs with respect to different tissues, time, and stress conditions, as well as functional predictions. The results could help to screen potential resistance genes and provide very detailed and reliable information for subsequent studies.

4. Materials and Methods

4.1. Identification of CKX Genes in L. chinense

L. chinense protein sequences were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/, accessed on 12 April 2022). The Hidden Markov Model (HMM) profile (PF09265) of the cytokinin-binding conserved structural domain of the CKX gene family and the HMM profile (PF01565) of the FAD-binding conserved structural domain were downloaded from the Pfam database (https://pfam.xfam.org, accessed on 5 May 2022). HMMER 3.2 software was used to analyze and identify the protein sequences that contain both conserved structural domains. The candidate member sequences were compared using NCBI (https://www.ncbi.nlm.nih.gov/, accessed on 5 July 2022) to determine their CDS and position information, and the CDD database (https://www.ncbi.nlm.nih.gov/cdd/, accessed on 5 July 2022) was used to manually analyze and confirm that the candidate genes contained 2 conserved structural domains at the same time; finally, the members of the CKX gene family were obtained.

4.2. Protein Physicochemical Properties and Tertiary Structure Prediction of CKX Genes in L. chinense

According to the identified CKX gene ID, the chromosome location information was obtained from the GFF3 file. The physicochemical properties of the proteins, including relative molecular mass, theoretical isoelectric point, instability index, and hydrophilicity, were analyzed using the web-based online tool ExPASy (https://web.expasy.org/, accessed on 5 July 2022). The position information of the LcCKX genes on the chromosome was picked up from the L. chinense annotations using TBtools. The predictive analysis of the 3D structures of different members of the CKX gene family was performed according to the online website SWISS-MODEL (https://swissmodel.expasy.org/, accessed on 5 July 2022).

4.3. Phylogenetic Analysis of CKX Genes in L. chinense

MEGA v10.1.8 (Temple, Philadelphia, PA, USA) was used to examine CXKs from L. chinense, rice, and Arabidopsis to determine their phylogenetic relationship. We used MUSCLE implemented in MEGA to align the amino acid sequences and the maximum-likelihood estimation algorithm to create phylogenetic trees with a bootstrap value of 1000. DANMAN v9.0 (Lynnon Corporation, San Ramon, CA, USA) was used for the multi-fragment alignment of amino acid sequences.

4.4. Gene Structure and Conserved Motif Analysis of CKX Genes in L. chinense

The structure of the gene was produced based on the length of the CKX gene and the location information of the CDS. The conserved patterns of the aa sequences of all members of LcCKX were analyzed using MEME (http://memesuite.org/tools/meme/, accessed on 5 July 2022), and the phylogenetic tree, gene structure, and conserved patterns of the LcCKX gene were merged using TBtools.

4.5. Cis-Acting Elements of CKX Genes in L. chinensis

The genomic DNA sequences 2000 bp upstream of TAG in the sequences of different members of the LcCKX family were selected using whole-genome data of L. chinense, predicted and analyzed in cis using Plant Care (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 5 July 2022), and mapped and displayed using OriginPro9.06Bit software to predict gene function.

4.6. RNA-seq Analysis of LcCKX Gene Expression Levels in Different Organs and under Multiple Stresses

The drought stress transcriptome data of L. hybrid were annotated with accession number PRJNA679101 and can be downloaded from NCBI (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA679101/; accessed on 5 September 2022). The data on somatic embryogenesis are unpublished. Heatmaps visualizing expressions were realized with TBtools software (v1.09). The log2 (TPM + 1) value was used for standardization and hierarchical cluster analysis.
Transcript data of different organs and hybrid data of L. chinense under high-temperature stress and drought stress were downloaded from NCBI. The transcript data on low temperature, L. chinense petal development, and hybrid L. chinense somatic embryogenesis are undisclosed data. The expression levels of related genes are listed in Table S2. All mRNA abundance values were measured in transcripts per million (TPM) based on the L. chinense genomic database.

4.7. Plant Materials and Abiotic Stress Treatment

Seedlings produced during the somatic embryogenesis of L. chinense were used as the starting material for this study. Prior to stress treatment, somatic embryogenic seedlings were removed from the culture vessels and domesticated in a greenhouse for 2 weeks (conditions: 22 °C, prolonged light for 16 h and darkness for 8 h, and relative humidity of 75%). Three biological replications were performed using 15% PEG8000 to simulate a natural drought environment. Roots, stems, and leaves were harvested after 6 h and 24 h of drought treatment, respectively. All experimental tissue samples were immediately frozen in liquid nitrogen and then stored at −80 °C.

4.8. RNA Extraction and Quantitative Real-Time PCR Analysis

The first-strand gene was synthesized from 1.0 mg of RNA using an Evo M-MLV RT kit with gDNA Clean (Changsha Precision Biotechnology (Hunan) Co.). An Equalbit 1× dsDNA HS Assay Kit (EQ121-01; Vazyme, Nanjing, China) was used to complete the quantification of all reverse cDNA. Polymerase chain reaction amplification was performed in 20 µL using a SYBR®Green PreMix Pro Taq HS qPCR Kit (Precision Biotechnology (Hunan) Co., Ltd., Changsha, China) using a Roche LightCycler® 480 Real-Time Polymerase Chain Reaction System. Three replicates were performed for each selected gene. The expression pattern of CKX-related genes under low-temperature stress was studied using qRT-PCR, and Primer 5.0 software was used to design primers in the non-conserved structural domain region of the genes. qPCR SYBR Green Master Mix (Vazyme) was used for real-time quantitative PCR, and GAPDH and 18s were used as the internal control genes. The real-time PCR cycling parameters were 95 °C for 30 s, followed by 45 cycles at 95 °C for 5 s and 60 °C for 30 s, with melting curve analysis. All reactions were performed in triplicate to ensure the repeatability of the results. Gene expression levels were calculated using 2−∆∆Ct [42].

5. Conclusions

In this study, comprehensive analysis of the CKX gene family in the L. chinense genome was conducted, and five LcCKX genes were identified. Subsequently, gene structure analysis, phylogeny, chromosomal localization, gene duplication, and genome-wide identification and analysis of CKX family genes in L. chinense were carried out using bioinformatics and qRT-PCR. The differential expression of LcCKX5 genes in different tissues of L. chinense and the different expression trends under drought stress and ABA treatment may indicate that they play an important role in drought resistance and tissue development. The present study provides comprehensive information on the CKX genes in L. chinense, which could help to determine the functions of CKX genes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants12112157/s1, Table S1: Protein sequences of 5 LcCKXs; Table S2: Protein names and sequences of CKX.

Author Contributions

X.S. was the designer and performer of this study, completed data analysis, and wrote the first draft of the paper; L.Z. and W.W. assisted in some of the data analysis; L.X., Y.Y., Y.L., J.Z. and J.S. instructs the experimental operation; J.C. and Z.H. directed the experimental design, data analysis, paper writing, and full-text revision. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by National Key Research and Development Program of China during the 14th Five-year Plan Period (2021YFD2200102), Youth Foundation of the Natural Science Foundation of Jiangsu Province (grant No. BK20210614), Natural Science Foundation of China (32071784), and Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Data Availability Statement

Transcriptome data of somatic embryogenesis and tissues have not yet been published. The drought stress transcriptome data of L. hybrid were annotated with accession number PRJNA679101 and can be downloaded from NCBI (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA679101/; accessed on 5 September 2022). The complete genome, transcript/protein sequences, and genome feature file of Lchi were downloaded from https://www.ncbi.nlm.nih.gov/assembly/GCA_003013855.2 (accessed on 5 September 2022).

Acknowledgments

We thank Nanjing Forestry University for providing a platform for our experiments and all those who contributed to this article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Liu, Z.; Lv, Y.; Zhang, M.; Liu, Y.; Kong, L.; Zou, M.; Lu, G.; Cao, J.; Yu, X. Identification, expression, and comparative genomic analysis of the IPT and CKX gene families in Chinese cabbage (Brassica rapa ssp. pekinensis). BMC Genom. 2013, 14, 594. [Google Scholar] [CrossRef] [PubMed]
  2. Werner, S.; Bartrina, I.; Novak, O.; Strnad, M.; Werner, T.; Schmulling, T. The Cytokinin Status of the Epidermis Regulates Aspects of Vegetative and Reproductive Development in Arabidopsis thaliana. Front. Plant Sci. 2021, 12, 613488. [Google Scholar] [CrossRef] [PubMed]
  3. Geng, L.; Li, Q.; Jiao, L.; Xiang, Y.; Deng, Q.; Zhou, D.X.; Zhao, Y. WOX11 and CRL1 act synergistically to promote crown root development by maintaining cytokinin homeostasis in rice. New. Phytol. 2022, 237, 204–216. [Google Scholar] [CrossRef] [PubMed]
  4. Schaller, G.E.; Street, I.H.; Kieber, J.J. Cytokinin and the cell cycle. Curr. Opin. Plant Biol. 2014, 21, 7–15. [Google Scholar] [CrossRef]
  5. Khuman, A.; Kumar, V.; Chaudhary, B. Evolutionary expansion and expression dynamics of cytokinin-catabolizing CKX gene family in the modern amphidiploid mustard (Brassica sp.). 3 Biotech. 2022, 12, 233. [Google Scholar] [CrossRef]
  6. Ramireddy, E.; Nelissen, H.; Leuendorf, J.E.; Van Lijsebettens, M.; Inzé, D.; Schmülling, T. Root engineering in maize by increasing cytokinin degradation causes enhanced root growth and leaf mineral enrichment. Plant Mol. Biol. 2021, 106, 555–567. [Google Scholar] [CrossRef]
  7. Gu, R.; Fu, J.; Guo, S.; Duan, F.; Wang, Z.; Mi, G.; Yuan, L. Comparative Expression and Phylogenetic Analysis of Maize Cytokinin Dehydrogenase/Oxidase (CKX) Gene Family. J. Plant Growth Regul. 2010, 29, 428–440. [Google Scholar] [CrossRef]
  8. Mahto, R.K.; Ambika; Singh, C.; Chandana, B.S.; Singh, R.K.; Verma, S.; Gahlaut, V.; Manohar, M.; Yadav, N.; Kumar, R. Chickpea Biofortification for Cytokinin Dehydrogenase via Genome Editing to Enhance Abiotic-Biotic Stress Tolerance and Food Security. Front. Genet. 2022, 13, 900324. [Google Scholar] [CrossRef]
  9. Noman, A.; Fahad, S.; Aqeel, M.; Ali, U.; Amanullah; Anwar, S.; Baloch, S.K.; Zainab, M. miRNAs: Major modulators for crop growth and development under abiotic stresses. Biotechnol. Lett. 2017, 39, 685–700. [Google Scholar] [CrossRef]
  10. Khan, A.; Tan, D.K.Y.; Afridi, M.Z.; Luo, H.; Tung, S.A.; Ajab, M.; Fahad, S. Nitrogen fertility and abiotic stresses management in cotton crop: A review. Environ. Sci. Pollut. R. 2017, 24, 14551–14566. [Google Scholar] [CrossRef]
  11. Du, Y.; Zhang, Z.; Gu, Y.; Li, W.; Wang, W.; Yuan, X.; Zhang, Y.; Yuan, M.; Du, J.; Zhao, Q. Genome-wide identification of the soybean cytokinin oxidase/dehydrogenase gene family and its diverse roles in response to multiple abiotic stress. Front. Plant Sci. 2023, 14, 1163219. [Google Scholar] [CrossRef] [PubMed]
  12. Chen, W.; Wang, G.; Yi, M.; Gao, T.; Song, C.; Gao, Q.; Xia, Q.; Xiang, H. Whole-genome identification and salt- and ABA-induced expression trends of the Nicotiana tabacum CKX gene family. Plant Biotechnol. Rep. 2023. [Google Scholar] [CrossRef]
  13. Jain, P.; Singh, A.; Iquebal, M.A.; Jaiswal, S.; Kumar, S.; Kumar, D.; Rai, A. Genome-Wide Analysis and Evolutionary Perspective of the Cytokinin Dehydrogenase Gene Family in Wheat (Triticum aestivum L.). Front. Genet. 2022, 13, 931659. [Google Scholar] [CrossRef]
  14. Li, M.; Zhou, J.; Gong, L.; Zhang, R.; Wang, Y.; Wang, C.; Du, X.; Luo, Y.; Zhang, Y.; Wang, X.; et al. Identification and Expression Analysis of CKX Gene Family in Brassica juncea var. tumida and Their Functional Analysis in Stem Development. Horticulturae 2022, 8, 705. [Google Scholar] [CrossRef]
  15. Wu, W.; Zhu, S.; Zhu, L.; Wang, D.; Liu, Y.; Liu, S.; Zhang, J.; Hao, Z.; Lu, Y.; Cheng, T.; et al. Characterization of the Liriodendron Chinense MYB Gene Family and Its Role in Abiotic Stress Response. Front. Plant Sci. 2021, 12, 641280. [Google Scholar] [CrossRef]
  16. Wu, W.; Zhu, S.; Xu, L.; Zhu, L.; Wang, D.; Liu, Y.; Liu, S.; Hao, Z.; Lu, Y.; Yang, L.; et al. Genome-wide identification of the Liriodendron chinense WRKY gene family and its diverse roles in response to multiple abiotic stress. BMC Plant Biol. 2022, 22, 25. [Google Scholar] [CrossRef]
  17. Yang, Y.; Xu, M.; Luo, Q.; Wang, J.; Li, H. De novo transcriptome analysis of Liriodendron chinense petals and leaves by Illumina sequencing. Gene 2014, 534, 155–162. [Google Scholar] [CrossRef]
  18. Zhong, Y.D.; Zhang, X.; Li, Y.Q.; Liu, L.P.; Yu, F.X. Genome Survey of Liriodendron chinense (Hemsl.) Sarg. Mol. Plant Breed. 2017, 15, 507–512. [Google Scholar] [CrossRef]
  19. Dash, P.K.; Rai, R. Green revolution to grain revolution: Florigen in the frontiers. J. Biotechnol. 2022, 343, 38–46. [Google Scholar] [CrossRef]
  20. Durán-Medina, Y.; Díaz-Ramírez, D.; Marsch-Martínez, N. Cytokinins on the Move. Front. Plant Sci. 2017, 8, 146. [Google Scholar] [CrossRef]
  21. Blume, R.; Yemets, A.; Korkhovyi, V.; Radchuk, V.; Rakhmetov, D.; Blume, Y. Genome-wide identification and analysis of the cytokinin oxidase/dehydrogenase (ckx) gene family in finger millet (Eleusine coracana). Front. Genet. 2022, 13, 963789. [Google Scholar] [CrossRef] [PubMed]
  22. Zhaodong, H. Liriodendron Genome Evolution and Thegenetic Basis of Flower Color Variation. Doctor Dissertation, Nanjing Forestry University, Nanjing, China, 2020. [Google Scholar]
  23. Nguyen, H.N.; Kambhampati, S.; Kisiala, A.; Seegobin, M.; Emery, R. The soybean (Glycine max L.) cytokinin oxidase/dehydrogenase multigene family; Identification of natural variations for altered cytokinin content and seed yield. Plant Direct 2021, 5, e308. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, C.; Wang, H.; Zhu, H.; Ji, W.; Hou, Y.; Meng, Y.; Wen, J.; Mysore, K.S.; Li, X.; Lin, H. Genome-wide identification and characterization of cytokinin oxidase/dehydrogenase family genes in Medicago truncatula. J. Plant Physiol. 2021, 256, 153308. [Google Scholar] [CrossRef]
  25. Galuszka, P.; Frebortova, J.; Werner, T.; Yamada, M.; Strnad, M.; Schmulling, T.; Frebort, I. Cytokinin oxidase/dehydrogenase genes in barley and wheat: Cloning and heterologous expression. Eur. J. Biochem. 2004, 271, 3990–4002. [Google Scholar] [CrossRef] [PubMed]
  26. Kollmer, I.; Novak, O.; Strnad, M.; Schmulling, T.; Werner, T. Overexpression of the cytosolic cytokinin oxidase/dehydrogenase (CKX7) from Arabidopsis causes specific changes in root growth and xylem differentiation. Plant J. 2014, 78, 359–371. [Google Scholar] [CrossRef]
  27. Zheng, X.; Zhang, S.; Liang, Y.; Zhang, R.; Liu, L.; Qin, P.; Zhang, Z.; Wang, Y.; Zhou, J.; Tang, X.; et al. Loss-function mutants of OsCKX gene family based on CRISPR-Cas systems revealed their diversified roles in rice. Plant Genome 2023, e20283. [Google Scholar] [CrossRef]
  28. Yu, K.; Yu, Y.; Bian, L.; Ni, P.; Ji, X.; Guo, D.; Zhang, G.; Yang, Y. Genome-wide identification of cytokinin oxidases/dehydrogenase (CKXs) in grape and expression during berry set. Sci. Hortic-Amst. 2021, 280, 109917. [Google Scholar] [CrossRef]
  29. Zhang, C. Functional Studies on Cytokinin Oxidase/Dehydrogenase Gene in Mulberry. Masteral Dissertation, Southwest University, Chongqing, China, 2016. [Google Scholar]
  30. Nakashima, K.; Yamaguchi-Shinozaki, K.; Shinozaki, K. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat. Front. Plant Sci. 2014, 5, 170. [Google Scholar] [CrossRef]
  31. Santner, A.; Estelle, M. Recent advances and emerging trends in plant hormone signalling. Nature 2009, 459, 1071–1078. [Google Scholar] [CrossRef]
  32. Zhengnan, L. Bioinformatics Analysis of Maize CKX Gene Family and Selection of Cas9 Transgenic Maize Lines. Masteral Dissertation, Yantai University, Yantai, China, 2021. [Google Scholar]
  33. Sharma, A.; Prakash, S.; Chattopadhyay, D. Killing two birds with a single stone—Genetic manipulation of cytokinin oxidase/dehydrogenase (CKX) genes for enhancing crop productivity and amelioration of drought stress response. Front. Genet. 2022, 13, 941595. [Google Scholar] [CrossRef]
  34. Kurepa, J.; Smalle, J.A. Auxin/Cytokinin Antagonistic Control of the Shoot/Root Growth Ratio and Its Relevance for Adaptation to Drought and Nutrient Deficiency Stresses. Int. J. Mol. Sci. 2022, 23, 1933. [Google Scholar] [CrossRef] [PubMed]
  35. Li, S.; Zheng, H.; Zhang, X.; Sui, N. Cytokinins as central regulators during plant growth and stress response. Plant Cell Rep. 2021, 40, 271–282. [Google Scholar] [CrossRef] [PubMed]
  36. Cortleven, A.; Leuendorf, J.E.; Frank, M.; Pezzetta, D.; Bolt, S.; Schmülling, T. Cytokinin action in response to abiotic and biotic stresses in plants. Plant Cell Environ. 2019, 42, 998–1018. [Google Scholar] [CrossRef]
  37. Zu, S.H.; Jiang, Y.T.; Chang, J.H.; Zhang, Y.J.; Xue, H.W.; Lin, W.H. Interaction of brassinosteroid and cytokinin promotes ovule initiation and increases seed number per silique in Arabidopsis. J. Integr. Plant Biol. 2022, 64, 702–716. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, Y.; Zhang, M.; Meng, Z.; Wang, B.; Chen, M. Research Progress on the Roles of Cytokinin in Plant Response to Stress. Int. J. Mol. Sci. 2020, 21, 6574. [Google Scholar] [CrossRef] [PubMed]
  39. Zhu, M.; Wang, Y.; Lu, S.; Yang, L.; Zhuang, M.; Zhang, Y.; Lv, H.; Fang, Z.; Hou, X. Genome-wide identification and analysis of cytokinin dehydrogenase/oxidase (CKX) family genes in Brassica oleracea L. reveals their involvement in response to Plasmodiophora brassicae infections. Hortic. Plant J. 2022, 8, 68–80. [Google Scholar] [CrossRef]
  40. Cai, L.; Zhang, L.; Fu, Q.; Xu, Z. Identification and expression analysis of cytokinin metabolic genes IPTs, CYP735A and CKXs in the biofuel plant Jatropha curcas. PeerJ 2018, 6, e4812. [Google Scholar] [CrossRef]
  41. Tan, M.; Li, G.; Qi, S.; Liu, X.; Chen, X.; Ma, J.; Zhang, D.; Han, M. Identification and expression analysis of the IPT and CKX gene families during axillary bud outgrowth in apple (Malus domestica Borkh.). Gene 2018, 651, 106–117. [Google Scholar] [CrossRef]
  42. Štefan, Č.; Alexandra, B.; Juraj, K. Relative quantification of mRNA: Comparison of methods currently used for real-time PCR data analysis. Bmc Mol. Biol. 2007, 8, 113. [Google Scholar]
Plants 12 02157 g001 550
Figure 1. Phylogenetic analysis of CKX proteins. The amino acid sequences of CKXs were aligned using Clustal X, and the phylogenetic tree was constructed using the maximum-likelihood (ML) method in MEGA11 with 1000 bootstrap replicates. The cytokinin dehydrogenase/oxidase genes in L. chinense are marked in red. At: Arabidopsis thaliana; Am: Amborella trichopoda; Lc: Liriodendron chinense; Os; Oryza sativa; Zm: Zea mays.
Figure 1. Phylogenetic analysis of CKX proteins. The amino acid sequences of CKXs were aligned using Clustal X, and the phylogenetic tree was constructed using the maximum-likelihood (ML) method in MEGA11 with 1000 bootstrap replicates. The cytokinin dehydrogenase/oxidase genes in L. chinense are marked in red. At: Arabidopsis thaliana; Am: Amborella trichopoda; Lc: Liriodendron chinense; Os; Oryza sativa; Zm: Zea mays.
Plants 12 02157 g001
Plants 12 02157 g002 550
Figure 2. Gene structure and conserved motifs in LcCKXs. Phylogenetic relationships (a), conserved motifs (b), amino acid composition of each motif (c), and gene structure (d) of CKX genes of L. chinense. Differently colored boxes represent different themes and their positions in each LcCKX sequence.
Figure 2. Gene structure and conserved motifs in LcCKXs. Phylogenetic relationships (a), conserved motifs (b), amino acid composition of each motif (c), and gene structure (d) of CKX genes of L. chinense. Differently colored boxes represent different themes and their positions in each LcCKX sequence.
Plants 12 02157 g002
Plants 12 02157 g003 550
Figure 3. Chromosomal distribution of the CKX genes of L. chinense (a) and 3D structures of LcCKX oxidases showing functional sites (b). a: The scale located on the left panel is in bases, indicating chromosome sizes. The chromosome number is indicated on the left of each chromosome.
Figure 3. Chromosomal distribution of the CKX genes of L. chinense (a) and 3D structures of LcCKX oxidases showing functional sites (b). a: The scale located on the left panel is in bases, indicating chromosome sizes. The chromosome number is indicated on the left of each chromosome.
Plants 12 02157 g003
Plants 12 02157 g004 550
Figure 4. LcCKX gene expression profiles in different organs. (a): Heatmap of LcCKX genes under drought, cold and heat stresses. (b): Heatmap of LcCKX genes in somatic embryogenesis (c): Heatmap of LcCKX genes in seven tissues. The heatmaps show the means of three biological replicates. Transcripts per million (TPM) was used to indicate the gene expression level. PEM: embryogenic callus; ES1: 10 days after liquid culture; ES2: 2 days after screening; ES3: ABA treatment for 1 day; ES4: ABA treatment for 3 days; ES5: globular embryo; ES6: heart-shaped embryo; ES7: torpedo embryo; ES8: immature cotyledon embryo; ES9: mature cotyledon embryo; PL: plantlet.
Figure 4. LcCKX gene expression profiles in different organs. (a): Heatmap of LcCKX genes under drought, cold and heat stresses. (b): Heatmap of LcCKX genes in somatic embryogenesis (c): Heatmap of LcCKX genes in seven tissues. The heatmaps show the means of three biological replicates. Transcripts per million (TPM) was used to indicate the gene expression level. PEM: embryogenic callus; ES1: 10 days after liquid culture; ES2: 2 days after screening; ES3: ABA treatment for 1 day; ES4: ABA treatment for 3 days; ES5: globular embryo; ES6: heart-shaped embryo; ES7: torpedo embryo; ES8: immature cotyledon embryo; ES9: mature cotyledon embryo; PL: plantlet.
Plants 12 02157 g004
Plants 12 02157 g005 550
Figure 5. Expression profiles of LcCKX5 under abiotic stress. Values with a different letter (a–c) were significantly different when assessed using Duncan’s multiple range test (p < 0.05). Same treatment per row, same tissue site per column. The 20% PEG treatment, 20% PEG+ABA treatment, and 20% PEG+Flu treatment in the figure were referred to as PEG, PEG+ABA, and PEG+Flu, respectively.
Figure 5. Expression profiles of LcCKX5 under abiotic stress. Values with a different letter (a–c) were significantly different when assessed using Duncan’s multiple range test (p < 0.05). Same treatment per row, same tissue site per column. The 20% PEG treatment, 20% PEG+ABA treatment, and 20% PEG+Flu treatment in the figure were referred to as PEG, PEG+ABA, and PEG+Flu, respectively.
Plants 12 02157 g005
Table
Table 1. Summary of L. chinense CKX gene family members.
Table 1. Summary of L. chinense CKX gene family members.
Gene NameGene IDLength (aa)Molecular Weight (kDa)Isoelectric Point (pl)GRAVY
LcCKX1Lchi2446444649,620.798.8−0.136
LcCKX2Lchi3402741245,216.776.10.044
LcCKX3Lchi1250253259,699.256.64−0.196
LcCKX4Lchi3287047053,131.665.98−0.164
LcCKX5Lchi1965250856,314.365.7−0.089
Table
Table 2. LcCKX promoter cis-element analysis.
Table 2. LcCKX promoter cis-element analysis.
Gene NamePlant HormoneEnvironmental StressMYB Binding Site
ABAZTMeJAGASALightDefenseCircadianLow
Temperature		Drought
Inducibility
LcCKX1√√√√ √ √
LcCKX2√ √√ √ √
LcCKX3√√√ √√ √√
LcCKX4√ √√ √√ √√
LcCKX5√√ √ √√ √
Table
Table 3. qRT-PCR primers used to quantify LcCKX5 gene expression.
Table 3. qRT-PCR primers used to quantify LcCKX5 gene expression.
Gene Name qRT-PCR Primer
LcCKX5RAAATGGCCTTCCTCTCGACG
FCTTCGTTTCGGCCGTTCATC
18SRCTGCCTTCCTTGGATGTGGT
FGCCCGTCGCTCTGATGAT
Acting97RTGGTCGCACAACTGGTATCG
FTTCCCGTTCAGCAGTGGTCG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sun, X.; Zhu, L.; Hao, Z.; Wu, W.; Xu, L.; Yang, Y.; Zhang, J.; Lu, Y.; Shi, J.; Chen, J. Genome-Wide Identification and Abiotic-Stress-Responsive Expression of CKX Gene Family in Liriodendron chinense. Plants 2023, 12, 2157. https://doi.org/10.3390/plants12112157

AMA Style

Sun X, Zhu L, Hao Z, Wu W, Xu L, Yang Y, Zhang J, Lu Y, Shi J, Chen J. Genome-Wide Identification and Abiotic-Stress-Responsive Expression of CKX Gene Family in Liriodendron chinense. Plants. 2023; 12(11):2157. https://doi.org/10.3390/plants12112157

Chicago/Turabian Style

Sun, Xiao, Liming Zhu, Zhaodong Hao, Weihuang Wu, Lin Xu, Yun Yang, Jiaji Zhang, Ye Lu, Jisen Shi, and Jinhui Chen. 2023. "Genome-Wide Identification and Abiotic-Stress-Responsive Expression of CKX Gene Family in Liriodendron chinense" Plants 12, no. 11: 2157. https://doi.org/10.3390/plants12112157

APA Style

Sun, X., Zhu, L., Hao, Z., Wu, W., Xu, L., Yang, Y., Zhang, J., Lu, Y., Shi, J., & Chen, J. (2023). Genome-Wide Identification and Abiotic-Stress-Responsive Expression of CKX Gene Family in Liriodendron chinense. Plants, 12(11), 2157. https://doi.org/10.3390/plants12112157

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop