Identification of Salt-Stress-Responding Genes by Weighted Gene Correlation Network Analysis and Association Analysis in Wheat Leaves
Abstract
:1. Introduction
2. Results
2.1. Transcriptional Response to Salt Stress in Wheat Leaves
2.2. Co-Expression Modules of Salt-Stress-Responding Genes
2.3. Association Analysis between DEGs and Leaf Salt Injury Index
2.4. DEGs Responding to Salt Stress in Leaves
2.5. KASP Marker Validation of Candidate Genes
2.6. Prediction of the Interaction Network between TaBAM and TaAAP
3. Discussion
3.1. Modules Responding Salt Stress in Wheat Leaves
3.2. Salt-Tolerant Candidate Genes
3.3. Predicted Interaction Network in Turquoise Module
4. Materials and Methods
4.1. Plant Materials and NaCl Treatment
4.2. RNA-Seq
4.3. WGCNA
4.4. Association Analysis
4.5. KASP
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Butcher, K.; Wick, F.; Desutter, T.; Chatterjee, A.; Harmon, J. Soil salinity: A threat to global food security. Agron. J. 2016, 108, 2189–2200. [Google Scholar] [CrossRef]
- Davenport, R.; James, R.A.; Zakrisson-Plogander, A.; Tester, M.; Munns, R. Control of sodium transport in durum wheat. Plant Physiol. 2005, 137, 807–818. [Google Scholar] [CrossRef] [PubMed]
- Tester, M.; Davenport, R. Na+ tolerance and Na+ transport in higher plants. Ann. Bot. 2003, 91, 503–527. [Google Scholar] [CrossRef] [PubMed]
- Van Zelm, E.; Zhang, Y.; Testerink, C. Salt tolerance mechanisms of plants. Annu. Rev. Plant Biol. 2020, 71, 403–433. [Google Scholar] [CrossRef]
- International Wheat Genome Sequencing Consortium (IWGSC). Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, eaar7191. [Google Scholar] [CrossRef]
- Li, J.; Gao, X.; Chen, X.; Fan, Z.; Zhang, Y.; Wang, Z.; Shi, J.; Wang, C.; Zhang, H.; Wang, L.; et al. Comparative transcriptome responses of leaf and root tissues to salt stress in wheat strains with different salinity tolerances. Front. Genet. 2023, 14, 1015599. [Google Scholar] [CrossRef]
- Chen, J.; Zhang, L.; Liu, Y.; Shen, X.; Guo, Y.; Ma, X.; Zhang, X.; Li, X.; Cheng, T.; Wen, H.; et al. RNA-Seq-based WGCNA and association analysis reveal the key regulatory module and genes responding to salt stress in wheat roots. Plants 2024, 13, 274. [Google Scholar] [CrossRef]
- Wang, W.; Wang, W.; Wu, Y.; Li, Q.; Zhang, G.; Shi, R.; Yang, J.; Wang, Y.; Wang, W. The involvement of wheat U-box E3 ubiquitin ligase TaPUB1 in salt stress tolerance. J. Integr. Plant Biol. 2020, 62, 631–651. [Google Scholar] [CrossRef]
- Zheng, M.; Lin, J.; Liu, X.; Chu, W.; Li, J.; Gao, Y.; An, K.; Song, W.; Xin, M.; Yao, Y.; et al. Histone acetyltransferase TaHAG1 acts as a crucial regulator to strengthen salt tolerance of hexaploid wheat. Plant Physiol. 2021, 186, 1951–1969. [Google Scholar] [CrossRef]
- Qiu, D.; Hu, W.; Zhou, Y.; Xiao, J.; Hu, R.; Wei, Q.; Zhang, Y.; Feng, J.; Sun, F.; Sun, J.; et al. TaASR1-D confers abiotic stress resistance by affecting ROS accumulation and ABA signalling in transgenic wheat. Plant Biotechnol. J. 2021, 19, 1588–1601. [Google Scholar] [CrossRef]
- Rosa-Téllez, S.; Anoman, D.; Alcántara-Enguídanos, A.; Garza-Aguirre, R.A.; Alseekh, S.; Ros, R. PGDH family genes differentially affect Arabidopsis tolerance to salt stress. Plant Sci. 2020, 290, 110284. [Google Scholar] [CrossRef] [PubMed]
- Wen, F.P.; Zhang, Z.H.; Bai, T.; Xu, Q.; Pan, Y.H. Proteomics reveals the effects of gibberellic acid (GA3) on salt-stressed rice (Oryza sativa L.) shoots. Plant Sci. 2010, 178, 170–175. [Google Scholar] [CrossRef]
- Zhu, H.; Yang, X.; Wang, X.; Li, Q.; Guo, J.; Ma, T.; Zhao, C.; Tang, Y.; Qiao, L.; Wang, J.; et al. The sweetpotato β-amylase gene IbBAM1.1 enhances drought and salt stress resistance by regulating ROS homeostasis and osmotic balance. Plant Physiol. Biochem. 2021, 168, 167–176. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Zhai, M.; Cui, D.; Han, R.; Wang, X.; Xu, W.; Qi, G.; Zeng, X.; Zhuang, Y.; Liu, C. Genome-wide analysis of the amino acid permeases gene family in wheat and TaAAP1 enhanced salt tolerance by accumulating ethylene. Int. J. Mol. Sci. 2023, 24, 13800. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Qiao, L.; Bai, J.; Wang, P.; Duan, W.; Yuan, S.; Yuan, G.; Zhang, F.; Zhang, L.; Zhao, C. Genome-wide characterization of JASMONATE-ZIM DOMAIN transcription repressors in wheat (Triticum aestivum L.). BMC Genom. 2017, 18, 152. [Google Scholar] [CrossRef]
- Ye, H.; Qiao, L.; Guo, H.; Guo, L.; Ren, F.; Bai, J.; Wang, Y. Genome-wide identification of wheat WRKY gene family reveals that TaWRKY75-A is referred to drought and salt resistances. Front. Plant Sci. 2021, 12, 663118. [Google Scholar] [CrossRef]
- He, D.; Zhang, H.; Yang, P. The mitochondrion-located protein OsB12D1 enhances flooding tolerance during seed germination and early seedling growth in rice. Int. J. Mol. Sci. 2014, 15, 13461–13481. [Google Scholar] [CrossRef]
- Ergen, N.Z.; Thimmapuram, J.; Bohnert, H.J.; Budak, H. Transcriptome pathways unique to dehydration tolerant relatives of modern wheat. Funct. Integr. Genom. 2009, 9, 377–396. [Google Scholar] [CrossRef]
- Wang, Y.; Li, Y.; Tian, H.; Wang, W.; Wang, X.; Hussain, S.; Yuan, Y.; Lin, R.; Hussain, H.; Wang, T.; et al. AtS40-1, a group I DUF584 protein positively regulates ABA response and salt tolerance in Arabidopsis. Gene 2022, 846, 146846. [Google Scholar] [CrossRef]
- Liu, J.; Zhao, J.; Lu, P.; Chen, M.; Guo, C.; Xu, Z.; Ma, Y. The E-subgroup pentatricopeptide repeat protein family in Arabidopsis thaliana and confirmation of the responsiveness PPR96 to abiotic stresses. Front. Plant Sci. 2016, 7, 1825. [Google Scholar] [CrossRef]
- Xu, Z.; Chen, X.; Lu, X.; Zhao, B.; Yang, Y.; Liu, J. Integrative analysis of transcriptome and metabolome reveal mechanism of tolerance to salt stress in oat (Avena sativa L.). Plant Physiol. Biochem. 2021, 160, 315–328. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Qiao, D.; Zhang, Z.; Li, Y.; Shi, S.; Yang, Y. Calcium signal regulated carbohydrate metabolism in wheat seedlings under salinity stress. Physiol. Mol. Biol. Plants 2024, 30, 123–136. [Google Scholar] [CrossRef] [PubMed]
- Schreier, T.B.; Fahy, B.; David, L.C.; Siddiqui, H.; Castells-Graells, R.; Smith, A.M. Introduction of glucan synthase into the cytosol in wheat endosperm causes massive maltose accumulation and represses starch synthesis. Plant J. 2021, 106, 1431–1442. [Google Scholar] [CrossRef] [PubMed]
- Qiao, L.; Zhang, X.; Li, X.; Yang, Z.; Li, R.; Jia, J.; Yan, L.; Chang, Z. Genetic incorporation of genes for the optimal plant architecture in common wheat. Mol. Breed. 2022, 42, 66. [Google Scholar] [CrossRef] [PubMed]
- Qiao, L.; Zhang, X.; Li, S.; Chen, F.; Li, X.; Guo, H.; Zhang, S.; Chang, L.; Zhang, X.; Chang, Z. Salt-tolerance identification at seedling stage and molecular marker evaluation of wheat-Thinopyrum intermedium introgression lines. Shandong Agr. Sci. 2021, 53, 69–73. [Google Scholar]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
SNP-ID | Position (IWGSC v1.0) | p Value | Gene | Module | Annotation |
---|---|---|---|---|---|
1B28382[G/C] | chr1B:357643623 | 6.16 × 10−5 | TraesCS1B02G199700 | Turquoise | Aldo/keto reductase |
1B28384[T/C] | chr1B:357643624 | 6.16 × 10−5 | |||
1B62422[G/A] | chr1B:658447582 | 9.44 × 10−5 | TraesCS1B02G433700 | Red | B12D protein |
2A19680[C/T] | chr2A:202051233 | 8.23 × 10−5 | TraesCS2A02G215100 | Turquoise | β-amylase |
2A56718[T/C] | chr2A:735005679 | 1.18 × 10−5 | TraesCS2A02G508900 | Magenta | 3-phosphoglycerate dehydrogenase |
2A56735[C/G] | chr2A:735005886 | 1.18 × 10−5 | |||
2A56900[C/T] | chr2A:735008442 | 3.74 × 10−5 | |||
2A57026[T/C] | chr2A:735010697 | 7.21 × 10−5 | |||
2A57040[C/T] | chr2A:735010824 | 3.20 × 10−6 | |||
2A57350[C/T] | chr2A:735247227 | 2.77 × 10−6 | TraesCS2A02G509600 | Purple | Kinase |
2B36776[G/A] | chr2B:394319058 | 2.21 × 10−5 | TraesCS2B02G286300 | Yellow | Senescence regulator S40 |
2B53697[G/A] | chr2B:583672455 | 6.16 × 10−5 | TraesCS2B02G410100 | Blue | Pentatricopeptide repeat-containing protein |
2D16208[G/A] | chr2D:30979221 | 5.59 × 10−5 | TraesCS2D02G073700 | Brown | Germin-like protein |
2D16220[C/G] | chr2D:30979584 | 1.13 × 10−5 | |||
2D30145[T/C] | chr2D:112552049 | 9.02 × 10−5 | TraesCS2D02G168600 | Black | Transcription factor WRKY |
3A25691[A/G] | chr3A:418765923 | 2.19 × 10−5 | TraesCS3A02G223700 | Brown | Chitinase domain-containing protein 1 |
3A25693[G/A] | chr3A:418765932 | 2.19 × 10−5 | |||
3A25695[C/A] | chr3A:418765937 | 2.19 × 10−5 | |||
3A25696[T/C] | chr3A:418765938 | 2.19 × 10−5 | |||
3D34988[A/G] | chr3D:569527094 | 6.89 × 10−5 | TraesCS3D02G465600 | Yellow | Hydroxyethylthiazole kinase |
5B14295[C/T] | chr5B:381844970 | 8.23 × 10−5 | TraesCS5B02G211000 | Yellow | Jasmonate zim-domain protein |
6B00507[C/T] | chr6B:18731508 | 1.25 × 10−5 | TraesCS6B02G031700 | Yellow | Acid β-fructofuranosidase |
6B00509[G/A] | chr6B:18731516 | 1.25 × 10−5 | |||
7B00634[A/C] | chr7B:23439766 | 5.42 × 10−5 | TraesCS7B02G024500 | Red | Glutamyl-tRNA reductase |
7B00635[A/C] | chr7B:23439791 | 3.77 × 10−5 | |||
7B00636[G/C] | chr7B:23439798 | 3.77 × 10−5 | |||
7B00758[C/T] | chr7B:23442344 | 9.84 × 10−5 | |||
7D14857[T/C] | chr7D:141558991 | 2.17 × 10−5 | TraesCS7D02G189000 | Turquoise | Amino acid permease |
7D14966[T/A] | chr7D:141564019 | 7.20 × 10−5 | |||
7D14967[C/A] | chr7D:141564020 | 7.20 × 10−5 |
Marker Name | Primer Sequence (5′−3′) |
---|---|
KASP-1B62422-F1 | GAAGGTGACCAAGTTCATGCTCCCCTCTGCTAGTTGGCC |
KASP-1B62422-F2 | GAAGGTCGGAGTCAACGGATTCCCCTCTGCTAGTTGGCT |
KASP-1B62422-R | GAACATGGGAGGGATGGGTG |
KASP-2A19680-F | GGCGTGTATGATGGATGTGC |
KASP-2A19680-R1 | GAAGGTGACCAAGTTCATGCTATGCCAGCGGATGTAGCC |
KASP-2A19680-R2 | GAAGGTCGGAGTCAACGGATTATGCCAGCGGATGTAGCT |
KASP-2A56900-F | GCAAAACTCTTGCTATCCTTGGG |
KASP-2A56900-R1 | GAAGGTGACCAAGTTCATGCTGGGGCATATGCAATGAGATAAAGTC |
KASP-2A56900-R2 | GAAGGTCGGAGTCAACGGATTGGGGCATATGCAATGAGATAAAGTT |
KASP-2B36776-F | GACTAGTGCAGCGGAGTAG |
KASP-2B36776-R1 | GAAGGTGACCAAGTTCATGCTATTCGCCCTCTTATTTCTGTTTC |
KASP-2B36776-R2 | GAAGGTCGGAGTCAACGGATTATTCGCCCTCTTATTTCTGTTTT |
KASP-2B53697-F1 | GAAGGTGACCAAGTTCATGCTGGTGGACTCGTGTCTTCGC |
KASP-2B53697-F2 | GAAGGTCGGAGTCAACGGATTGGTGGACTCGTGTCTTCGT |
KASP-2B53697-R | TGTCCCATAGGAGGCAATGT |
KASP-2D30145-F | GTAGGGCGAGAGGGGAGTC |
KASP-2D30145-R1 | GAAGGTGACCAAGTTCATGCTGCCTCCTAAGTCCAACACATGT |
KASP-2D30145-R2 | GAAGGTCGGAGTCAACGGATTGCCTCCTAAGTCCAACACATGC |
KASP-5B14295-F1 | GAAGGTGACCAAGTTCATGCTGCCAACTCCCTCACTCTTATACTC |
KASP-5B14295-F2 | GAAGGTCGGAGTCAACGGATTGCCAACTCCCTCACTCTTATACTT |
KASP-5B14295-R | GACGCGGAGAGGGCATTTGC |
KASP-7B00758-F | GGAGTTGGTCAACAAATTTCCG |
KASP-7B00758-R1 | GAAGGTGACCAAGTTCATGCTCAAGAGAAACAAGCTTTCCTGC |
KASP-7B00758-R2 | GAAGGTCGGAGTCAACGGATTCAAGAGAAACAAGCTTTCCTGT |
KASP-7D14857-F | GGAATGGCCTTGATTGACTC |
KASP-7D14857-R1 | GAAGGTGACCAAGTTCATGCTGCCGCCTTCATTCTGGTTAAA |
KASP-7D14857-R2 | GAAGGTCGGAGTCAACGGATTGCCGCCTTCATTCTGGTTAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qiao, L.; Li, Y.; Wang, L.; Gu, C.; Luo, S.; Li, X.; Yan, J.; Lu, C.; Chang, Z.; Gao, W.; et al. Identification of Salt-Stress-Responding Genes by Weighted Gene Correlation Network Analysis and Association Analysis in Wheat Leaves. Plants 2024, 13, 2642. https://doi.org/10.3390/plants13182642
Qiao L, Li Y, Wang L, Gu C, Luo S, Li X, Yan J, Lu C, Chang Z, Gao W, et al. Identification of Salt-Stress-Responding Genes by Weighted Gene Correlation Network Analysis and Association Analysis in Wheat Leaves. Plants. 2024; 13(18):2642. https://doi.org/10.3390/plants13182642
Chicago/Turabian StyleQiao, Linyi, Yijuan Li, Liujie Wang, Chunxia Gu, Shiyin Luo, Xin Li, Jinlong Yan, Chengda Lu, Zhijian Chang, Wei Gao, and et al. 2024. "Identification of Salt-Stress-Responding Genes by Weighted Gene Correlation Network Analysis and Association Analysis in Wheat Leaves" Plants 13, no. 18: 2642. https://doi.org/10.3390/plants13182642
APA StyleQiao, L., Li, Y., Wang, L., Gu, C., Luo, S., Li, X., Yan, J., Lu, C., Chang, Z., Gao, W., & Zhang, X. (2024). Identification of Salt-Stress-Responding Genes by Weighted Gene Correlation Network Analysis and Association Analysis in Wheat Leaves. Plants, 13(18), 2642. https://doi.org/10.3390/plants13182642