Next Article in Journal
Long-Term Alleviation of the Functional Phenotype in Chlorophyll-Deficient Wheat and Impact on Productivity: A Semi-Field Phenotyping Experiment
Next Article in Special Issue
Genome-Wide Analysis of the Rhododendron AP2/ERF Gene Family: Identification and Expression Profiles in Response to Cold, Salt and Drought Stress
Previous Article in Journal
Antibacterial, Antifungal and Algicidal Activity of Phlorotannins, as Principal Biologically Active Components of Ten Species of Brown Algae
Previous Article in Special Issue
Elucidating Biological Functions of 9-cis-Epoxycarotenoid Dioxygenase Genes Involved in Seed Dormancy in Paeonia lactiflora
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 4
10.3390/plants12040823
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

IlAP2, an AP2/ERF Superfamily Gene, Mediates Cadmium Tolerance by Interacting with IlMT2a in Iris lactea var. chinensis

by
Zhiquan Wang
1,2,
Longjie Ni
3,
Liangqin Liu
1,2,
Haiyan Yuan
1,2 and
Chunsun Gu
1,2,3,*
1
Institute of Botany, Jiangsu Province and Chinese Academy of Sciences (Nanjing Botanical Garden Memorial Sun Yat-Sen), Nanjing 210014, China
2
Jiangsu Key Laboratory for the Research and Utilization of Plant Resources, Nanjing 210014, China
3
College of Forest Sciences, Nanjing Forestry University, Nanjing 210037, China
*
Author to whom correspondence should be addressed.
Plants 2023, 12(4), 823; https://doi.org/10.3390/plants12040823
Submission received: 25 December 2022 / Revised: 10 February 2023 / Accepted: 10 February 2023 / Published: 12 February 2023
(This article belongs to the Special Issue Molecular Biology of Ornamental Plants)
Browse Figures
Versions Notes

Abstract

:
Cadmium (Cd) stress has a major impact on ecosystems, so it is important to find suitable Cd-tolerant plants while elucidating the responsible molecular mechanism for phytoremediation to manage Cd soil contamination. Iris lactea var. chinensis is an ornamental perennial groundcover plant with strong tolerance to Cd. Previous studies found that IlAP2, an AP2/ERF superfamily gene, may be an interacting partner of the metallothionein gene IlMT2a, which plays a key role in Cd tolerance. To study the role of IlAP2 in regulating Cd tolerance in I. lactea, we analyzed its regulation function and mechanism based on a yeast two-hybrid assay, a bimolecular fluorescence complementation test, quantitative real-time PCR, transgenics and transcriptome sequencing. The results showed that IlAP2 interacts with IlMT2a and may cooperate with other transcription factors to regulate genes involved in signal transduction and plant hormones, leading to reduced Cd toxicity by hindering Cd transport. These findings provide insights into the mechanism of IlAP2-mediated stress responses to Cd and important gene resources for improving plant stress tolerance in phytoremediation.

1. Introduction

Human activity, natural pollution such as volcanic ash, climate change and the use of recycled water, among other reasons, have resulted in an increase in the area of cadmium (Cd)-contaminated soil [1,2,3]. The presence of Cd in soil is a serious environmental hazard, as the metal is not only toxic to plants but also transmissible through the food chain, threatening ecosystems and human health [4,5]. Compared with physicochemical treatment, phytoremediation is an economical, natural and effective method for managing Cd soil contamination [6,7]. Therefore, it is important to find suitable Cd-tolerant plants and elucidate their relevant molecular mechanisms.
Cd toxicity can inhibit carbon fixation and reduce chlorophyll content and photosynthetic activity [8]. When plants are exposed to Cd-contaminated soil, osmotic stress occurs, reducing the relative moisture content, stomatal conductance and transpiration [9]. Meanwhile, an excessive occurrence of reactive oxygen species (ROS) can damage plant membranes and destroy cell biomolecules and organelles [10]. Cd also interferes with the transport and uptake of mineral elements [9]. To avoid the harm caused by Cd stress, plants have undergone a series of morphological, physiological and biochemical evolutionary changes [11]. One major mechanism is external exclusion, which prevents plant cells from absorbing excessive Cd and hinders Cd transport within the plant [12,13]. Another mechanism is tolerance to Cd accumulation, whereby Cd exists in a non-biologically active conjugated form within the plant through chelation and compartmentalization [14]. Studies have reported that when Cd is absorbed by a plant, proteins such as metallothioneins (MTs) can form stable chelates with the Cd ion, thus reducing its toxicity [4,15]. The regulation of transcription factors is a vital mechanism in plant cells that protects them from heavy metal exposure [16]. For example, previous studies showed that metal-responsive transcription factor 1 (MTF1) is involved in cellular protection against Cd stress signals [17]. Under Cd stress conditions, MTF1 can translocate into the nucleus and bind to metal-responsive elements (MREs), mediating the transcription of a series of downstream genes such as MTs, ZIP10, ferroportin 1 (FPN 1), selenoprotein H (Sel H) and selenoprotein W (Sel W) [16].
Iris lactea var. chinensis, an ornamental perennial groundcover plant that grows fast and forms a large biomass, is resistant to several stresses [18,19]. In particular, it has a very strong tolerance to Cd and the ability to accumulate Cd, which makes it suitable for improving Cd-contaminated soil [20]. We preliminarily analyzed the regulatory mechanism of I. lactea in response to Cd stress through transcriptome sequencing and mined an MT gene, IlMT2a, that may play a key role in Cd tolerance [21]. When constitutively expressed in Arabidopsis thaliana, IlMT2a leads to greater root length under Cd stress compared to the wild type (WT) [22]. In turn, we identified several proteins interacting with IlMT2a using a yeast two-hybrid assay (Y2H) with a yeast library constructed from cadmium-treated I. lactea seedlings and found that IlAP2, an apetala2/ethylene responsive factor, may be an interacting partner of IlMT2a [3].
Many transcription factors can be regulated by Cd stress and induce MTs to confer Cd tolerance [23,24,25], and AP2 genes have been specifically induced by Cd in many plants, including A. thaliana, rice and kenaf [26,27,28]. Many reports have documented that AP2s are important regulators involved in plant growth and development, hormonal regulation, plant metabolite biosynthesis and the conferring of stress tolerance to plants [29,30]. Recently, potato StAP2/ERFs were found to be indispensable for Cd uptake and tolerance and may be useful in designing gene-modified plants with improved Cd tolerance [31]. To study the role of IlAP2 in regulating the Cd tolerance of I. lactea, we cloned the open reading frame of IlAP2 and confirmed the interaction between IlMT2a and IlAP2 using Y2H and a bimolecular fluorescence complementation test (BiFC). Following that, the regulation function and mechanism were explored through genetic transformation and transcriptome sequencing. This study provides information on the molecular mechanism of Cd tolerance and a gene resource for improving plant tolerance to Cd.

2. Results

2.1. Cloning and Analysis of the I1AP2 Sequence

Based on transcriptome data, primers were designed to obtain the full-length ORF sequence of IlAP2. The ORF of IlAP2 was 1296 bp and encoded 432 amino acids. Several proteins with high similarity to IlAP2 in other plant species were selected using Blast on the NCBI website, and their amino acid sequences were analyzed using ClustalX software (Figure 1a). The alignment results showed that IlAP2 contained two conserved AP2 domains (Figure 1a). A phylogenetic tree was constructed using the neighbor-joining method to further analyze the evolutionary relationship between the IlAP2 and AP2 genes in other plants. The results showed that IlAP2 was most closely related to the genes of Phoenix dactylifera (Figure 1b).
To further understand the cytological function of the IlAP2 protein, we inserted IlAP2 into a pCAMBIA expression vector with an eGFP tag and transgenically transformed A. thaliana protoplasts to observe the subcellular distribution of IlAP2 proteins. The IlAP2–GFP fusion protein was only expressed in the nucleus, while the empty GFP vector was expressed in all parts of the cell, which indicates that IlAP2 is a nuclear-localized transcription factor (Figure 2).

2.2. Confirmation of Interaction between IlAP2 and IlMT2a

We re-inserted the complete IlAP2 sequence into a pGADT7 vector and verified the interaction between IlAP2 and IlMT2a by Y2H based on the screening results using SD-Trp-Leu-Ade-His (QDO plates) [3,32]. The positive control (BD-53 + AD-T), negative control (BD-Lam + AD-T) and yeast cells co-transformed with PGADT7–IlAP2 and PGBKT7–IlMT2a all grew normally in the SD-Trp-Leu medium, while only the positive plasmid and yeast cells co-transformed with PGADT7–IlAP2 and PGBKT7–IlMT2a turned blue in the SD-Trp-Leu/X-α-Gal medium, indicating that IlAP2 and IlMT2a interact in yeast (Figure 3a). In addition, we carried out a BiFC experiment. A. tumefaciens containing IlAP2–NYFP and IlMT2a–CYFP plasmids were co-injected into tobacco leaves. The obvious interaction between IlAP2 and IlMT2a was verified again. The BiFC fluorescence was located in the nuclear region (Figure 3b).

2.3. IlAP2 Expression Pattern Analysis

To explore the expression pattern of IlAP2 in response to Cd stress, semi-quantitative PCR and RT-qPCR were used to analyze the expression of IlAP2 in I. lactea roots under 50 μM CdCl2 stress at different times. Semi-quantitative PCR showed up-regulated IlAP2 expression after stress treatment, which was further demonstrated by RT-qPCR (Figure 4). There was no significant difference in IlAP2 expression level among the different treatment times (Figure 4).

2.4. Functional Verification of I1AP2 in A. thaliana

To investigate whether IlAP2 can improve Cd tolerance, we constructed I1AP2-overexpressing A. thaliana and obtained eight homozygous T3-generation transgenic lines. Three independent transgenic lines were selected for functional verification: OE2, OE4 and OE5. After 10 days of growth (3-day-old seedlings were exposed to cadmium for 7 days), there was no significant difference in root length and growth between the WT and transgenic plants grown on normal half-MS medium. Under a 7-day Cd treatment, although the root length and growth of the WT and transgenic plants decreased continuously, the degree of decline for the transgenic plants was slower than that of the WT plants (Figure 5), suggesting that IlAP2 improved Cd tolerance in A. thaliana.

2.5. Analysis of the Potential Mechanism of IlAP2 under Cd Stress

To further explore the mechanism by which IlAP2 regulates Cd tolerance, RNA-seq analysis was performed on transgenic A. thaliana seedlings. The comparison between the transgenic A. thaliana and the WT identified 2210 genes as DEGs: 1340 up-regulated and 870 down-regulated (Figure 6a). The GO enrichment analysis showed that the enrichment degree of transferase activity was the highest in molecular function, indicating that ion signal transduction played an important role in I. lactea‘s response after 24 h of Cd stress (Figure 6b). The KEGG enrichment analysis showed that plant hormone signal transduction was significantly enriched (Figure 6c), suggesting that plant hormones also played an important role in response to Cd stress. In addition, we found that bHLH, WRKY, NAC, MYB, GRAS, AP2/ERF and other transcription factors were all affected by IlAP2 after 24 h of Cd stress (Figure 6d). We randomly chose six differentially expressed transcription factors and analyzed the relative changes in expression using qRT-PCR (Figure S1). The results showed that the expression patterns of most of the transcription factors tested with qRT-PCR were similar to those obtained from the sequencing data. Additionally, it was proven again that the transcription factors were affected by IlAP2.

3. Discussion

Heavy metal pollution of soil and water is a serious environmental problem. Among heavy metal pollutants, Cd is considered to be one of the most toxic ones [24]. Cd can be quickly absorbed by plants due to its high solubility in water, which is the main way it enters the food chain [33]. Plant roots can absorb and transport Cd to nutritional and reproductive organs even at low Cd concentrations, which has a negative impact on the regulation of the plant’s nutrition and its mineral balance during growth [34].
Several genes in plants, such as those encoding an ATP-binding transporter, ZRT/IRT-like proteins and glutathione, have been reported to participate in reducing Cd ion toxicity by inhibiting Cd ion absorption and transport, improving Cd ion chelation ability and other processes [35,36]. Gene BcMT2 could enhance Cd tolerance and reduce the production of reactive oxygen species (ROS) in A. thaliana [37]. Similarly, we previously discovered that IlMT2a in I. lactea increased plant tolerance to Cd by potentially reducing the accumulation of H2O2 and O2•− [22]. However, IlMT3, another MT, was identified as an interacting protein of IlMT2a but did not provide protection against Cd toxicity in transgenic A. thaliana [3]. In this study, an AP2/ERF superfamily gene that encodes an interacting protein of IlMT2a, further validated its role in I. lactea‘s response to Cd stress.
The transformation of transcriptomics under Cd stress has been studied in several plant species, which has helped to identify many Cd-responding transcription factors [24]. Different transcription factors, such as ERF (ethylene-responsive factor), WRKY, bZIP (basic leucine zipper) and MYB (myeloblastosis protein), control the expression of specific stress-related genes under Cd stress and play important roles [24]. Based on the ORF sequence amplified by PCR, the gene was named IlAP2 following the phylogenetic tree and amino acid sequence analyses. To further understand the cytological function of the IlAP2 protein, we studied its expression and found that it was localized in the nucleus. In addition, the BiFC assays showed that the site of interaction between IlAP2 and IlMT2a was also in the nucleus. The expression pattern analysis indicated that IlAP2 was a stress-responsive transcription factor that could be regulated by Cd stress and maintained a steady high level of expression under Cd stress treatment. These findings indicate that IlAP2 may be involved in the response to Cd stress and has a positive effect on Cd-stress tolerance, similar to some StAP2/ERF genes in kenaf [23].
Plant-specific AP2/ERF transcription factors can regulate plant responses to environmental stimuli or plant growth and development, depending on the presence of a highly conserved 60-amino-acid AP2 domain in the protein [38,39]. For example, rice OsEREBP1 attenuates disease caused by Xanthomonas and confers drought and submergence tolerance by activating the jasmonate and abscisic acid signaling pathways, thereby priming the rice plants for enhanced survival under abiotic or biotic stress conditions [40]. A. thaliana RAP2.6 participates in abiotic stress, including abscisic acid (ABA), salt and osmotic stress, possibly through the ABA-dependent pathway [41]. A previous study found that StAP2/ERFs are indispensable in Cd uptake and tolerance and may be useful in designing gene-modified potato plants with improved Cd tolerance [31]. To further demonstrate that IlAP2 can improve plant Cd tolerance, we performed phenotype analysis on overexpressing A. thaliana plants. Under normal conditions, the phenotypic difference between the transgenic and WT A. thaliana plants was not significant. After Cd treatment, the growth of all A. thaliana plants was inhibited, but the root length and growth of the WT were inhibited to a greater extent, indicating that IlAP2 influences the response of A. thaliana to Cd stress.
The overexpression of TdSHN1, a wheat ERF transcription factor, in transgenic tobacco conferred Cd tolerance, produced less ROS under excess Cd compared to WT plants and had higher activities of ROS-scavenging enzymes, which might contribute to Cd tolerance [42]. IlAP2 was confirmed to interact with IlMT2a and improve Cd tolerance. Although there is no report on the overexpression of AtAP2 in Arabidopsis, the expression of potato StAP2/ERF075/077/126 has been shown to increase tolerance to Cd [31]. Therefore, AP2 may play an important role in the regulation of cadmium tolerance. Based on these results, we used transgenic Arabidopsis to preliminarily explore the regulatory mechanism through transcriptome sequencing, laying the foundation for subsequent research. A total of 1,340 and 870 genes were identified as up- and down-regulated, respectively. Enrichment analysis showed that IlAP2 could alter ion signal transduction, plant hormones and other transcription factors at the transcriptional level, playing an important role in the plant’s response to Cd stress. Previous studies have preliminarily analyzed the regulatory mechanism of I. lactea in response to Cd stress through proteome data and found that Cd regulatory proteins were mainly involved in signal transduction, ion transport, redox reactions, ion binding and other functions [43]. These findings indicate that IlAP2 interacts with IlMT2a in the nucleus and may cooperate with other transcription factors to regulate genes related to signal transduction and plant hormones, thereby reducing Cd toxicity.

4. Materials and Methods

4.1. Plant Materials

The plant materials were preserved in Nanjing Botanical Garden Memorial Sun Yat-Sen. Selected seeds of I. lactea were cultivated under a photoperiod of 16/8 h (day/night) in a greenhouse incubator for 6 weeks. Seedlings about 10 cm high were washed and transferred to 50 mL centrifuge tubes containing 1/2 Hoagland solution (Table S1) for 1 week. Following that, the seedlings were transferred again to centrifuge tubes containing 1/2 Hoagland solution with 50 μM CdCl2, as described in a previous study [21]. The roots were sampled at time points of 0, 1, 3, 6, 12 and 24 h, with three biological replicates for each time point. Samples at 0 h served as controls. All sampled plant materials were immediately frozen in liquid nitrogen and stored at −80 °C.
Tobacco (Nicotiana benthamiana) and A. thaliana (ecotype Columbia) seeds were selected and sown in plastic pots containing mixed culture medium (peat, vermiculite and perlite, 1:1:1 by volume) after soaking in sterile water for 24 h. The leaves obtained were used for research on subcellular localization and BiFC testing. Transgenic and WT A. thaliana seeds were prepared and sterilized with 10% NaClO for 10 min, then sown in 1/2 Murashige and Skoog (1/2 MS) medium supplemented with 3% (w/v) sucrose and 0.8% agar, incubated in darkness at 4 °C for 24 h and grown in a sterile environment.

4.2. Sequence Alignment and Subcellular Localization

The open reading frame (ORF) was amplified using Takara LA Taq (Takara, Dalian, China) based on the sequence obtained from transcriptome data (Table 1), and the PCR product was purified and cloned into the pMD19-T vector (Takara) for sequencing verification. Protein sequence was used for alignment using ClustalW (v. 2.1) software, and a phylogenetic tree was constructed using MEGA 7.0 with the neighbor-joining method following 1000 bootstrap replications.
A ClonExpress II One Step Cloning Kit (Vazyme, Nanjing, China) was selected to construct the recombinant plasmid vector containing the target sequence without the stop codon and the pBI121–GFP vector. The recombinant plasmids were transformed into A. thaliana protoplasts, which were isolated with enzymatic hydrolysis [44,45] using the PEG transformation method. Confocal laser scanning microscopy (Zeiss LSM 710 META, Jena, Germany) was used to determine the localization of gene expression through observing GFP fluorescence [46].

4.3. Semi-Quantitative PCR and Quantitative Real-Time PCR (qRT-PCR)

Total RNA of I. lactea roots under Cd stress was extracted using Plant RNeasy Mini Kit (Vazyme) and cDNA was generated with PrimeScript® RT kit (Takara, Dalian, China). Oligo 6.0 was used to design primers for semi-quantitative PCR and qRT-PCR (Table 1). Semi-quantitative PCR and qRT-PCR were performed using IlUBC as the reference gene [20]. Each reaction mix of semi-quantitative PCR contained 1 μL Taq enzyme, 2 μL 10 × PCR Buffer (Mg2+ Free), 1.5 μL Mg2+ (25 mmol·L−1), 1.3 μL dNTP mixture (2.5 mmol·L−1 each), 6 pmol of each primer and 1 μL cDNA (about 1000 ng·μL−1). PCR was performed under the following cycling conditions: 94 °C for 4 min, 25 cycles of 94 °C for 30 s, 55°C for 30 s, 72°C for 30 s and 72 °C for 10 min. PCR products were detected by 1% agarose gel electrophoresis. qRT-PCR was performed using AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China) and StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. The reaction mixture consisted of 2 µL diluted cDNA, 10 µL 2 × SYBR Green Master Mix (Bimake, Houston, TX, USA), 0.4 µL ROX (Dye I), 1 µL of each forward and reverse primer and ddH2O to a total volume of 20 µL. The PCR procedure included an initial denaturation step set at 95 °C for 10 min, followed by 40 cycles of 95°C for 15 s, 60 °C for 30 s and 72 °C for 30 s. Melting curve analyses of the amplified products were conducted at 60–95 °C. Three biological replicates were performed for each treatment and three technical replicates for each reaction. Expression levels were analyzed with the 2−ΔΔCT calculation method.

4.4. Y2H and BiFC

The full-length ORF sequence of IlAP2 was inserted into the PGADT7 vector using a ClonExpress II One Step Cloning Kit (Vazyme) to form the recombinant vector PGADT7–IlAP2. According to the Yeast Protocols Handbook (PT3024-1, Clontech, USA), the negative control (PGBKT7-LAM + PGADT7-T), positive control (PGBKT7-53 + PGADT7-T) and recombinant vector (PGADT7–IlAP2 + PGBKT7–IlMT2a) were transformed into YH2GOLD yeast strain using the Yeastmaker™ Yeast Transformation System 2 (Takara). After growing in SD-Trp-Leu and SD-Trp-Leu/x-α-Gal medium (Takara) for 3 days, the monoclones were inoculated into YPDA liquid medium for 24 h of dark culture. Ten-fold serial dilutions (1, 1:10, 1:102, 1:103 and 1:104) were spotted onto SD-Trp-Leu and SD-Trp-Leu /x-α-Gal solid media for 3 days to observe the phenotype.
The full-length ORF sequence of IlAP2 was inserted into the PSM35S–NYFP vector using the ClonExpress II One Step Cloning Kit (Vazyme). The full-length IlMT2a ORF sequence was inserted into the PSM35S–CyFP vector to form the recombinant vector PSM35S–IlMT2a–CyFP. The constructed vector plasmids were transferred into Agrobacterium tumefaciens GV3101 using electro-transformation method and cultured for 2 days at 30 °C. Subsequently, the constructed vector plasmids were mixed in a 1:1 ratio and injected into the lower epidermis of tobacco leaves. The results were observed with confocal laser scanning microscopy (Zeiss LSM 710 META) after 2 days under low light conditions with BRZ1-nTFP + HLH40-cYFP as positive control [47,48,49].

4.5. Construction and Stress Treatment of Transgenic A. thaliana

The IlAP2 sequence was inserted into the pCAMBIA1305 vector with 35S promoter using the ClonExpress II One Step Cloning Kit (Vazyme), then the 35S:IlAP2 plasmid was transformed into A. tumefaciens GV3101. A. thaliana Columbia was used for transformation by tidbit infection, and homozygous T3 transgenic A. thaliana lines were identified with 1/2 MS medium containing selective antibiotic hygromycin (50 mg/L). The expression of I1AP2 in WT and transgenic A. thaliana was confirmed by agarose gel electrophoresis with PCR products amplified using IlAP2-ORF primers and cDNA from WT and transgenic A. thaliana. Total RNA from WT and transgenic A. thaliana under Cd stress was extracted using Plant RNeasy Mini Kit (Vazyme), and cDNA was generated using PrimeScript® RT kit (Takara). Three-day-old WT and transgenic A. thaliana seedlings were selected and transplanted to 1/2 MS medium containing 50 μM CdCl2. The root length and fresh weight of seedlings were measured after 7 days of growth.

4.6. RNA-seq and Analysis

Twenty-day-old transgenic and WT A. thaliana seedlings were treated with 50 μM CdCl2 for 24 h and sampled for RNA extraction [50]. RNA-seq libraries were created following the manufacturer’s instructions for the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, Ipswich, MA, USA). The cDNA fragments, ranging in length from 250 to 300 bp, were screened using AMPure XP system (Beckman Coulter, Beverly, CA, USA). Illumina Hiseq 2000 (Illumina, San Diego, CA, USA) was utilized for library sequencing and paired-end read production.
Genes were assembled using the full-length transcript sequence as a reference [51]. The FPKM value obtained from read counts was converted to a TPM value to obtain the expression level of each isoform. Based on analysis using differential expression analysis software DESeq2, genes with padj < 0.05 and |log2foldchange| > 1 were identified as differentially expressed genes (DEGs). GO enrichment analysis was performed on DEGs using Wallenius’ noncentral hypergeometric distribution of the GOseq R package. The KEGG enrichment analysis was performed using KOBAS software.

5. Conclusions

In conclusion, the AP2/ERF superfamily gene IlAP2, confirmed to interact with IlMT2a in this study, was analyzed using quantitative real-time PCR, transgenics and transcriptome sequencing to understand its regulation function and mechanism in improving plant tolerance to cadmium stress. The results showed that IlAP2 could interact with IlMT2a in the nucleus and may cooperate with other transcription factors to regulate genes related to signal transduction and plant hormones, leading to reduced cadmium toxicity. These findings provide insights into the mechanism of IlAP2-mediated stress responses to cadmium and highlight IlAP2 as an important gene resource for improving plant stress tolerance in phytoremediation to manage cadmium soil contamination.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants12040823/s1, Figure S1: Relative changes in expression of genes analyzed using qRT-PCR; Table S1: 1/2 Hoagland’s solution composition.

Author Contributions

Conceptualization, Z.W. and C.G.; formal analysis, L.N. and Z.W.; investigation, Z.W., L.N., L.L. and H.Y.; writing—original draft preparation, Z.W. and L.N.; writing—review and editing, Z.W. and C.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31772351) and the 333 Talents Project of Jiangsu Province (BRA2017498).

Data Availability Statement

No new data were created or analyzed in this study. Data sharing is not applicable to this article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gill, S.S.; Tuteja, N. Cadmium stress tolerance in crop plants: Probing the role of sulfur. Plant Signal. Behav. 2011, 6, 215–222. [Google Scholar] [CrossRef] [PubMed]
  2. Chen, H.; Li, Y.; Ma, X.; Guo, L.; He, Y.; Ren, Z.; Kuang, Z.; Zhang, X.; Zhang, Z. Analysis of potential strategies for cadmium stress tolerance revealed by transcriptome analysis of upland cotton. Sci. Rep. 2019, 9, 86. [Google Scholar] [CrossRef]
  3. Wang, Z.; Ni, L.; Liu, L.; Yuan, H.; Huang, S.; Gu, C. Screening and identification of host proteins interacting with Iris lactea var. Chinensis metallothionein IlMT2a by yeast two-hybrid assay. Genes 2021, 12, 554. [Google Scholar]
  4. Verbruggen, N.; Hermans, C.; Schat, H. Mechanisms to cope with arsenic or cadmium excess in plants. Curr. Opin. Plant Biol. 2009, 12, 364–372. [Google Scholar] [CrossRef]
  5. Nawrot, T.; Plusquin, M.; Hogervorst, J.; Roels, H.A.; Celis, H.; Thijs, L.; Vangronsveld, J.; Van Hecke, E.; Staessen, J.A. Environmental exposure to cadmium and risk of cancer: A prospective population-based study. Lancet Oncol. 2006, 7, 119–126. [Google Scholar] [CrossRef] [PubMed]
  6. Kanamarlapudi, S.; Chintalpudi, V.K.; Muddada, S. Application of biosorption for removal of heavy metals from wastewater. Biosorption 2018, 18, 70–116. [Google Scholar]
  7. Monteiro, C.M.; Castro, P.; Malcata, F.X. Metal uptake by microalgae: Underlying mechanisms and practical applications. Biotechnol. Prog. 2012, 28, 299–311. [Google Scholar] [CrossRef]
  8. Gallego, S.; Pena, L.; Barcia, R.; Azpilicueta, C.; Iannone, M.; Rosales, E.; Benavides, M. Unravelling cadmium toxicity and tolerance in plants: Insight into regulatory mechanisms. Environ. Exp. Bot. 2012, 83, 33–46. [Google Scholar] [CrossRef]
  9. Haider, F.; Liqun, C.; Coulter, J.; Cheema, S.; Wu, J.; Zhang, R.; Wenjun, M.; Farooq, M. Cadmium toxicity in plants: Impacts and remediation strategies. Ecotoxicol. Environ. Saf. 2021, 211, 111887. [Google Scholar] [PubMed]
  10. Abbas, T.; Rizwan, M.; Ali, S.; Adrees, M.; Zia-ur-Rehman, M.; Qayyum, M.F.; Ok, Y.S.; Murtaza, G. Effect of biochar on alleviation of cadmium toxicity in wheat (Triticum aestivum L.) grown on Cd-contaminated saline soil. Environ. Sci. Pollut. Res. 2018, 25, 25668–25680. [Google Scholar] [CrossRef]
  11. Liu, S.; Li, L.; Deng, Y.; Bai, Y.; Sun, C.; Huang, S.; Zhou, J.; Shi, L.; Yang, X.; Li, L. BRPNAC895 and BRPABI449 coregulate the transcription of the afflux-type cadmium transporter BRPHMA2 in Brassica parachinensis. Hortic. Res. 2022, 9, uhac044. [Google Scholar] [CrossRef]
  12. Tong, Y.-P.; Kneer, R.; Zhu, Y.-G. Vacuolar compartmentalization: A second-generation approach to engineering plants for phytoremediation. Trends Plant Sci. 2004, 9, 7–9. [Google Scholar] [CrossRef] [PubMed]
  13. Chen, G.; Liu, Y.; Wang, R.; Zhang, J.; Owens, G. Cadmium adsorption by willow root: The role of cell walls and their subfractions. Environ. Sci. Pollut. Res. 2013, 20, 5665–5672. [Google Scholar] [CrossRef]
  14. Deng, D.; Shu, W.; Zhang, J.; Zou, H.; Lin, Z.; Ye, Z.; Wong, M.H. Zinc and cadmium accumulation and tolerance in populations of sedum alfredii. Environ. Pollut. 2007, 147, 381–386. [Google Scholar] [CrossRef] [PubMed]
  15. Weiti, C.; Huiping, C.; Kaikai, Z.; Qijiang, J.; Yanjie, X.; Jin, C.; Yan, X.; Jing, Z.; Wenbiao, S.; Ji-Hong, L. Cadmium-induced hydrogen sulfide synthesis is involved in cadmium tolerance in medicago sativa by reestablishment of reduced (homo)glutathione and reactive oxygen species homeostases. PLoS ONE 2014, 9, e109669. [Google Scholar]
  16. Talukder, M.; Bi, S.; Jin, H.T.; Ge, J.; Zhang, C.; Lv, M.; Li, J. Cadmium induced cerebral toxicity via modulating MTF1-MTs regulatory axis. Environ. Pollut. 2021, 285, 117083. [Google Scholar] [CrossRef] [PubMed]
  17. Saydam, N.; Georgiev, O.; Nakano, M.; Greber, U.; Schaffner, W. Nucleo-cytoplasmic trafficking of metal-regulatory transcription factor 1 is regulated by diverse stress signals. J. Biol. Chem. 2001, 276, 25487–25495. [Google Scholar] [CrossRef]
  18. Tang, J.; Liu, Q.; Yuan, H.; Zhang, Y.; Huang, S. Molecular analysis of a novel alkaline metal salt (nacl)-responsive WRKY transcription factor gene IlWRKY1 from the halophyte Iris lactea var. Chinensis. Int. Biodeterior. Biodegrad. 2018, 127, 139–145. [Google Scholar] [CrossRef]
  19. Han, Y.-L.; Huang, S.-Z.; Gu, J.-G.; Qiu, S.; Chen, J.-M. Tolerance and accumulation of lead by species of Iris L. Ecotoxicology 2008, 17, 853–859. [Google Scholar] [CrossRef]
  20. Gu, C.; Xu, S.; Wang, Z.; Liu, L.; Zhang, Y.; Deng, Y.; Huang, S. De novo sequencing, assembly, and analysis of Iris lactea var. Chinensis roots’ transcriptome in response to salt stress. Plant Physiol. Biochem. 2018, 125, 1–12. [Google Scholar]
  21. Gu, C.-S.; Liu, L.-Q.; Deng, Y.-M.; Zhang, Y.-X.; Wang, Z.-Q.; Yuan, H.-Y.; Huang, S.-Z. De novo characterization of the Iris lactea var. Chinensis transcriptome and an analysis of genes under cadmium or lead exposure. Ecotoxicol. Environ. Saf. 2017, 144, 507–513. [Google Scholar]
  22. Gu, C.-S.; Liu, L.-q.; Zhao, Y.-H.; Deng, Y.-m.; Zhu, X.-d.; Huang, S.-Z. Overexpression of Iris. Lactea var. Chinensis metallothionein IlMT2a enhances cadmium tolerance in Arabidopsis thaliana. Ecotoxicol. Environ. Saf. 2014, 105, 22–28. [Google Scholar] [PubMed]
  23. Chen, P.; Li, Z.; Luo, D.; Jia, R.; Lu, H.; Tang, M.; Hu, Y.; Yue, J.; Huang, Z. Comparative transcriptomic analysis reveals key genes and pathways in two different cadmium tolerance kenaf (Hibiscus cannabinus L.) cultivars. Chemosphere 2021, 263, 128211. [Google Scholar] [CrossRef]
  24. DalCorso, G.; Farinati, S.; Furini, A. Regulatory networks of cadmium stress in plants. Plant Signal. Behav. 2010, 5, 663–667. [Google Scholar] [CrossRef] [PubMed]
  25. Chen, J.; Yang, L.; Yan, X.; Liu, Y.; Wang, R.; Fan, T.; Ren, Y.; Tang, X.; Xiao, F.; Liu, Y. Zinc-finger transcription factor ZAT6 positively regulates cadmium tolerance through the glutathione-dependent pathway in Arabidopsis. Plant Physiol. 2016, 171, 707–719. [Google Scholar] [CrossRef] [PubMed]
  26. Weber, M.; Trampczynska, A.; Clemens, S. Comparative transcriptome analysis of toxic metal responses in Arabidopsis thaliana and the cd2+-hypertolerant facultative metallophyte Arabidopsis halleri. Plant Cell Environ. 2006, 29, 950–963. [Google Scholar] [CrossRef]
  27. He, F.; Liu, Q.; Zheng, L.; Cui, Y.; Shen, Z.; Zheng, L. RNA-seq analysis of rice roots reveals the involvement of post-transcriptional regulation in response to cadmium stress. Front. Plant Sci. 2015, 6, 1136. [Google Scholar] [CrossRef]
  28. Ogawa, I.; Nakanishi, H.; Mori, S.; Nishizawa, N.K. Time course analysis of gene regulation under cadmium stress in rice. Plant Soil 2009, 325, 97–108. [Google Scholar] [CrossRef]
  29. Feng, K.; Hou, X.; Xing, G.; Liu, J.; Duan, A.; Xu, Z.; Li, M.; Zhuang, J.; Xiong, A. Advances in AP2/ERF super-family transcription factors in plant. Crit. Rev. Biotechnol. 2020, 40, 750–776. [Google Scholar] [CrossRef]
  30. Sun, F.; Ding, L.; Feng, W.; Cao, Y.; Lu, F.; Yang, Q.; Li, W.; Li, Y.; Shabek, N.; Fu, F.; et al. Maize transcription factor ZmBES1/BZR1-5 positively regulates kernel size. J. Exp. Bot. 2021, 72, 1714–1726. [Google Scholar] [CrossRef] [PubMed]
  31. Tian, W.; Huang, Y.; Li, D.; Meng, L.; He, T.; He, G. Identification of STAP2/ERF genes of potato (Solanum tuberosum) and their multiple functions in detoxification and accumulation of cadmium in yest: Implication for genetic-based phytoremediation. Sci. Total Environ. 2022, 810, 152322. [Google Scholar] [CrossRef] [PubMed]
  32. Zhu, H.; Zhou, Y.; Zhai, H.; He, S.; Zhao, N.; Liu, Q. A novel sweetpotato WRKY transcription factor, IbWRKY2, positively regulates drought and salt tolerance in transgenic Arabidopsis. Biomolecules 2020, 10, 506. [Google Scholar] [CrossRef]
  33. Buchet, J.; Lauwerys, R.; Roels, H.; Bernard, A.; Bruaux, P.; Claeys, F.; Ducoffre, G.; Plaen, P.; Staessen, J.; Amery, A.; et al. Renal effects of cadmium body burden of the general population. Lancet 1990, 336, 699–702. [Google Scholar] [CrossRef] [PubMed]
  34. Farinati, S.; DalCorso, G.; Varotto, S.; Furini, A. The Brassica juncea BjCdR15, an ortholog of Arabidopsis TGA3, is a regulator of cadmium uptake, transport and accumulation in shoots and confers cadmium tolerance in transgenic plants. New Phytol. 2010, 185, 964–978. [Google Scholar] [CrossRef]
  35. Lin, Y.F.; Aarts, M.G.M. The molecular mechanism of zinc and cadmium stress response in plants. Cell. Mol. Life Sci. 2012, 69, 3187–3206. [Google Scholar]
  36. Narendrula-Kotha, R.; Theriault, G.; Mehes-Smith, M.; Kalubi, K.; Nkongolo, K. Metal toxicity and resistance in plants and microorganisms in terrestrial ecosystems. Rev. Environ. Contam. Toxicol. 2019, 249, 1–27. [Google Scholar]
  37. Lv, Y.; Deng, X.; Quan, L.; Xia, Y.; Shen, Z. Metallothioneins BcMT1 and BcMT2 from Brassica campestris enhance tolerance to cadmium and copper and decrease production of reactive oxygen species in Arabidopsis thaliana. Plant Soil 2013, 367, 507–519. [Google Scholar] [CrossRef]
  38. Nakano, T.; Suzuki, K.; Fujimura, T.; Shinshi, H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol. 2006, 140, 411–432. [Google Scholar] [CrossRef] [PubMed]
  39. Sharoni, A.M.; Nuruzzaman, M.; Satoh, K.; Shimizu, T.; Kondoh, H.; Sasaya, T.; Choi, I.-R.; Omura, T.; Kikuchi, S. Gene structures, classification and expression models of the AP2/EREBP transcription factor family in rice. Plant Cell Physiol. 2011, 52, 344–360. [Google Scholar] [CrossRef] [PubMed]
  40. Jisha, V.; Dampanaboina, L.; Vadassery, J.; Mithöfer, A.; Kappara, S.; Ramanan, R. Overexpression of an AP2/ERF type transcription factor oserebp1 confers biotic and abiotic stress tolerance in rice. PLoS ONE 2015, 10, e0127831. [Google Scholar] [CrossRef]
  41. Zhu, Q.; Zhang, J.; Gao, X.; Tong, J.; Xiao, L.; Li, W.; Zhang, H. The Arabidopsis AP2/ERF transcription factor RAP2. 6 participates in ABA, salt and osmotic stress responses. Gene 2010, 457, 1–12. [Google Scholar] [CrossRef] [PubMed]
  42. Djemal, R.; Khoudi, H. The ethylene-responsive transcription factor of durum wheat, TDSHN1, confers cadmium, copper, and zinc tolerance to yeast and transgenic tobacco plants. Protoplasma 2022, 259, 19–31. [Google Scholar] [CrossRef] [PubMed]
  43. Liu, Q.; Zhang, Y.; Wang, Y.; Wang, W.; Gu, C.; Huang, S.; Yuan, H.; Dhankher, O.P. Quantitative proteomic analysis reveals complex regulatory and metabolic response of Iris lactea pall. Var. Chinensis to cadmium toxicity. J. Hazard. Mater. 2020, 400, 123165. [Google Scholar] [CrossRef]
  44. Bossche, R.V.; Demedts, B.; Vanderhaeghen, R.; Goossens, A. Transient expression assays in tobacco protoplasts. In Jasmonate Signaling; Springer: Totowa, NJ, USA, 2013; pp. 227–239. [Google Scholar]
  45. Yoo, S.D.; Cho, Y.H.; Sheen, J. Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat. Protoc. 2007, 2, 1565–1572. [Google Scholar] [CrossRef]
  46. Wei, F.; Tang, D.; Li, Z.; Kashif, M.H.; Khan, A.; Lu, H.; Jia, R.; Chen, P. Molecular cloning and subcellular localization of six HDACs and their roles in response to salt and drought stress in kenaf (Hibiscus cannabinus L.). Biol. Res. 2019, 52, 20. [Google Scholar] [CrossRef] [PubMed]
  47. Chen, W.C.; Wang, Q.; Cao, T.J.; Lu, S. UBC19 is a new interacting protein of ORANGE for its nuclear localization in Arabidopsis thaliana. Plant Signal. Behav. 2021, 16, 1964847. [Google Scholar] [CrossRef]
  48. Fang, Z.; Ji, Y.; Hu, J.; Guo, R.; Sun, S.; Wang, X. Strigolactones and brassinosteroids antagonistically regulate the stability of D53-OsBZR1 complex to determine FC1 expression in rice tillering. Mol. Plant 2020, 13, 586–597. [Google Scholar] [CrossRef]
  49. Kong, L.; Duan, Y.; Ye, Y.; Cai, Z.; Wang, F.; Qu, X.; Qiu, R.; Wu, C.; Wu, W. Screening and analysis of proteinsinteracting with OsMADS16 in rice (Oryza sativa L.). PLoS ONE 2019, 14, e0221473. [Google Scholar] [CrossRef]
  50. Ni, L.; Wang, Z.; Liu, X.; Wu, S.T.; Hua, J.; Liu, L.; Yin, Y.; Li, H.; Gu, C. Genome-wide study of the GRAS gene family in Hibiscus hamabo Sieb. et Zucc and analysis of HhGRAS14-induced drought and salt stress tolerance in Arabidopsis. Plant Sci. 2022, 319, 111260. [Google Scholar] [CrossRef]
  51. Ni, L.; Wang, Z.; Guo, J.; Pei, X.; Liu, L.; Li, H.; Yuan, H.; Gu, C. Full-length transcriptome sequencing and comparative transcriptome analysis to evaluate drought and salt stress in Iris lactea var. Chinensis. Genes 2021, 12, 434. [Google Scholar] [CrossRef]
Plants 12 00823 g001 550
Figure 1. Analysis of the AP2 sequence: (a) alignment result of IlAP2 amino acid sequence (the red boxes represent functional domains, ’*’ indicates positions which have a single, fully conserved residue); and (b) phylogenetic tree of AP2 proteins from I. lactea (IlAP2) and other species.
Figure 1. Analysis of the AP2 sequence: (a) alignment result of IlAP2 amino acid sequence (the red boxes represent functional domains, ’*’ indicates positions which have a single, fully conserved residue); and (b) phylogenetic tree of AP2 proteins from I. lactea (IlAP2) and other species.
Plants 12 00823 g001
Plants 12 00823 g002 550
Figure 2. Subcellular localization of IlAP2 in A. thaliana leaf cells, with GFP as control. Green fluorescence protein (GFP), chlorophyll autofluorescence (Auto) and merged images (Merged 1 and Bright Merged 2) are shown. Scale bar: 10 μm.
Figure 2. Subcellular localization of IlAP2 in A. thaliana leaf cells, with GFP as control. Green fluorescence protein (GFP), chlorophyll autofluorescence (Auto) and merged images (Merged 1 and Bright Merged 2) are shown. Scale bar: 10 μm.
Plants 12 00823 g002
Plants 12 00823 g003 550
Figure 3. Interaction between IlAP2 and IlMT2a: (a) yeast two-hybrid analysis of IlAP2 and IlMT2a, with BD-53 + AD-T as positive control and BD-Lam + AD-T as negative control; and (b) BiFC analysis of IlAP2 and IlMT2a, with BRZ1-nTFP + HLH40-cYFP as positive control and 35S::nYFP + 35S::cYFP as negative control. Ruler: 20 μm.
Figure 3. Interaction between IlAP2 and IlMT2a: (a) yeast two-hybrid analysis of IlAP2 and IlMT2a, with BD-53 + AD-T as positive control and BD-Lam + AD-T as negative control; and (b) BiFC analysis of IlAP2 and IlMT2a, with BRZ1-nTFP + HLH40-cYFP as positive control and 35S::nYFP + 35S::cYFP as negative control. Ruler: 20 μm.
Plants 12 00823 g003
Plants 12 00823 g004 550
Figure 4. Analysis of IlAP2 expression pattern in I. lactea roots at different times of Cd stress: (a) semi-quantitative PCR and (b) RT-qPCR. ‘**’ shows the significance level of p < 0.01.
Figure 4. Analysis of IlAP2 expression pattern in I. lactea roots at different times of Cd stress: (a) semi-quantitative PCR and (b) RT-qPCR. ‘**’ shows the significance level of p < 0.01.
Plants 12 00823 g004
Plants 12 00823 g005 550
Figure 5. Functional verification analysis of I1AP2 in A. thaliana. (a) Root length of wild-type (WT) and transgenic A. thaliana under CdCl2 stress. (b) Root length statistics of WT and transgenic A. thaliana under CdCl2 stress. (c) Comparison of growth of WT and transgenic A. thaliana under CdCl2 stress. (d) Fresh weight of WT and transgenic A. thaliana under CdCl2 stress. (e) Agarose gel electrophoresis profile for the expression of I1AP2 in WT and transgenic A. thaliana (OE2, OE4 and OE5). The + band was amplified with I. lactea cDNA and ORF primers of I1AP2, serving as positive control. ‘**’ shows the significance level of p < 0.01.
Figure 5. Functional verification analysis of I1AP2 in A. thaliana. (a) Root length of wild-type (WT) and transgenic A. thaliana under CdCl2 stress. (b) Root length statistics of WT and transgenic A. thaliana under CdCl2 stress. (c) Comparison of growth of WT and transgenic A. thaliana under CdCl2 stress. (d) Fresh weight of WT and transgenic A. thaliana under CdCl2 stress. (e) Agarose gel electrophoresis profile for the expression of I1AP2 in WT and transgenic A. thaliana (OE2, OE4 and OE5). The + band was amplified with I. lactea cDNA and ORF primers of I1AP2, serving as positive control. ‘**’ shows the significance level of p < 0.01.
Plants 12 00823 g005
Plants 12 00823 g006 550
Figure 6. RNA-seq analysis of WT and transgenic A. thaliana. (a) DEG analysis results, (b) GO enrichment results, (c) KEGG enrichment results and (d) gene families possibly affected by IlAP2.
Figure 6. RNA-seq analysis of WT and transgenic A. thaliana. (a) DEG analysis results, (b) GO enrichment results, (c) KEGG enrichment results and (d) gene families possibly affected by IlAP2.
Plants 12 00823 g006
Table
Table 1. Primer sequences of the genes for full-length open reading frames (ORFs) and semi-quantitative PCR and quantitative real-time PCR.
Table 1. Primer sequences of the genes for full-length open reading frames (ORFs) and semi-quantitative PCR and quantitative real-time PCR.
PrimerForward PCR PrimerReverse PCR Primer
IlAP2-ORFATGTCGTTCGACCTGAACTTCTCAGCTCCTGGAGTGGTAATG
IlAP2-qRT-PCR
(semi-quantitative PCR)		GAATTTGAGGATTTCTCAACCTACTTGATGATGCTCAGGAAC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Z.; Ni, L.; Liu, L.; Yuan, H.; Gu, C. IlAP2, an AP2/ERF Superfamily Gene, Mediates Cadmium Tolerance by Interacting with IlMT2a in Iris lactea var. chinensis. Plants 2023, 12, 823. https://doi.org/10.3390/plants12040823

AMA Style

Wang Z, Ni L, Liu L, Yuan H, Gu C. IlAP2, an AP2/ERF Superfamily Gene, Mediates Cadmium Tolerance by Interacting with IlMT2a in Iris lactea var. chinensis. Plants. 2023; 12(4):823. https://doi.org/10.3390/plants12040823

Chicago/Turabian Style

Wang, Zhiquan, Longjie Ni, Liangqin Liu, Haiyan Yuan, and Chunsun Gu. 2023. "IlAP2, an AP2/ERF Superfamily Gene, Mediates Cadmium Tolerance by Interacting with IlMT2a in Iris lactea var. chinensis" Plants 12, no. 4: 823. https://doi.org/10.3390/plants12040823

APA Style

Wang, Z., Ni, L., Liu, L., Yuan, H., & Gu, C. (2023). IlAP2, an AP2/ERF Superfamily Gene, Mediates Cadmium Tolerance by Interacting with IlMT2a in Iris lactea var. chinensis. Plants, 12(4), 823. https://doi.org/10.3390/plants12040823

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop