Identification of Drought-Resistant Response in Proso Millet (Panicum miliaceum L.) Root through Physiological and Transcriptomic Analysis
Abstract
:1. Introduction
2. Results
2.1. Physiological Differences in Response to Drought Stress and Re-Watering in Proso Millet
2.2. Transcriptome Reprogramming in Proso Millet Root Triggered by Drought Stress and Re-Watering
2.3. Functional and Pathway Annotation of Genes
2.4. DEGs under Drought and Re-Watering Conditions
2.5. GO Enrichment Analysis of DEGs
2.6. Metabolic Pathway Analysis via KEGG
2.7. Drought Stress and Rehydration-Responsive Transcriptional Factors
2.8. Weighted Gene Co-Expression Network Analysis
2.9. Validation of RNA-Seq Data Using qRT-PCR
3. Discussion
3.1. Response of Physiological Traits to Drought and Rehydration Conditions
3.2. DEGs Reflect Drought and Rehydration Conditions
3.3. Metabolic Pathway Response to Drought and Rehydration Conditions
3.4. TFs Regulate Drought Stress
4. Materials and Methods
4.1. Plant Material and Drought–Rehydration Treatment
4.2. Measurements of Root Physiological Index
4.3. RNA Extraction and Transcriptome Sequencing
4.4. Gene Functional Annotation
4.5. Evolutionary Genealogy of Genes
4.6. Differentially Expressed Genes Analysis
4.7. Transcription Factor Analysis of DEGs
4.8. Weighted Gene Co-Expression Network Analysis
4.9. Quantitative RT-PCR Analysis
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Boyer, J.S. Plant Productivity and Environment. Science 1982, 218, 443–448. [Google Scholar] [CrossRef]
- Zhao, Y.; Yang, X.; Zhang, J.; Huang, L.; Shi, Z.; Tian, Z.; Sha, A.; Lu, G. Thaumatin-like protein family genes VfTLP4-3 and VfTLP5 are critical for faba bean’s response to drought stress at the seedling stage. Plant Physiol. Biochem. 2024, 206, 108243. [Google Scholar] [CrossRef]
- Liu, S.; Wang, H.; Qin, F. Genetic dissection of drought resistance for trait improvement in crops. Acta Agron. Sin. 2023, 11, 975–985. [Google Scholar] [CrossRef]
- Narciso, J.O.; NystrÖm, L. The genetic diversity and nutritional quality of proso millet (Panicum miliaceum) and its Philippine ecotype, the ancient grain “kabog millet”: A review. J. Agric. Food Res. 2023, 11, 100499. [Google Scholar] [CrossRef]
- Zou, C.S.; Li, L.T.; Miki, D.; Li, D.L.; Tang, Q.M.; Xiao, L.H.; Rajput, S.; Deng, P.; Peng, L.; Jia, W.; et al. The genome of broomcorn millet. Nat. Commun. 2019, 10, 436. [Google Scholar] [CrossRef]
- Rajput, S.G.; Santra, D.K.; Schnable, J. Mapping QTLs for morpho-agronomic traits in proso millet (Panicum miliaceum L.). Mol. Breed. 2016, 36, 4. [Google Scholar] [CrossRef]
- Wen, Y.; Liu, J.; Meng, X.Y.; Zhang, D.X.; Zhao, G.H. Characterization of proso millet starches from different geographical origins of China. Food Sci. Biotechnol. 2014, 23, 1371–1377. [Google Scholar] [CrossRef]
- Sarker, A. Effect of Pre-Processing on the Nutritive, Physical, and Sensory Properties of Proso Millet. Master’s Thesis, The University of Guelph, Guelph, ON, Canada, 2015. [Google Scholar]
- Rajpu, S.G.; Plyler-Harveson, T.; Santra, D.K. Development and characterization of SSR markers in proso millet based on switchgrass genomics. Am. J. Plant Sci. 2014, 5, 175–186. [Google Scholar] [CrossRef]
- Yuan, Y.H.; Liu, L.; Gao, Y.B.; Yang, Q.H.; Dong, K.J.; Liu, T.B.; Feng, B.L. Comparative analysis of drought-responsive physiological and transcriptome in broomcorn millet (Panicum miliaceum L.) genotypes with contrasting drought tolerance. Ind. Crops Prod. 2022, 177, 114498. [Google Scholar] [CrossRef]
- Zheng, J.; Fu, J.J.; Gou, M.Y.; Huai, J.L.; Liu, Y.J.; Jian, M.; Huang, Q.S.; Guo, X.Y.; Dong, Z.G.; Wang, H.Z.; et al. Genome-wide transcriptome analysis of two maize inbred lines under drought stress. Plant Mol. Biol. 2010, 72, 407–421. [Google Scholar] [CrossRef]
- Zhang, P.Y.; Wang, G.R.; Cao, L.R.; Yuan, Z.; Ku, L.X.; Wang, T.C.; Wei, L. Analysis of differentially expressed transcription factor genes in maize (Zea mays) under drought stress and rewatering. J. Agric. Biotechnol. 2020, 28, 211–222. [Google Scholar]
- Zhang, Y.; Gao, X.; Li, J.; Gong, X.; Yang, P.; Gao, J.; Wang, P.; Feng, B. Comparative analysis of proso millet (Panicum miliaceum L.) leaf transcriptomes for insight into drought tolerance mechanisms. BMC Plant Biol. 2019, 19, 397. [Google Scholar] [CrossRef]
- Yue, H.; Deng, P.C.; Liu, S.Y.; Wang, M.; Song, W.N.; Nie, X.J. Selection and evaluation of reference genes for quantitative gene expression analysis in broomcorn millet (Panicum miliaceum L.). J. Plant Biol. 2016, 59, 435–443. [Google Scholar] [CrossRef]
- Yue, H.; Wang, L.; Liu, H.; Yue, W.J.; Du, X.H.; Song, W.N.; Ni, X.J. De novo assembly and characterization of the transcriptome of broomcorn millet (Panicum miliaceum L.) for gene discovery and marker development. Front. Plant Sci. 2016, 7, 1083. [Google Scholar] [CrossRef]
- Tian, H.Y.; Jia, Y.B.; Niu, T.T.; Yu, Q.Q.; Ding, Z.J. The key players of the primary root growth and development also function in lateral roots in Arabidopsis. Plant Cell Rep. 2014, 33, 745–753. [Google Scholar] [CrossRef]
- Teng, Z.; Lyu, J.; Chen, Y.; Zhang, J.; Ye, N. Effects of stress-induced ABA on root architecture development: Positive and negative actions. Crop J. 2023, 11, 1072–1079. [Google Scholar] [CrossRef]
- Xu, W.; Cui, K.H.; Xu, A.H.; Nie, L.X.; Huang, J.L.; Peng, S.B. Drought stress condition increases root to shoot ratio via alteration of carbohydrate partitioning and enzymatic activity in rice seedlings. Acta Physiol. Plant 2015, 37, 9. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Li, S.; Li, P.Y.; Sun, Z.J.; Li, W. Transcriptome analysis-based bermudagrass root RNA sequencing data under drought stress. Acta Prataculturae Sin. 2024, 33, 186–198. [Google Scholar]
- Tiwari, B.S.; Belenghi, B. Levine A: Oxidative stress increased respiration and generation of reactive oxygen species, resulting in ATP depletion, opening of mitochondrial permeability transition, and programmed cell death. Plant Physiol. 2002, 128, 1271–1281. [Google Scholar] [CrossRef]
- Sreedhar, L.; Wolkers, W.F.; Hoekstra, F.A.; Bewley, J.D. In vivo characterization of the effects of abscisic acid and drying protocols associated with the acquisition of desiccation tolerance in alfalfa (Medicago sativa L.) somatic embryos. Ann. Bot. 2002, 89, 391–400. [Google Scholar] [CrossRef]
- Molina, C.; Rotter, B.; Horres, R.; Udupa, S.; Besser, B.; Bellarmino, L.; Baum, M.; Matsumura, H.; Terauchi, R.; Kahl, G.; et al. SuperSAGE: The drought stress-responsive transcriptome of chickpea roots. BMC Genom. 2008, 9, 553. [Google Scholar] [CrossRef]
- Munns, R.; Gilliham, M. Salinity tolerance of crops-what is the cost? New Phytol. 2015, 208, 668–673. [Google Scholar] [CrossRef]
- Yuan, Y.H.; Liu, C.J.; Gao, Y.B.; Ma, Q.; Yang, Q.H.; Feng, B.L. Proso millet (Panicum miliaceum L.): A potential crop to meet demand scenario for sustainable saline agriculture. J. Environ. Manag. 2021, 296, 113216. [Google Scholar] [CrossRef]
- Shi, H.T.; Li, R.J.; Cai, W.; Liu, W.; Wang, C.L.; Lu, Y.T. Increasing nitric oxide content in Arabidopsis thaliana by expressing rat neuronal nitric oxide synthase resulted in enhanced stress tolerance. Plant Cell Physiol. 2012, 53, 344–357. [Google Scholar] [CrossRef]
- Kumar, S.; Ayachit, G.; Sahoo, L. Screening of mungbean for drought tolerance and transcriptome profiling between drought-tolerant and susceptible genotype in response to drought stress. Plant Physiol. Biochem. 2020, 157, 229–238. [Google Scholar] [CrossRef]
- Zhu, X.D.; Li, X.P.; Jiu, S.T.; Zhang, K.K.; Wang, C.; Fang, J.G. Analysis of the regulation networks in grapevine reveals response to waterlogging stress and candidate gene-marker selection for damage severity. Royal Soci. Open Sci. 2018, 5, 172253. [Google Scholar] [CrossRef]
- Hou, Z.H.; Yin, J.L.; Lu, Y.F.; Song, J.H.; Wang, S.P.; Wei, S.D.; Liu, Z.X.; Zhang, Y.X.; Fang, Z.W. Transcriptomic analysis reveals the temporal and spatial changes in physiological process and gene expression in common buckwheat (Fagopyrum esculentum Moench) grown under drought stress. Agronomy 2019, 9, 17–26. [Google Scholar] [CrossRef]
- Shao, A.; Wang, W.; Fan, S.G.; Xu, X.; Yin, Y.L.; Erick, A.; Li, X.N.; Wang, G.Y.; Wang, H.L.; Fu, J.M. Comprehensive transcriptional analysis reveals salt stress-regulated key pathways, hub genes and time-specific responsive gene categories in common bermudagrass (Cynodon dactylon (L.) Pers.) roots. BMC Plant Biol. 2021, 21, 18–26. [Google Scholar] [CrossRef]
- Zhou, J.; Chen, S.Q.; Shi, W.J.; David, S.R.; Li, S.T.; Yang, F.L.; Lin, Z.X. Transcriptome profiling reveals the effects of drought tolerance in Giant Juncao. BMC Plant Biol. 2021, 21, 2. [Google Scholar] [CrossRef]
- He, L. Relationship between 2C Serine/Threonine Protein Phosphatase Activity and Drought Tolerance in Maize; Sichuan Agricultural University: Chengdu, China, 2008. [Google Scholar]
- Meskiene, I.; Baudouin, E.; Schweighofer, A.; Liwosz, A.; Jonak, C.; Rodriguez, P.L.; Jelinek, H.; Hirt, H. Stress-induced protein phosphatase 2C is a negative regulator of a mitogen-activated protein kinase. J. Biol. Chem. 2003, 278, 18945–18952. [Google Scholar] [CrossRef]
- Zhang, J.J.; Li, J.J.; Nian, H.J. The role of calcium/calmodulin signaling pathways in the stresses:Progress in researches. Chin. J. Microecol. 2013, 25, 858–860. [Google Scholar]
- Zeng, B.; Shang, P.P.; Shen, B.N.; Wang, M.H.; Qu, M.H.; Yuan, Y.; Bi, L.; Yang, X.Y.; Li, W.W.; Zhou, X.L.; et al. Differentially expressed genes and related pathways in root systems of Dactylis glomerata under looding stress. Acta Prataculturae Sin. 2024, 33, 93–111. [Google Scholar]
- Wang, L.; Li, D.; Zhang, Y.; Gao, Y.; Yu, J.; Wei, X.; Zhang, X. Tolerant and susceptible sesame genotypes reveal waterlogging stress response patterns. PLoS ONE 2016, 11, e0149912. [Google Scholar] [CrossRef]
- Zhao, Q.; Dixon, R.A. Transcriptional networks for lignin biosynthesis: More complex than we thought? Trends Plant Sci. 2011, 16, 227–233. [Google Scholar] [CrossRef]
- Dong, N.Q.; Lin, H.X. Contribution of phenylpropanoid metabolism to plant development and plant–environment interactions. J. Integr. Plant Biol. 2021, 63, 180–209. [Google Scholar] [CrossRef]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu. Rev. Plant Biol. 2006, 57, 781–803. [Google Scholar] [CrossRef]
- Gonçalves, L.P.; Boscariol Camargo, R.L.; Takita, M.A.; Machado, M.A.; dos Soares Filho, W.S.; Costa, M.G.C. Rootstock-induced molecular responses associated with drought tolerance in sweet orange as revealed by RNA-Seq. BMC Genom. 2019, 20, 110. [Google Scholar] [CrossRef]
- Chen, W.; Yao, Q.M.; Li, S.; Agarwal, G.; Wang, B.; Li, L.; Wang, B.; Wang, Y.Q.; Prince, S.J.; Song, L.; et al. Identification and comparative analysis of differential gene expression in soybean leaf tissue under drought and flooding stress revealed by RNA-Seq. Front. Plant Sci. 2016, 7, 1044. [Google Scholar] [CrossRef]
- Liu, J.H.; Peng, T.; Dai, W. Critical cis-acting elements and interacting transcription factors:key players associated with abiotic stress responses in plants. Plant Mol. Biol. Rep. 2014, 32, 303–317. [Google Scholar] [CrossRef]
- Chandler, J.W. Class VIIIb APETALA2 ethylene response factors in plant development. Trends Plant Sci. 2018, 23, 151–162. [Google Scholar] [CrossRef]
- Owji, H.; Hajiebrahimi, A.; Seradj, H.; Hemmati, S. Identification and functional prediction of stress responsive AP2/ERF transcription factors in Brassica napus by genome-wide analysis. Comput. Biol. Chem. 2017, 71, 32–56. [Google Scholar] [CrossRef]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Improving plant drought, salt and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat. Biotechnol. 1999, 17, 287–291. [Google Scholar]
- Bold, O.; Jeevan, R.J.; Lim, Y.P.; Vanjildorj, E. Differatation of wheat WRKY transcription factor TAWRKY10 gene expression in abiotic stress resistance. Mong. J. Agric. Sci. 2015, 13, 136–140. [Google Scholar] [CrossRef]
- Yue, H.; Wang, M.; Liu, S.Y.; Du, X.H.; Song, W.N.; Nie, X.J. Transcriptome-wide identification and expression profiles of the WRKY transcription factor family in broomcorn millet (Panicum miliaceum L.). BMC Genom. 2016, 17, 343. [Google Scholar] [CrossRef]
- Xing, J.; Zhe, L.; Wu, W.F. POD, CAT and SOD enzyme activity of corn kernels as affected by low plasma pretreatment. Int. J. Food Prop. 2023, 26, 38–48. [Google Scholar]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Yuan, Y.X. The Production rate and malondialdehyde content of different tissue superoxide anions in wetland phrgmintes australis. Sci. Tech. Eng. 2019, 19, 40–43. [Google Scholar]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; Van Baren, M.J.; Salaberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
- Smyth, G.K.; Robinson, M.D.; McCarthy, D.J. edgeR: A bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef]
- Mao, X.Z.; Cai, T.; Olyarchuk, J.G.; Wei, L.P. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
- Sun, M.; Huang, D.J.; Zhang, A.L.; Khan, I.; Yan, H.D.; Wang, X.S.; Zhang, X.Q.; Zhang, J.; Huang, L.K. Transcriptome analysis of heat stress and drought stress in pearl millet based on Pacbio full-length transcriptome sequencing. BMC Plant Biol. 2020, 20, 323. [Google Scholar] [CrossRef]
- Dai, X.; Sinharoy, S.; Udvardi, M.; Zhao, P.X. PlantTFcat: An online plant transcription factor and transcriptional regulator categorization and analysis tool. BMC Bioinform. 2013, 14, 321. [Google Scholar] [CrossRef]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef]
- Niiler, T. Comparing groups of time dependent data using locally weighted scatterplot smoothing alpha-adjusted serial T-tests. Gait Posture 2020, 76, 58–63. [Google Scholar] [CrossRef]
Sample | Total Clean Reads (Mb) | Total Clean Bases (Gb) | Clean Reads (Q30, %) | GC Ratio (%) | Mapped Reads (Mb) | Uniq Mapped Reads (Mb) | Multiple Mapped Reads (Mb) | Reads Mapped to ‘+’ (Mb) | Reads Mapped to ‘−’ (Mb) |
---|---|---|---|---|---|---|---|---|---|
CK-1 | 44.53 | 6.65 | 93.62 | 54.16 | 40.88 (91.81%) | 35.53 (79.77%) | 5.36 (12.03%) | 29.24 (65.67%) | 29.28 (65.75%) |
CK-2 | 49.64 | 7.42 | 93.46 | 54.07 | 45.81 (92.28%) | 40.10 (80.79%) | 5.71(11.50%) | 32.26 (64.99%) | 32.30 (65.06%) |
CK-3 | 50.10 | 7.49 | 93.71 | 54.50 | 47.12 (94.07%) | 41.29 (82.43%) | 5.83 (11.64%) | 33.11 (66.10%) | 33.14 (66.16%) |
D1-1 | 56.70 | 8.46 | 92.86 | 54.93 | 51.81 (91.38%) | 44.94 (79.26%) | 6.87 (12.12%) | 37.13 (65.49%) | 37.19 (65.59%) |
D1-2 | 44.14 | 6.58 | 92.69 | 55.29 | 41.15 (93.22%) | 35.66 (80.78%) | 5.49(12.44%) | 29.60 (67.05%) | 29.65(67.16%) |
D1-3 | 54.94 | 8.21 | 93.22 | 55.47 | 51.39 (93.54%) | 44.79 (81.53%) | 6.60 (12.01%) | 36.43 (66.31%) | 36.48 (66.40%) |
D2-1 | 42.38 | 6.33 | 93.17 | 55.66 | 38.83 (91.63%) | 33.51 (79.07%) | 5.32 (12.55%) | 28.10 (66.31%) | 28.15 (66.42%) |
D2-2 | 46.59 | 6.96 | 93.04 | 55.40 | 41.21 (88.46%) | 35.97 (77.21%) | 5.24 (11.25%) | 29.07 (62.40%) | 29.11(62.48%) |
D2-3 | 49.17 | 7.34 | 93.34 | 55.60 | 45.00 (91.53%) | 38.84 (78.99%) | 6.16 (12.53%) | 32.50 (66.10%) | 32.54 (66.18%) |
D3-1 | 59.94 | 8.95 | 93.20 | 55.03 | 55.04 (91.82%) | 47.50 (79.24%) | 7.54 (12.58%) | 39.80(66.40%) | 39.87 (66.50%) |
D3-2 | 40.98 | 6.12 | 93.37 | 55.43 | 37.99 (92.71%) | 32.84 (80.13%) | 5.16 (12.58%) | 27.47 (67.04%) | 27.51 (67.15%) |
D3-3 | 48.60 | 7.26 | 93.30 | 55.12 | 43.63 (89.77%) | 37.81 (77.79%) | 5.83 (11.99%) | 31.24 (64.29%) | 31.29 (64.38%) |
D4-1 | 50.28 | 7.52 | 93.12 | 54.92 | 45.66 (90.82%) | 39.72(79.01%) | 5.94 (11.81%) | 32.51 (64.66%) | 32.56 (64.76%) |
D4-2 | 59.95 | 8.96 | 92.85 | 54.55 | 54.61 (91.08%) | 47.55 (79.32%) | 7.05 (11.76%) | 38.76 (64.65%) | 38.82(64.76%) |
D4-3 | 47.46 | 7.10 | 93.07 | 55.32 | 43.53 (91.73%) | 38.05 (80.18%) | 5.48 (11.55%) | 30.74 (64.77%) | 30.79 (64.87%) |
R1-1 | 43.50 | 6.51 | 92.34 | 54.30 | 38.88 (89.37%) | 35.90 (82.51%) | 2.98 (6.85%) | 23.76 (54.61%) | 23.79 (54.68%) |
R1-2 | 40.37 | 6.04 | 93.14 | 54.11 | 34.72 (86.00%) | 30.98 (76.74%) | 3.74 (9.26%) | 23.28 (57.67%) | 23.31 (57.74%) |
R1-3 | 43.96 | 6.57 | 92.60 | 53.32 | 34.78 (79.11%) | 31.34 (71.29%) | 3.43 (7.81%) | 22.78 (51.82%) | 22.81 (51.88%) |
Average | 48.51 | 7.25 | 93.12 | 54.84 |
Name | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Product Size (bp) |
---|---|---|---|
PM15G18540 | CAAGTCACCACCACCGCTTCTTC | GCTGCTCCCTATCTCTCCCTATCC | 113 |
PM04G13050 | AACGCCAACAAGACGGACAAGG | CAGCACCTCCATCAACGGCATC | 144 |
PM06G10520 | TCATCTCTCCCGACCCTCTTTCTTC | GCTGGTAGTGGTGGTGGTATTGC | 131 |
PM01G28660 | GAGCCAGAACTACGCCGAT | CATTCATCTCCGTCCACAGC | 326 |
PM01G29860 | CCTCACCTCACACCCATCTCTCC | CGGCTCGTCCATCACCATGTTG | 147 |
PM07G31660 | ACGACACCAACTCCATCATGTTCTC | GGGCATCTCCAACGACGACTTG | 131 |
PM01G47550 | AAAGGGATCGGATCGGGAGAGATG | GTTAGTAGCGGCGGCGTTAGC | 80 |
PM11G00920 | CTCTCGCCCACCAAGGATTAACG | TCTGAGCAACCAAGAATCTCGTGTG | 83 |
PM07G23530 | CAGTACACACGCACACCACCTC | CATGGCTGTCTGGTCTGGTTTGG | 128 |
18S | CGTCGCGTCCACCCTTTG | GATTTGAAGGTTCCAACTTTG | 195 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, P.; Wang, B.; Guo, Y.; Wang, T.; Wei, Q.; Luo, Y.; Li, H.; Wu, H.; Wang, X.; Zhang, X. Identification of Drought-Resistant Response in Proso Millet (Panicum miliaceum L.) Root through Physiological and Transcriptomic Analysis. Plants 2024, 13, 1693. https://doi.org/10.3390/plants13121693
Zhang P, Wang B, Guo Y, Wang T, Wei Q, Luo Y, Li H, Wu H, Wang X, Zhang X. Identification of Drought-Resistant Response in Proso Millet (Panicum miliaceum L.) Root through Physiological and Transcriptomic Analysis. Plants. 2024; 13(12):1693. https://doi.org/10.3390/plants13121693
Chicago/Turabian StyleZhang, Panpan, Binglei Wang, Yaning Guo, Tao Wang, Qian Wei, Yan Luo, Hao Li, Huiping Wu, Xiaolin Wang, and Xiong Zhang. 2024. "Identification of Drought-Resistant Response in Proso Millet (Panicum miliaceum L.) Root through Physiological and Transcriptomic Analysis" Plants 13, no. 12: 1693. https://doi.org/10.3390/plants13121693
APA StyleZhang, P., Wang, B., Guo, Y., Wang, T., Wei, Q., Luo, Y., Li, H., Wu, H., Wang, X., & Zhang, X. (2024). Identification of Drought-Resistant Response in Proso Millet (Panicum miliaceum L.) Root through Physiological and Transcriptomic Analysis. Plants, 13(12), 1693. https://doi.org/10.3390/plants13121693