Next Article in Journal
Cathelicidin LL-37 in Health and Diseases of the Oral Cavity
Previous Article in Journal
The Effects of the Exposure of Musculoskeletal Tissue to Extracorporeal Shock Waves
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Aptamers Targeting Cardiac Biomarkers as an Analytical Tool for the Diagnostics of Cardiovascular Diseases: A Review

Scientific-Manufacturing Complex Technological Centre, 1–7 Shokin Square, Zelenograd, 124498 Moscow, Russia
*
Author to whom correspondence should be addressed.
Biomedicines 2022, 10(5), 1085; https://doi.org/10.3390/biomedicines10051085
Submission received: 19 April 2022 / Revised: 5 May 2022 / Accepted: 6 May 2022 / Published: 6 May 2022
(This article belongs to the Collection Feature Papers in Biomedical Engineering in Human Health)

Abstract

:
The detection of cardiac biomarkers is used for diagnostics, prognostics, and the risk assessment of cardiovascular diseases. The analysis of cardiac biomarkers is routinely performed with high-sensitivity immunological assays. Aptamers offer an attractive alternative to antibodies for analytical applications but, to date, are not widely practically implemented in diagnostics and medicinal research. This review summarizes the information on the most common cardiac biomarkers and the current state of aptamer research regarding these biomarkers. Aptamers as an analytical tool are well established for troponin I, troponin T, myoglobin, and C-reactive protein. For the rest of the considered cardiac biomarkers, the isolation of novel aptamers or more detailed characterization of the known aptamers are required. More attention should be addressed to the development of dual-aptamer sandwich detection assays and to the studies of aptamer sensing in alternative biological fluids. The universalization of aptamer-based biomarker detection platforms and the integration of aptamer-based sensing to clinical studies are demanded for the practical implementation of aptamers to routine diagnostics. Nevertheless, the wide usage of aptamers for the diagnostics of cardiovascular diseases is promising for the future, with respect to both point-of-care and laboratory testing.

1. Introduction

Cardiovascular diseases (CVDs) are the most frequent cause of death worldwide. The WHO estimated the number of deaths associated with CVDs to have reached 17.9 million in 2019, about 32% of all global deaths [1]. The early detection of CVDs is required to start medical treatment as soon as possible. The diagnostics of CVDs rely on physical examinations, electrocardiography, echocardiography, and blood analysis [2]. A variety of cardiac biomarkers have been established which are useful for diagnostics, progression evaluation, outcome prognosis, and the risk assessment of CDVs. These biomarkers are classified in several categories (Figure 1). Cardiac troponin I (cTnI), cardiac troponin T (cTnT), myoglobin, and creatine kinase (CK-MB) are considered as specific markers of myocardial injury. B-type natriuretic peptide (BNP) and N-terminal pro-B-type natriuretic peptide (NT-proBNP) are the markers of myocardial stretch. Neurohumoral markers include mid-regional proadrenomedullin (MR-proADM), mid-regional pro-atrial natriuretic peptide (MR-proANP), and copeptin. Inflammatory biomarkers are also related to CDVs, with interleukin-6 (IL-6), C-reactive protein (CRP), and tumor necrosis factor alpha (TNFα) being the most notable among them. The soluble suppression of tumorigenicity 2 (sST2), galectin-3 (Gal3), growth differentiation factor 8 (GDF8), and growth differentiation factor 15 (GDF15) are the markers of extracellular matrix remodeling [3]. The speed, accessibility, and low cost are the key benefits of biomarker analysis, as it can be performed both in laboratory environments and using point-of-care portable (POC) devices [4].
To date, biomarker analysis mainly relies on immunoanalysis with special concern to laboratory diagnostics, which implies mainly sandwich antibody-based detection. As a diagnostics tool, antibodies offer high sensitivity and selectivity, but also have some drawbacks, which are relatively high price and batch-to-batch variations, the latter leading to the loss of result reproducibility [5]. To overcome these issues, aptamers are emerging as an alternative to antibodies as an analytical instrument. Aptamers are short nucleic acid ligands (DNA or RNA of 15–100 nt long) which are capable of binding to a specific target with high affinity and specificity [6]. SOMAmers (slow off-rate modified aptamers) are DNA aptamers in which nucleic bases are modified with some hydrophobic moieties [7]. These modifications expand the range of aptamer–target interactions with hydrophobic ones, which are absent in conventional DNA and RNA aptamers. This, in turn, results in higher affinities of SOMAmers to their targets [7]. Aptamers to almost any target can be obtained using an in vitro evolutionary approach called SELEX [8,9]. The structure of any aptamer is standardized by its primary sequence, which is always known for the aptamer, in contrast to antibodies. The automation of chemical oligonucleotide synthesis minimizes the probability of batch-to-batch variations. DNA and RNA oligonucleotide synthesis is available from different manufacturers for a cost of about USD 0.2–0.5 per single nucleotide. Thus, aptamers offer a low cost of chemical synthesis, very low batch-to-batch variation, ease of labeling, and regeneration ability [10,11]. An additional benefit of aptamers is the possibility to regulate their selectivity among the interfering analytes using negative and counter selection steps introduced to the selection procedure. This ability is one more advantage of aptamers in comparison to antibodies, which are suspected to exhibit cross-reactivity to homologous targets [12]. Aptamers expand strongly to the research field of POC device development, with cardiac biomarker detection systems being among them [3]. As for laboratory diagnostics, aptamer-based detection often lacks sandwich-type analysis, while this analysis has gained its popularity due to the enhanced specificity of assays granted by dual-target recognition and the ability to implement signal amplification labels to one of the paired ligands [13]. Sandwich-type analysis is applicable to both electrochemical and optical detection platforms and is useful for laboratory and POC diagnostics. A drawback of aptamers, in respect to analytical applications, is a strong impact of the surrounding conditions on aptamer folding, and thus target recognition; the binding of aptamers to targets is strongly affected by pH and buffer composition [6]. This can impede the practical detection of biomarkers from biological fluids, which is strongly important for POC devices.
This review is aimed to critically evaluate the existing aptamers to the most common CVD biomarkers as a basis for analytical detection for the purpose of practical implementation to clinical diagnostics. For this, binding characteristics and specificity of the established aptamers to the targets, as well as the ascertainment of sandwich-type aptamer assays, are analyzed. Special attention is paid to the possibility of CVD biomarker detection from whole blood, saliva, and urine as alternatives to blood serum, as these fluids are more affordable for POC formats. Aptamers have not been established for all cardiac biomarkers. Nevertheless, we include the biomarkers for which aptamers are not yet discovered to this review to provide a more exhaustive biomarker range and to demonstrate the gaps in the current aptamer research.

2. Cardiac Biomarkers and Their Aptamers

2.1. Cardiac Troponins

The troponin complex, which regulates muscle contraction, is a component of skeletal and cardiac muscle thin filaments [14,15]. Myocardial damage results in the release of troponin to blood circulation within 1–3 h of injury [14]. The peak concentration of troponin, mounting up to 100 ng/mL, is reached within 1–2 days after the infarction, and the elevated level remains for about 10 days [16]. The troponin complex is comprised of three subunits: troponin C, troponin I, and troponin T. In humans, troponins I and T exist in three isoforms each: fast and slow skeletal isoforms and a specific cardiac isoform (cTnI and cTnT) [14,15], while troponin C is identical in skeletal and cardiac tissues [15]. Due to this, cTnI and cTnT are rather sensitive and specific biomarkers for cardiac injury. Elevated levels of cTnI and cTnT in blood serum are associated with acute myocardial infarction (AMI), but can also be caused by other reasons, both cardiac and non-cardiac [14,17]. Besides blood serum, cardiac troponins can be measured in saliva and urine. Saliva levels of cardiac troponins correlate with blood serum levels and, therefore, detection from saliva can be used instead of blood analysis. Cardiac troponins in urine are associated with renal disease [14].
To date, troponins are the most specific biomarkers for myocardial injury. In clinical practice, sandwich immunological assays are dominant for the detection of troponins. Contemporary ultra-sensitive immunoassays are capable to detect as low as 1 ng/L cTnI [15]. Nevertheless, the detection of troponins is hampered by the cross-reactivity of sensitive cTnI and cTnT antibodies with skeletal isoforms of troponins, which causes the false positive results of detection [15,18]. Due to possible unspecific detection, the diagnostics cut-off value should be established for each detection method individually based on the analysis of troponin levels in a healthy control group [16,19]. Today a lot of effort is posed to develop more and more acute, sensitive and fast detection tools for cTnI and cTnT.
For cTnI, several DNA aptamers have been reported. In 2015, H. Jo et al. published the isolation of Tro4 and Tro6 aptamers binding cTnT with KD in the picomolar range [20]. The specificity of cTnI detection using Tro4 was demonstrated over cTnT, cTnC, human serum albumin (HSA), myoglobin, and B-type natriuretic peptide [20]. Tro4 has become the most popular tool for the development of numerous biosensors and detection methods [21,22,23,24,25,26,27,28]. Many sensors have also been developed using the Tro6 aptamer [29,30]. The specificity of Tro6 for cTnI has been proven using thrombin, myoglobin, IgG, BSA, and alpha-fetoprotein [30]. The combination of Tro4 and Tro6 allowed the development of sandwich assays for cTnI detection [20,31,32,33,34,35].
Dorraj et al. performed aptamer isolation resulting in four aptamer sequences (TnIApt23, TnIApt19, TnIApt18, TnIApt11) [36]. The sequences of TnIApt23 and TnIApt19 are not provided in the original paper, but a dot-blot assay for cTnI detection based on the TnIApt23 aptamer is reported beside the aptamer selection [36]. TnIApt18, the sequence of which is published, was further used by other research groups for the development of other cTnI biosensors [37,38].
In 2018, the TnI2 aptamer was isolated [39] and further applied for the ELONA-type assay of cTnI based on the combination of the aptamer and the TnI-specific antibody [40].
Cen et al. reported the selection of two more DNA aptamers for cTnI named Apt 3 and Apt 6, and their application for the ELONA-type sandwich assay for cTnI detection [41]. The developed aptamer-based assay was characterized with a dynamic range of 0.05–200 ng/mL. The detection of cTnI was not interfered with by skeletal TnI, cTnT or cTnC. This research represents a rather rare example of aptamer-based assay validation in clinical diagnostics. The aptamer-based ELONA was compared to a commercial antibody-based FICA kit for cTnI detection in the clinical diagnosis of AMI. The sensitivity and specificity of the aptamer-based ELONA were 96.46% and 93.85%, respectively, and the accuracy was 95.06% These parameters turned out to be superior to the FICA kit which is used in clinical practice [41].
The group of Tamás Mészáros developed Spiegelmers targeting cTnI [18,42]. Spiegelmers are L-DNA ligands exhibiting very strong nuclease resistance. The peptide fragments from both C and N terminal parts of cardiac troponin I serve as selection targets to enable subsequent sandwich-type detection and avoid cross-reactivity of the Spiegelmers with skeletal TnI isoforms. Four Spiegelmers, two (A4, B10) targeting the C-terminal fragment [18] and two (A6, C6) for the N-terminal fragment [42], were established. These Spiegelmers were evaluated for the development of a sandwich bead-based luminescent homogenous proximity assay (AlphaLISA) [18,43]. Interestingly, the B10 sequence has also been reported to function as a conventional DNA aptamer. Electrochemiluminescence disposable [44] and electrochemical (DPV) [45] aptasensors employing DNA B10 sequence have been reported, but no mention that it is a Spiegelmer is present in these papers.
Krasitskaya et al. reported DNA aptamer selection against cTnI which resulted in several aptamer sequences (TnAp1, TnAp2, TnAp4, TnAp5, TnAp10, TnAp12, TnAp14, TnAp2t1, TnAp2t2, TnAp2t3) [46]. Based on TnAp10 and TnAp2t3, a sandwich bioluminescent assay for cTnI detection capable to detect 0.04–3 nM of cTnI was developed [46].
A sequence of the DNA aptamer for cTnI is provided in [47]. This paper describes a SERS sensor for cTnI detection. One more cTnI aptamer sequence is available in [48]. Based on this aptamer, an electrochemiluminescent aptasensor for cTnI was developed. Additionally, two research works report aptasensors which seem to employ unique aptamers, but no sequences are provided in the publications [49,50].
The known sequences of aptamers binding to cTnI and other cardiac biomarkers discussed in this review are summarized in Table 1.The existing cTnI aptasensors are extensively reviewed in special papers [51,52]. The large variety of detection platforms for the aptasensing of troponins is available, including both optical assays (luminescent, fluorescent, SPR, SERS, colorimetric) and electrochemical biosensors (DPV, CV, SWV, EIS, FET). Most of the developed aptasensors display excellent sensing characteristics. The established aptamers are applicable for the development of both laboratory assays with instrumental detection [29,37,40,42] and POC portable devices [35,38], can be combined to benefit with sandwich-type analysis [32,33,34,35,42,53], and have been shown to detect cTnI in saliva, urine and whole blood, as well as blood serum [21,23,51]. Surely, aptamers can serve for cTnI detection in clinical practice. Among the varieties of aptamer binding, cTnI, Tro4 and Tro6 display the best performance due to the lowest KD values, well demonstrated specificity to cTnI, applicability for the detection from saliva and serum, and ability to function in dual-aptamer sandwich assays. Moreover, Apt 3 and Apt 6 are viable for practical usage, as this aptamer pair display good LOD and vast dynamic range for cTnI detection, and have been evaluated in clinical research.
The specificity of cTnT for AMI detection is lower compared to cTnI [54,55]. However, cTnT is believed to be the most stable AMI biomarker [54], and due to this displays higher accuracy in late diagnostics [55]. cTnT levels correlate with mortality in patients, making it a disease outcome predictor [55].
cTnT concentration in saliva correlates with its concentration in blood serum [56], and cTnT detection from saliva can be an alternative for blood testing.
Several aptamers are also available for Troponin T. The Tro4 aptamer, which was initially developed for cTnI [20], has been reported to detect cTnT electrochemically [57,58]. The selectivity test was performed for both aptasensors, but cTnI was not included in the interferents set. At the same time, the specificity of the Tro4-based aptasensor against cTnT was addressed in other papers, and the reported aptasensors for cTnI detection exhibited no response to cTnT [20,24,25,28]. So far, the data on the specificity of Tro4 for cTnT is confusing. This places special emphasis on the necessity of the specificity assessment of the aptamers and aptamer-based detection methods to the desired target and to appropriate cross-target choice.
Two more DNA sequences (Apt1 and Apt2) have been found to work for the ELONA sandwich assay of cTnT [59]. The LOD and detection range of this assay were not sufficient for the real detection of cTnT, but demonstrated the benefit of good analyte recovery from undiluted serum [59]. The sensing parameters of the sandwich assay based on Apt1 and Apt2 can be improved with the application of other biosensor design. Apt1 was applied to detect cTnT electrochemically, and the sensor demonstrated an LOD of 1.7 pg/mL from 10-fold diluted serum, which is enough for practical usage, and showed no response to cTnI and myoglobin [60]. A DNA aptamer binding to Troponin T (AraHH001) was discovered during cell-SELEX against mouse tumor endothelial cells [61,62]. It also binds human tumor endothelial cells, and this research revealed that cTnT can serve as a cancer marker in human [62]. AraHH001 was used for electrochemical cTnT detection as a part of multiple biomarker detection panel [63]. Besides, two papers report cTnT FET-based aptasensors with no indication of the employed aptamer sequences [64,65]. The amount of both established aptamer sequences and the developed aptasensors for cTnT is less than for cTnI. Nevertheless, the existing aptamers provide a sufficient basis for the implementation of aptamer-based cTnT detection in clinical practice.

2.2. Myoglobin

Myoglobin is a rather small protein with a molecular weight of 16.8 kDa whose function is the binding, storage and transport of oxygen. It is present in skeletal and cardiac muscles. The normal blood level of myoglobin is reported to be 6–85 ng/mL [54]. Upon the injury of muscle cells, which happens under AMI, it is released in the blood and reaches the levels of 70–200 ng/mL, which is the diagnostics cut-off value for myoglobin [66]. Myoglobin is the earliest AMI biomarker, as its level in blood increases within 1 h after infarction, reaches its maximum at 4–12 h, and returns to normal within 24 h [54,67]. Due to the presence in skeletal muscles, myoglobin is not absolutely specific for cardiac diseases, but it exhibits a high negative predictive value [68]. Myoglobin can be detected in saliva [69,70,71] for AMI diagnostics and in urine, though in urine it serves as a renal and muscle disease marker, but not cardiac [72,73,74].
A successful aptamer isolation against myoglobin was reported in 2014 [75]. Three aptamer sequences are provided in the respective paper (Myo40-7-27, Myo40-7-69, Myo40-7-34) and, among them, Myo40-7-27 exhibited the lowest KD of 4.93 nM. Myo40-7-27 has generated dozens of biosensors of different types using electrochemical and optical platforms [76]. Myo40-7-27 can be combined with myoglobin-specific antibodies to perform the assay in a sandwich format [77,78]. Besides, the established splitting of this aptamer enables the usage of donor–acceptor proximity-based detection, which is usually a benefit of sandwich-type assays [79].
Three more DNA aptamers for myoglobin are reported, but these sequences are much less involved in aptasensor development. One of them is a DNA aptamer with a length of 72 nt produced by OTC Biotech [80]. The aptamer was applied to develop a DPV-based electrochemical sensor with a 2.1 pg/mL limit of detection (LOD) from 10-fold diluted human serum. Another aptamer is referred to as ST1, but its sequence is not available [81]. ST1 served for the detection of myoglobin as part of an electrochemical sensor with an LOD of 0.34 ng/mL [81] and the SERS sensor detecting as low as 10 fg/mL [82]. Finally, the isolation of the 78 nt long DNA aptamer, characterized with picomolar KD value, was reported [83]. The aptamer was applied for the electrochemical detection of myoglobin in serum samples with an LOD of 0.524 pg/mL. The sensor provided no response for hemoglobin and BSA [83].
An extensive recent review of aptamer-based nanosensors for myoglobin is available [76]. In brief, the variety of myoglobin aptasensors was developed using different detection platforms. LODs and detection ranges efficiently covered the required clinical values. No two-side sandwich assay based completely on the aptamers for myoglobin has been reported to date, though this approach could be very useful for developing myoglobin assays in a popular ELISA-type format. Most of the sensors are applied for the detection from serum samples, while detection from saliva [84] and urine [84,85] is performed rarely. No aptasensing of myoglobin in whole blood has been described [76]. The described aptamers for myoglobin have equal chances to be employed for the clinical detection of this biomarker. For this, the evaluation of sandwich aptamer pairs and more efforts for the development of the sensors for the detection from saliva and urine are required.

2.3. Creatine Kinase

Creatine phosphokinase (CK, EC 2.7.3.2) is present in humans in three isoenzymes—BB, MM and MB—the names of which originate from the various combination of the M (i.e., muscle) and B (i.e., brain) isoforms. A significant concentration of CK-MB isoenzyme is found almost exclusively in the myocardium, and the appearance of elevated CK-MB levels in serum is highly specific and sensitive for myocardial cell wall injury. Normal reference values for serum CK-MB range from 3 to 5% (percentage of total CK activity) or 5 to 25 IU/L. The peak level of CK-MB activity is reached 3–8 h after infarction, ranges from 15 to 30% of total CK activity, and stays elevated for 24–48 h [86]. Despite the fact that the introduction of assays for troponins T and I has allowed the slightly earlier diagnosis of acute coronary syndrome (ACS) and improved the sensitivity over CK-MB [87,88], the measurement of CK and CK-MB is still popular in clinical diagnostics [89]. The evaluation of CK-MB in serum allows the determination of infarct size, and the infarct size is associated with short- and long-term cardiovascular complications such as cardiac death, reinfarction, congestive heart failure (CHF), stroke and unstable angina requiring hospitalization [90]. The presence of CK in saliva could confer a quick, less invasive investigation at lower cost. Mirzaii-Dizgah et al. investigate the serum and unstimulated whole saliva of AMI patients and healthy participants to compare the ratio of CK-MB/whole CK [91] and reveal the higher levels of CK-MB in the AMI group. The same correlations were reported in [92], but these correlations do not allow selective diagnosis as serum measurements [93] and additional study should be performed.
Nowadays, the CK-MB level is usually determined by the ELISA based on the sandwich principle with a mono-clonal antibody specific for the MB isoenzyme [94] or by the activity measurements of the B-subunit after the immunoinhibition of M-subunit activity [95].
Two DNA aptamers (c.Apt.21 and c.Apt.30) with high specificity and affinity to CK-MB are reported [96]. By using fluorescent microspheres and c.Apt.30, an aptamer-based lateral flow assay was developed and tested on artificial serum samples. The LOD for CK-MB was found to be as low as 0.63 ng·mL−1, and the assay worked in the range of 0.005–2 μg·mL−1 CK-MB concentration. This makes it promising that a developed assay can be used clinical diagnostics [96]. In another paper, c.Apt.21 was used to develop a microfluidic chip with DNA hydrogel for the detection of CK-MB. The obtained signal was linearly correlated with the logarithm of CK-MB concentration in the range of 0.01–750 nM. In this approach, a cell phone was used to perform a quantitative readout of reaction results with an LOD of 0.027 nM [97].

2.4. Heart-Type Fatty Acid-Binding Protein

Heart-type fatty acid-binding protein (HFABP) is a small protein with a molecular weight of 15 kDa [98]. HFABP is assumed to contribute to the uptake, intracellular metabolism, and transport of long-chain fatty acids [99]. This protein is a cardiac-specific form of fatty-acid binding proteins and is abundant in cardiomyocytes [99]. HFABP increases in the blood within 30–90 min of cardiac injury [3,100], reaches its maximum at 6–8 h, and returns to baseline after 24–36 h [4,100]. Due to its fast release to blood, HFABP can serve as an early biomarker of ACS [3,101], being superior to myoglobin for AMI detection due to its faster release and the specificity of the cardiac form [4]. HFABP can be used to detect recurrent myocardial infarction [4] and to evaluate the risk of adverse cardiac events [102]. HFABP has also been detected in the urine of patients with AMI [103]. No information can be derived from the scientific literature on the presence of HFABP in saliva. Normal HFABP concentration in blood is typically less than 4.3 ng/mL [102]. The diagnostics cut-off value is not uniformly established, and ranges from 4 to 5.7 ng/mL [3,102]. High HFABP levels (9.3–79.0 ng/mL) are reported in sepsis patients [3,104]. ELISA is a common method for HFABP detection in practice [105].
Only one paper concerning aptamer development against HFABP has been published [101]. Two DNA aptamers (N13 and N53) with distinct binding sites were isolated with KD values of 74.3 and 334 nM, respectively. An application of these aptamers for HFABP detection using an AuNP aggregation-based colorimetric assay provided an LOD of 54 ng/mL, which is insufficient for practical usage.
So far, the future direction of aptamer research for HFABP is the isolation of novel HFABP-specific aptamers and the development of new detection methods, including sandwich assays.

2.5. B-Type Natriuretic Peptide and N-Terminal Pro-B-Type Natriuretic Peptide

B-type natriuretic peptide (BNP) is released in response to myocardial stretching [106,107]. Cardiomyocytes produce a proBNP, a 108-amino-acid peptide which is then enzymatically cleaved at the 76–77 position to form N-terminal proBNP (NT-proBNP, 1–76 amino acids of pro-BNP) and BNP (77–108 amino acids of proBNP). BNP contains a 17-amino-acid ring closed with a disulfide bond [107]. BNP is physiologically active, and NT-pro-BNP does not display biological activity [2,4]. BNP dilates blood vessels, decreases vascular resistance, increases stroke volume and renal sodium secretion, and increases urine production, which results in a decrease in blood volume and hence blood pressure [108]. BNP and NT-proBNP serve as biomarkers of HF and ACS and have prognostic utility in HF and coronary heart disease [109]. Regardless, these peptides are not considered to be exclusively cardiac specific [110]. Though BNP and NT-proBNP are released in equimolar amounts, BNP has a shorter lifetime in blood, which is 20 min for BNP and 1–2 h for NT-proBNP [111]. A normal value of BNP in the blood is about 20 pg/mL, and the diagnostic cut-off level is 0.1 ng/mL [2,4]. The cut-off value for NT-pro-BNP is 0.3 ng/mL [110]. So far, the detection of BNP is more difficult compared to NT-proBNP, due to its low levels and short in vivo and in vitro lifetime [110,111]. BNP is degraded by unspecific proteases to shorter peptide fragments with no biological activity, which are still immunoreactive, and this additionally hampers the correct detection of BNP [110]. Both BNP and NT-proBNP can be detected from saliva [112,113,114], which is acceptable for HF diagnostics and monitoring [114].
The first aptamer binding to BNP referred to as 8–12 was published in 2009 [115]. No KD is provided for this 55 mer DNA aptamer, as it was selected among other candidate sequences based on an ELISA-type end-point screening assay [115]. Nevertheless, this aptamer encouraged the development of various biosensors based on different detection platforms including SPR [115,116,117], FRET [118], and DPV [119]. The mentioned SPR and DPV sensors employed BNP-specific antibodies besides the BNP aptamer to build a sandwich-type binding of the target. The dynamic range of the aptasensors fits the biological levels of BNP. The detection of BNP with these sensors was performed in spiked serum samples [119] and in the diluted blood [115].
To develop a sandwich assay of BNP fully based on aptamers, an aptamer isolation experiment was performed by Bruno et al. [120]. The candidate aptamer sequences were screened for binding ability using ELONA, and four oligonucleotides, which provided maximum binding signal (2F, 6R, 14bF, 25cF), were selected for subsequent evaluation in an aptamer-magnetic bead capture electrochemiluminescence sandwich assay of BNP. Maximum response was obtained for the combination 25c-2F, but the cross-reactivity of these oligonucleotides was insufficient with notable response to BSA, CRP, and IL-6 [120].
Another aptamer selection against BNP was reported in 2014 by Wang et al. [121]. The selection resulted in several potent DNA aptamer candidates named A8, A10, A11, A14-1, and A14-5 which displayed target binding in a fluorescence binding assay. Among them, A10 oligonucleotide with the lowest KD of 12 nM was established as a BNP aptamer, its specificity was proven over BSA and Ovalbumin, and no matrix effect on the binding was detected in the serum [121]. The A10 aptamer to BNP was applied for the development of the photoelectrochemical (PEC) sensor with an LOD of 0.14 pg/mL and a linear range 1 pg/mL–0.1 mg/mL. The aptasensor was applied for the detection of BNP in serum [122]. Another sensor engaging the A10 aptamer is a DPV-based electrochemical biosensor capable of detecting 1 pg/mL–1 mg/mL BNP in spiked serum [111]. Notably, in this research, no BNP was detected in the clinical samples, either with the aptasensor or with the laboratory immunoassay, while NT-proBNP was determined with the laboratory method in the same samples. This demonstrates the influence of the very fast degradation of BNP on its assay [111].
The aptamers 8–12 [115] and A10 [121] are the most promising for future implementation to clinical diagnostics.
As for NT-proBNP, we succeeded to find a single DNA aptamer sequence named N20a which was isolated along with the selection aptamers for cTnI and fibrinogen performed by Sinha et al. using the microfluidic SELEX platform [39]. The binding of N20a with NT-proBNP was characterized with a KD of 2.89 nM determined with SPR, and the aptamer was shown to exhibit no cross-reactivity for cTnI, fibrinogen or BSA. The aptamer sequence was hidden in the original paper, but was later published in another report of the same research group [123]. N20a was applied for NT-proBNP detection in an automated microfluidic platform [123]. The detection relied on a combination of aptamer and specific antibodies in a sandwich-type assay. The LOD was established to be as low as 1.53 pg/mL. The detection of the target from spiked serum samples provided 86.3–96.9% recovery. The results of NT-proBNP detection with the developed microfluidic system were consistent with the results of the clinically involved immunoassay Cobas e411 (Roche Diagnostic) [123]. An amperometric aptasensor for NT-pro-BNP based on N20a is described. This sensor was realized in two variants, one based on the direct detection using the aptamer and one based on the aptamer–antibody sandwich assay. The second one provided lower LOD (1 pg/mL) and better sensitivity.
In summary, the existing aptamers for BNP and NT-proBNP allow the detection of these peptides in biologically and clinically relevant ranges, but lack the well-established ability to perform sandwich assays based fully on aptamers without the involvement of antibodies.

2.6. Mid-Regional pro-Adrenomedullin

Adrenomedullin (ADM) is a peptide vasoactive hormone. It is produced by vascular endothelial cells in different tissues; adrenomedullin causes vasodilatation, lowering blood pressure, and maintains vascular integrity [124,125,126]. ADM is increased under HF to decrease the heart overload [125]. Besides HF, hypertension, MI, renal diseases, and sepsis are associated with increased ADM, and the hormone elevation level depends on the severity of vascular damage [126]. The detection of ADM is difficult due to its 22 min half-life time [126]. ADM is synthesized as a preprohormone which is transformed to proADM, and proADM is cleaved to ADM and mid-region-proADM (MR-proADM), which is a 47-amino-acid-long peptide with the molecular weight of 5.1 kDa. MR-proADM can serve as a reliable surrogate biomarker for ADM. MR-proADM is more of a prognostic biomarker than a diagnostic one. MR-proADM can be used for diagnosis and the prognosis of sepsis, septic shock, and organ failure [127]. For the diagnosis of HF, it lacks specificity and does not provide significant diagnostic value compared to NT-proBNP [125]. MR-proADM displays outcome prognostic value in acute severe dyspnea and acute heart failure (ACF) [128] and provides significant prognostic and additive prognostic values to predict outcome and mortality in HF [3]. The normal range of MR-proADM is 0.26–0.51 nM [3]. Cut-off values for MR-proADM are not well established [126]; however, 2.96 ng/mL is reported as the cut-off for prognosis in HF [4,129]. A concentration above 0.72 nmol/L predicts mortality risk in patients with HF [130]. Immunoassay is the basis for MR-proADM detection [131,132], and no aptamers for this biomarker are described in the scientific literature.

2.7. Mid-Regional pro-Atrial Natriuretic Peptide

Atrial natriuretic peptide (ANP) is a peptide hormone with diuretic, natriuretic, and hypotensive activity produced by cardiac muscle cells in the walls of the atria in the heart [133,134]. ANP is increased in blood upon tension of the atrial wall, but its half-life is about 2 min [134]. Similar to BNP, ANP is expressed as a part of preprohormone (151 amino acid residues). PreproANP is then processed with the cleavage of the N-terminal fragment to form pro-ANP with a length of 126 amino acids. Finally, pro-ANP is cleaved to form ANP and N-terminal proANR [134]. N-terminal pro-ANP is further enzymatically degraded to several fragments, among which mid-regional proANP (MR-proANP) is formed [135]. MR-proANP contains 38 amino acid residues, has a molecular weight of 4 kDa, and circulates in the blood for about 2 h [3]. Thus, MR-proANP is considered as a stable surrogate biomarker for ANP.
MR-proANP is a diagnostic biomarker and an additive prognostic marker of HF [3,136]. The normal range of MR-proANP is 3.5–61.7 pM [137]. The concentration of MR-proANP lower than 85 pM excludes HF [4,138], and 120 pM is the cut-off for the diagnosis of AHF [139,140]. MR-proANP is recommended as a diagnostic marker for acute HF in the emergency department as an alternative to BNP and NT-proBNP to help differentiate acute HF from non-cardiac causes of acute dyspnea with a cut-off level 0.12 ng/mL [4,141].
Immunoassays are normally used to detect MR-proANP [132,136,142,143]. No aptamers for this peptide are isolated.

2.8. Copeptin

Arginine vasopressin (AVP), or the antidiuretic hormone (ADH), plays an important physiological and pathological role. Its main function is the regulation of fluid retention by the kidneys and the maintenance of homeostasis [144]. AVP levels out of normal range are associated with a number of diseases, in particular, HF [145]. However, the detection of AVP is hampered by two factors. First, more than 90% of AVP in the bloodstream is associated with platelets and, therefore, the total number of platelets in the blood and the quality of their precipitation during sample preparation have a significant impact on the accuracy of the analysis. Second, AVP is highly unstable in plasma [144]. AVP is a short peptide consisting of nine amino acids. It is synthesized as part of a preprohormone, which is enzymatically cleaved into AVP, neurophysin II, and copeptin. [146]. Copeptin is a 39-amino-acid glycosylated peptide cleaved from the C-terminus of proAVP. Thus, copeptin is produced in an amount equimolar to AVP. The physiological function of copeptin is unknown. Possibly, it takes part in the folding of vasopressin during the processing of the preprohormone AVP [147]. Copeptin is sufficiently stable in plasma even during long-term storage, which makes it possible to reliably determine it. Thus, copeptin can serve as a surrogate marker for AVP [146]. For healthy individuals and patients with inflammatory diseases, plasma copeptin levels range from 3 to 12 pM [148]. In the case of AMI, its level increases, and ranges from 26 to 160 pM [148]. Copeptin has a prognostic value for the acute stage of AMI, and correlates with the clinical outcome of CHF and AHF [143]. In combination with troponin, the detection of copeptin may be important for the choice of medical strategies [144,145,146,147,148,149] but, on the other hand, copeptin detection along with cTn provides little additive value [3]. Besides, copeptin level is increased with renal failure, and traumatic brain injury and sepsis [3].
Copeptin is detected with immunoassays [150,151,152,153,154,155]. No aptamers for copeptin are isolated, while the L-DNA aptamer for AVP is reported with a KD value of 1.2 μM [156]. Due to the absence of specific aptamers, copeptin is excluded from aptasensing platforms for biomarker detection.

2.9. Interleukin-6

Interleukin-6 (IL-6) is a prominent pro-inflammatory cytokine which regulates cell proliferation, differentiation, and maturation, and plays important role in the immune system and the systemic host defense response to injury [157,158]. IL-6 is a 26 kDa glycosylated protein produced by lymphocytes, neutrophils, eosinophils, B-cells, fibroblasts, mast cells, endotheliocytes, synovial fibroblasts, and macrophages [5,159,160]. Abnormal values of IL-6 are associated with a variety of pathological conditions such as cancer, autoimmune abnormalities, and inflammation [157]. The role of IL-6 in CVD conditions is discussed in special reviews [161,162]. The intracardial expression of IL-6 is activated in ACS and AMI. IL-6 is increased in left ventricular dysfunction (LVD) and CHF alongside with BNP. IL-6 contributes to the development of atherosclerosis [161,162]. IL-6 can serve as a mortality predictor in patients with advanced HF and AMI with cardiogenic shock [163,164]. A normal range of IL-6 is reported to be less than 0.7 pg/mL, rising to 15 ng/mL in HF and increasing even more up to 50 ng/mL with severe inflammation and sepsis [3]. The level of IL-6 in saliva correlates with systemic inflammation [165,166], though local oral inflammation also results in increased salivary IL-6 [167]. Urine levels of IL-6 modestly correlate with its plasma levels, and increased urinary IL-6 is associated with cardio-renal dysfunction indicating tissue-specific inflammation [168].
Several DNA aptamers binding IL-6 are reported. The first study on the isolation of IL-6 aptamer was published in 1995 and revealed the aptamers 5522 and 5523 with KD in a low micromolar range [169]. The specificity of the aptamers was not addressed, and aptamers 5522 and 5523 were not further applied for the sensing of IL-6, possibly due to poor target binding. A DNA aptamer of 57 nt was reported for the development of an EIS-based aptasensor for IL-6 from serum samples with high selectivity, without referring to the sequence origin [170]. Spiridonova et al. reported another selection of IL-6 aptamers which resulted in the isolation of an aptamer named 12L and its shortened variant 12S [171]. Though this research was not accomplished with non-binding control experiments and specificity studies, the 12L sequence was applied by other researchers for the aptasensor development [172,173]. Based on the 12L aptamer, Tertiş et al. developed an electrochemical aptasensor based on gold and polypyrrole nanoparticles for IL-6 detection in the range of 1 pg/mL–15 mg/mL. The sensor demonstrated good recovery in human serum samples suggesting a sufficient specificity of 12L [172]. Another electrochemical sensor employing a 12L aptamer was capable to detect IL-6 in a range from 1 fM to 100 pM [173]. In this research, non-binding DNA and non-binding protein controls were performed proving the specificity of the 12L aptamer [173]. A bioinformatics research paper describes the docking of experimentally derived DNA sequences to IL-6 [174]. Two potent aptamers, referred to as IL62 and IL63, were recognized, and their binding to IL-6 was qualitatively confirmed by SPR analysis. According to the computer modelling results, these aptamers seemed to bind nearly to the same region of IL-6, thus precluding the development of sandwich assays using them [174]. Later, IL62 was applied for the development of a SERS biosensor detecting mouse IL-6 in a 10 pM–100 nM range with an LOD of 0.8 pM from mouse serum [175]. Several papers describe the development of aptasensors relying on the proprietary aptamer sequences named ATW0077, ATW0082 and ATW0083, offered commercially by Base Pair Biotechnologies, Inc. [175,176,177,178,179]. The sandwich detection of IL-6 is possible using ATW0077/ATW0082 and ATW0077/ATW0083 pairs [176,177]. Base Pair Biotechnologies, Inc. indicate that these aptamers are developed to bind murine IL-6, and the corresponding research papers note the detection of mouse IL-6 as a target [175,178,179] or do not specify the source of the protein [176,177]. The sequence similarity of mouse and human IL-6 is 42% [180]. So far, the applicability of sandwich assays for human IL-6 detection using ATW0077, ATW0082 and ATW0083 aptamers is obscure. Finally, SOMAmers binding IL-6 are reported as its inhibitors [181,182]. No aptamer-based detection of IL-6 from biological fluids other than blood serum has been described.

2.10. C-Reactive Protein

C-reactive protein (CRP) is a 125 kDa homopentameric protein produced in liver hepatocytes and some other cell types in response to any inflammation including cardiac damage [3,183,184,185]. CRP is unspecific, but nevertheless it is rather well-established as a cardiac biomarker due to its significant contribution to the pathophysiology of CVD [183]. Elevated CRP levels correlate with the risk of atherothrombotic events [185]. CRP is a strong outcome predictor in AMI, ACS and HF [3]. Normal levels of CRP in the blood serum of healthy individuals are less than 10 ug/mL. Within the normal range, CRP concentration can be used for the risk stratification of CVD. Values less than 1 ug/mL are associated with low CVD risk, levels of 1–3 ug/mL are considered as a medium risk factor, and levels over 3 ug/mL are classified as high risk [186]. During AMI, CRP levels increase above 10 ug/mL. Severe inflammation is associated with CRP levels of about 200 ug/mL.
Laboratory diagnostics of CRP is based on immunological assays [187]. CRP can be detected from saliva, but saliva CRP level does not consistently correlate with its concentration in serum [188]. The detection of CRP in urine is more promising, as it is shown to correlate with serum concentration [189] and has a potential to serve as a predictor for clinical outcomes [189,190].
The number of aptamers targeting CRP is relatively high, possibly due to the widespread use of this biomarker in clinical diagnostics. Two RNA aptamers with KD values of 125 nM [191] and 2.25 nM have been selected for study [192]. The first one of these RNA aptamers was shown to be specific for CRP using HSA as a cross-target, but the serum assay using SPR biosensor with this aptamer was hampered strongly by IgE [191]. For the second RNA aptamer, no experimental data on its specificity have been provided. Several other DNA aptamers have been described. Aptamer CRP-80-17 characterized with KD of 3.9 nM was isolated using GO-SELEX by Yang et al. [193]. Its truncated version, named CRP-40-17, with a slightly higher KD (16.2 nM) but better selectivity is also available [193]. Immobilization via 3′-end was shown to provide a higher response in an SPR-based biosensor for CRP-40-17 [193]. A DNA aptamer named 6th-62-40 was identified using a microfluidic SELEX device [194]. The aptamer exhibited high selectivity to CRP, which was determined against IgG, HSA, Hb, transferrin and myoglobin. Its binding to CRP is characterized by a KD of 16.2 nM [194]. Another microfluidic aptamer selection experiment by Huang et al. against CRP resulted in a DNA sequence referred to as Clone 1 (KD value is 3.51 nM) [195]. Its specificity was not examined carefully; an SPR sensor using a Clone 1 aptamer and a CRP-specific antibody was claimed to display high specificity, but no experimental evidence was provided, as the paper was mostly devoted to the development of a microfluidic SELEX chip rather than aptamer validation [195]. Nevertheless, the sensor employing the aptamer Clone 1 was shown to provide good CRP detection in comparison to the established CRP assays from real samples, including whole blood [196]. Another sequence of a CRP-specific aptamer was reported to be derived from the microfluidic SELEX performed by Huang et al. [197,198,199] but, in fact, differed from Clone 1 in the central region and was not presented in the original paper [195]. So far, no KD has been reported for this aptamer, but several sensors employing it display low LOD, wide linear detection range, good specificity for CRP [197,198,199], and can detect CRP in serum, urine, and saliva [197]. Lai and Hong proposed an interesting protocol employing magnetic fields for aptamer isolation [200,201,202]. These works resulted in the development of several DNA aptamer sequences with KDs in low nanomolar range, capable of detecting CRP in serum equally to antibodies in ELISA assays [202,203]. Two more DNA aptamers for CRP have been reported for biosensor development without referring to aptamer isolation details. The one produced by OTC Biotech with a length of 20 nt was applied for the SRP-based detection of CRP using an antibody–aptamer sandwich with an LOD of 7 zM (5 fg/mL) [203]. The second one was used for the development of a cell-based biosensor for in vivo CRP detection [204]. No binding characteristics of individual aptamers are available in the literature [203,204]. Finally, the aptamers containing modified nucleobases targeting CRP are described with KD values of 4 nM (SOMAmer) [205] and 6.2 pM [206]. Thus, at least 17 CRP aptamers are published.
The aptamer-based biosensors for CRP detection have been described and classified in a recent review [207]. The number of papers reporting aptasensors based on a wide range of detection platforms amount to about one hundred. Most of them ensure sufficient LODs, dynamic ranges, and specificity for clinical application in diagnostics. The sensors capable of detecting CRP in whole blood [196,207], saliva [197,206], and urine [197,208] are described. Surprisingly, a single study describes the sandwich assay using two different aptamers [209], and no information on their sequence is provided. So far, aptamer-based sandwich assays for CRP are unavailable, though various antibody–aptamer sandwich assays have been developed [194,195,196,203]. The benefits of sandwich-type assays are well illustrated by Wu et al. [194]. The SPR sensor using the 6th-62-40 aptamer was developed in three variants assuming the direct detection of CRP by the aptamer, the sandwich detection of CRP by the aptamer, the CRP-specific antibody, and the sandwich detection of the aptamer and the CRP-specific antibody with signal amplification, providing LODs of 1, 0.1 nM, and 10 pM, respectively. Moreover, the best zeptomolar LOD of CPR aptasensors was also obtained using sandwich detection [203].
The DNA aptamers CRP-40-17 [193], 6th-62-40 [194], Clone 1 [195], and an oligonucleotide referenced in [197,198,199] exhibit the highest potential for the clinical detection of CRP in the future, because of their good KD values and specificity. The search for aptamer sandwich combinations targeting CRP is required.

2.11. Tumor Necrosis Factor Alpha

Tumor necrosis factor alpha (TNFα) is a cytokine which acts as an intercellular chemical messenger in inflammatory processes. It is produced by a variety of cells, mostly immune, but also neural, skin, and endothelial, in a form of transmembrane TNFα, which is then cleaved by a specific enzyme to release soluble TNFα [210]. Both transmembrane and soluble forms of TNFα are biologically active as homotrimers, with a molecular weight of 51 kDa, and each subunit being of 17 kDa [211]. Playing a primary role in immune regulation, it poses an influence on many other physiological pathways [5] including vascular function [212]. Increases in TNFα level are associated with vascular inflammation, oxidative stress, atherosclerosis, thrombosis, vascular remodeling, and endothelium apoptosis [212]. TNFα cannot serve for diagnostics of CVDs because its level is increased in almost any inflammatory condition, but it can be used as a mortality predictor in HF [3,163]. TNFα level depends on age and sex [163]: a normal range is reported to be 0.7 ± 0.3 pg/mL [213]. Levels of TNFα in the range of 1–10 pg/mL is detected in MI and HF [3]. TNFα can be detected in saliva, but salivary level and its correlation to blood concentration in CVD have not yet been studied [214]. TNFα concentration in urea was shown not to differ significantly in patients with severe CHF, making the detection of TNFα in urea a possible practical instrument for the non-invasive diagnosis of CVD [215].
Several DNA aptamers and one RNA aptamer targeting TNFα are known, and most of them were introduced as TNFα inhibitors for anti-inflammatory therapy [216,217,218,219,220]. The VR11 aptamer is one of the most popular DNA ligands, and its binding to TNFα is characterized by the KD value of 7 nM [216]. VR11 inspired the development of biosensors for electrochemical [221,222], FET-based [223], and the optical [224,225] detection of TNFα. The conjugation of the VR11 aptamer with the TNFα-specific antibody is often used to design sandwich detection schemes [221,225]. An RNA aptamer named T3.11.7 [220] has also been applied for the electrochemical detection of TNFα [226,227]. Two more DNA aptamers with a length of 41 [218] and 49 nt (T1-4) [219] have not been applied for sensing yet, but have proved TNFα binding and are potent TNFα inhibitors. The T1-4 ligand is, in fact, a dimer of two shorter aptamers named T1 and T4, which are assumed to bind different sites in the TNFα structure [219], and thus show promising potential for dual-aptamer sandwich application. An isolation of the aptamer S01 binding to TNFα with KD of 0.19 nM is described in [228]. S01 is reported to be superior to the VR11 aptamer and the TNFα-specific antibody mAb11 in terms of affinity and the efficiency of target detection in serum using the ELISA protocol [228]. Surprisingly, we did not find the aptasensors for TNFα employing this aptamer. Finally, an electrochemical biosensor for TNFα with good analytical characteristics is described which engages a unique DNA aptameric sequence [229]. The origin of this aptamer is not specified or referred to.
In summary, the range of established aptamers for TNFα is wide enough, but these aptamers have resulted in few aptasensors. The developed sensors mostly exhibit LOD and linear ranges suitable for real TNFα measurement. Aptasensors are reported to detect TNFα in whole blood [226,227] and serum [221,228]. No dual-aptamer sandwich assays have been reported and no detection of TNFα from the urine or saliva using these aptamers has been described. VR11 [216] and S01 [228] DNA aptamers for TNFα are the most perspective for analytical application. VR11 is well established for TNFα sensing, and S01 exhibits the best KD value. T1 and T4 aptamers are of specific interest for the development of sandwich assays.

2.12. Galectin-3

Galectin-3 is a carbohydrate binding protein that plays many important regulatory roles in inflammation, immunity, and cancer. Recent studies demonstrates that Galectin-3 overexpression and secretion is associated with several diseases, and it is extensively studied in the context of fibrosis, HF, atherosclerosis, and diabetes mellitus [230]. Regarding HF, the increase in concentration is associated with an increased risk of mortality. The first data about Gal-3 circulating levels and HF were generated using ELISA [231]. Today, Gal-3 measurements are performed by commercial automated immunoassays [232]. The Gal-3 concentrations range, in healthy individuals, from 6.9 to 20.8 ng/mL [233]. Independent of symptoms and other laboratory investigations, levels of Gal-3 higher than 25.9 ng/mL predict a patient who is likely to have a rapid progression of HF with a very high risk of hospitalization and death [234]. However, successful treatment is associated with decreasing Gal-3 levels [235], indicating that Gal-3 control has a potential to be integrated into the management of patients with HF. Salivary levels of Gal-3 moderately correlate with serum levels and are significantly increased in patients with HF. The risk of cardiovascular death or hospitalization is strongly increased if the salivary level of Gal-3 is higher than 172.58 ng/mL [214].
To date, no aptamers with affinity to Gal-3 have been found, and the emergence of new aptamer-based methods is a matter of the near future. Moreover, recent studies indicate that Gal-3 is involved in cardiovascular fibrosis as a regulatory molecule in HF [230,236] and, thus, the development of aptamers for Gal-3 inhibition may be a promising direction in findings new drugs.

2.13. Soluble Suppression of Tumorigenicity 2

The suppression of tumorigenicity 2 (ST2) belongs to the IL-1 receptor family and exists as two important isoforms: transmembrane (ST2L) and soluble (sST2), which are produced by alternative splicing [237,238]. The transmembrane form binds to IL-33, the cytokine that is secreted by cells in response to tissue damage and has a cardioprotective effect. The soluble form acts as a decoy receptor, limiting the pro-inflammatory action of IL-33 [239]. When circulating sST2 levels are elevated, the cardioprotective action of IL-33 is reduced [240]. Hence, sST2 is a biomarker of vascular health with diagnostic and/or prognostic value in various CVDs, including coronary artery disease, MI and atherosclerosis [241]. sST2 was found to be a strong, independent predictive factor for HF and also to improve risk stratification accuracy for HF events in combination with NT-proBNP and troponin T [240,242]. A. Aleksova et al. proposed a practical tool based on sST2-assisted flowcharts in order to aid emergency medicine physicians to determine three common clinical scenarios [243]. Though IL-33 can be detected in the blood, saliva and urine, only serum values of sST2 can be derived from the scientific literature. The cut-off value of 35 ng/mL is the most frequently reported for HF, whereas the study discloses that the risk of all-cause death, cardiovascular death, and HF hospitalization increases exponentially with sST2 levels higher than 28 ng/mL [244,245,246]. sST2 level depends on sex and lower cut-offs for risk stratification could be used for women [247]. In order to aid the prognosis of HF at the point of care, a duplex platform targeting BNP and sST2 was developed [4,248]. Still, the most common method for sST2 measurement is the ELISA assay, although it is not clear which epitopes are detected by the antibodies against sST2 [249].

2.14. Growth Differentiation Factor 8 (Myostatin)

Myostatin (growth differentiation factor 8, GDF8), a cytokine from the transforming growth factor-β (TGF-β) family, inhibits skeletal muscle growth [250,251]. GDF8 active protein is a 25 kDa homodimer expressed in skeletal muscle and in heart and adipose tissue [250,252]. Myostatin expression in cardiomyocytes is increased in patients with HF [252] and AMI [253], and myostatin concentration in plasma positively correlates with cTnI [254] and natriuretic peptide [255] levels. Besides, the elevation level of myostatin reflects the extent of cardiac damage and correlates with adverse disease outcomes [254,255,256]. GDF8 level in healthy people is 10–80 ng/mL, and in CHF this is increased to 30–105 ng/mL [3]. On the other hand, myostatin serum levels in non-cardiac ICU patients are shown to negatively correlate with markers of systemic inflammation, including CRP and IL-6 [257] and, in this case, lower GDF8 levels of about 10 ng/mL are a predictor of unfavorable prognosis [3,257]. The detection of GDF8 from saliva or urine is not reported.
Common myostatin measurement is based on immunoassays [255,256,257,258]. The high structural similarity of GDF8 and GDF11, proteins of the TGF-β family, encumbers the accurate detection of myostatin [259]. The SOMAmer binding both GDF8 and GDF11 has been reported [260]. Recently, it was established that SOMAmers could selectively bind to each of these proteins [261]. No other aptamers except SOMAmers are known to bind myostatin.

2.15. Growth Differentiation Factor 15

Growth differentiation factor 15 (GDF15) is a stress-responsive cytokine which belongs to the TGFβ family. It is a 25 kDa homodimer in which the monomers are linked by a disulfide bond [262]. GDF15 is abundantly expressed in the liver, intestine, kidneys, and placenta [263]. In the heart, the expression of GDF15 is normally low but increases in response to cardiovascular injury induced by pressure overload, HF, ischemia–reperfusion injury, and atherosclerosis [263,264,265]. Increases in GDF15 are also associated with a large variety of diseases including inflammation, cancer, and obesity [265]. GDF15 seems to exhibit protective and anti-inflammatory effects in pathological processes including CVD, though the detailed biochemical mechanism of its functioning is still under investigation [262,263]. GDF15 is proposed to serve as a biomarker of disease progression [263,264,265]. GDF15 is associated with unfavorable prognosis in CVD [263]. Normal GBF15 level is 0.1–1.2 ng/mL. Levels of 1.2–1.8 ng/mL are considered moderately elevated, levels higher than 1.8 ng/mL−1 are considered severely elevated, reaching 47 ng/mL in patients with severe diseases [3].
GDF15 detected from saliva could not discriminate between patients with AMI and healthy controls, and no correlation between salivary and serum GDF15 was detected [266]. The studies of urinary GDF15 levels demonstrate its association with blood concentration, but were conducted for the patients with renal dysfunction [267,268,269,270].
The SOMAmer-based assay has been reported for GDF15 detection [271], although no other aptamers have been identified.
Table 1. Aptamers for cardiac biomarkers.
Table 1. Aptamers for cardiac biomarkers.
BiomarkerAptamer Name,
Type,
Length
Aptamer Sequence, 5′-3′ DirectionKDMethod for Affinity EstimationReference
cTnITro4,
DNA,
40 nt
CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTA270 pMSPR[20]
Tro6,
DNA,
40 nt
CGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC317 pMSPR[20]
TnIApt23,
DNA
No sequence published2.7 nMFluorescence[36]
TnIApt19,
DNA
No sequence published6.3 nMFluorescence[36]
TnIApt18,
DNA,
79 nt
GCCTGTTGTGAGCCTCCTAACTACATGTTCTCAGGGTTGAGGCTGGATGGCGATGGTGGCATGCTTATTCTTGTCTCCC9 nMFluorescence[36]
TnIApt11,
DNA,
79 nt
GCCTGTTGTGAGCCTCCTAACTTCAAGGTGTGGTCAGTCTTGGATTGGAGGAGTATGNGCATGCTTATTCTTGTCTCCC10.25 nMFluorescence[36]
TnI2,
DNA,
72 nt
GGCAGGAAGACAAACACCCAACCGAGGATGCAACGCTTGTTGTCATACTGTGATGTTGGTCTGTGGTGCTGT19.8 nMSPR[39,40]
Apt 3,
DNA,
96 nt
CGTACGGTCGACGCTAGCCGGACACCCAAGTCAGACGTGCCCATTATCGCGCGATACGTATTATTTCTTGCTCGGGGCCACGTGGAGCTCGGATCC1.01 nMELONA[41]
Apt 6,
DNA,
96 nt
CGTACGGTCGACGCTAGCCCGGAGCGAAGGCGGCCCCGTTTGCGTGCAGCGTAGTCTGTAGACAACAGTGCTGTGGGCCACGTGGAGCTCGGATCC0.68 nMELONA[41]
A4,
L-DNA,
76 nt
AGTCTCCGCTGTCCTCCCAGTGCAGGCTGAGTGGGTGGGTGGGTGGTGTGGCCACGTTGGGATGACGCCGTGACTG3.5 nMSPR[18]
B10,
L-DNA,
76 nt
AGTCTCCGCTGTCCTCCCGATGCACTTGACGTATGTCTCACTTTCTTTTCATTGACATGGGATGACGCCGTGACTG10.7 nMSPR[18]
A6,
L-DNA,
76 nt
CAGTGAGTGATGGTGAGGGCTTAGTTCGCCGCTCATGCCGAATCTCCTGTATAAATACCCACACTGTCCATACACG540 pMSPR[42]
C6,
L-DNA,
76 nt
CAGTGAGTGATGGTGAGGGTGAATCGGTGTCGACTATTAAATTAAGTTGTGGTTGTTCCCACACTGTCCATACACG305 pMSPR[42]
DNA,
28 nt
CCAATGCAGTGGGGAGGGACTGCGTTGGnd *nd[47]
biotin-apta,
DNA,
80 nt
TTCAGCACTCCACGCATAGCTCAGCCGGCAATGAACAACCTCCATTCTAACGCAGTGTTACCTATGCGTGCTACCGTGAAndnd[48]
TnAp1,
DNA,
80 nt
GGCAGCAGGAAGACAAGACATGGGTGGCGGGGACGGGGCGATGGGAACTTAGATTGCTAGTGGTTCTGTGGTTGCTCTGT61.51 nMBioluminescence[46]
TnAp2,
DNA,
80 nt
GGCAGCAGGAAGACAAGACAGGCAGTGTCACGCGCTCAAGGGTGGAGGGGTCGGGGAGGTTGGTTCTGTGGTTGCTCTGT42.01 nMBioluminescence[46]
TnAp4,
DNA,
80 nt
GGCAGCAGGAAGACAAGACACAACGCATGGGTGGGACGACGGGTGGGCAAGAGACACGCCTGGTTCTGTGGTTGCTCTGT167.1 nMBioluminescence[46]
TnAp5,
DNA,
80 nt
GGCAGCAGGAAGACAAGACACACGGGAGGGAGGGTAGGGTGTGTGTCGAATCACTGCGCATGGTTCTGTGGTTGCTCTGT255.7 nMBioluminescence[46]
TnAp10,
DNA,
80 nt
GGCAGCAGGAAGACAAGACACCACATCTATGGGTGGGACGATGGGTGGGCCGAAACGACCTGGTTCTGTGGTTGCTCTGT121.4 nMBioluminescence[46]
TnAp12,
DNA,
80 nt
GGCAGCAGGAAGACAAGACATCGGGAGGGAGGGAGGGCAGTCTAGTCTCATGTGTTTCCATGGTTCTGTGGTTGCTCTGT24.16 nMBioluminescence[46]
TnAp14,
DNA,
80 nt
GGCAGCAGGAAGACAAGACACTACCCATACACTTAGGGACGGGTGGCCGGGGAGGGAGGTTGGTTCTGTGGTTGCTCTGT79.04 nMBioluminescence[46]
TnAp2t1,
DNA,
40 nt
GGCAGTGTCACGCGCTCAAGGGTGGAGGGGTCGGGGAGGT39.06 nMBioluminescence[46]
TnAp2t2,
DNA,
54 nt
AGACAAGACAGGCAGTGTCACGCGCTCAAGGGTGGAGGGGTCGGGGAGGTTGGT24.93 nMBioluminescence[46]
TnAp2t3,
DNA,
27 nt
GCTCAAGGGTGGAGGGGTCGGGGAGGT30.6 nMBioluminescence[46]
DNA,
55 nt
No sequence publishedndnd[49]
DNANo sequence publishedndnd[50]
cTnTTro 4,
DNA,
40 nt
CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTAndnd[57,58]
Apt.1,
DNA,
71 nt
ATACGGGAGCCAACACCAGGACTAACATTATAAGAATTGCGAATAATCATTGGAGAGCAGGTGTGACGGAT122 nMSPR[59]
Apt.2,
DNA,
71 nt
ATCCGTCACACCTGCTCTCCAATGATTATTCGCAATTCTTATAATGTTAGTCCTGGTGTTGGCTCCCGTAT190 nMSPR[59]
AraHH001,
DNA,
40 nt
ACGTACCGACTTCGTATGCCAACAGCCCTTTATCCACCTC43 nMFlowcyto-
metry
[61,62]
MbMyo40-7-27,
DNA,
40 nt
CCCTCCTTTCCTTCGACGTAGATCTGCTGCGTTGTTCCGA4.93 nMSPR[75]
Myo40-7-69,
DNA,
40 nt
CGAGTACTTCTTTGCTAGTTCGCGAGATACGTTGGCTAGG6.38 nMSPR[75]
Myo40-7-34,
DNA,
40 nt
ACGCACAATTCCTTGTCCAATTAGGAAATTCTACGCGGAT5.58 nMSPR[75]
Mb 089,
DNA,
72 nt
ATCCGTCACACCTGCTCTTAATTACAGGCAGTTCCACTTAGACAGACACACGAATGGTGTTGGCTCCCGTATndnd[80]
ST1,
DNA
No sequence published65 pMSPR[81]
DNA,
78 nt
ATCCAGAGTGACGCAGCACAACGTGCAAATTATACCTGTTTTCCCCTTTTCCTACAAGTGCTATGGACACGGCTTAGT65 pMnd[83]
CK-MBC.Apt.21,
DNA,
45 nt
GGGGGGTGGGTGGGGGATCTCGGAGGATGCTTTTAGGGGGTTGGG0.81 nMELONA[96]
C.Apt.30,
DNA,
43 nt
CATTGAGAGGGGGTGGCCGTAGTCAGGTGGGTGGGGGTTTGAG24.04 nMELONA[96]
hFABPN13,
DNA,
90 nt
CACCTAATACGACTCACTATAGCGGATCCGAAGGGGGCGCGAGGTGTAAGGGTGTGGGGTGGTGGGTGGGCCTGGCTCGAACAAGCTTGC74.3 nMCD[101]
N53,
DNA,
90 nt
CACCTAATACGACTCACTATAGCGGATCCGAGGGGGTAGCGGGTGGGCCGGTG_GATGCGGGGCGCCGGCGCCTGGCTCGAACAAGCTTGC333.7 nMCD[101]
BNPA10,
DNA,
40 nt
GGCGATTCGTGATCTCTGCTCTCGGTTTCGCGTTCGTTCG12 nMFluorescence[121]
A8,
DNA,
40 nt
CGAAATACACAGCCAGGACTGGAGGGCAAGGGTAACGAGC139.4 nMFluorescence[121]
A11,
DNA,
40 nt
TGAGCCCGGGACAGAGAGACCGGACCACGTGCCCGGGCC28 nMFluorescence[121]
A14-1,
DNA,
40 nt
ATAACGACATCCGCCGGCACGAAGGGATCAAGTCGATAGG22.4 nMFluorescence[121]
A14-5,
DNA,
40 nt
CCCGTGCTTTGGCCCTCCATGCAGCCTTGAGCCTATGCC104.6 nMFluorescence[121]
8–12,
DNA,
50 nt
TAAACGCTCAAAGGACAGAGGGTGCGTAGGAAGGGTATTCGACAGGAGGCTCACAndELONA[115]
2F,
DNA,
72 nt
ATACGGGAGCCAACACCATGGTGGGTACTACCCTTAAAAACATCGCCCCCTACGAGAGCAGGTGTGACGGATndELONA[120]
6R,
DNA,
72 nt
ATCCGTCACACCTGCTCTCGTAGGGGGCGATGTTTTTAAGGGTAGTACCCACCATGGTGTTGGCTCCCGTATndELONA[120]
14bF,
DNA,
72 nt
ATACGGGAGCCAACACCACCTATTACAGACCCAATTTCCACCTGGCATTTCTATAGAGCAGGTGTGACGGATndELONA[120]
25cF,
DNA,
72 nt
ATACGGGAGCCAACACCACCTCTCACATTATATTGTGAATACTTCGTGCTGTTTAGAGCAGGTGTGACGGATndELONA[120]
NT-proBNPN20a,
DNA,
72 nt
GGCAGGAAGACAAACAGGTCGTAGTGGAAACTGTCCACCGTAGACCGGTTATCTAGTGGTCTGTGGTGCTGT2.89 nMSPR[39,123]
IL-65522,
DNA,
59 nt
CTCATAAGTCGTTGCAACCCCGTGCGCATGGACTGATCTTCCGCLGAATCACGAGGGTA6.15 µMGMSA[169]
5523,
DNA,
56 nt
CCTCACGAACCATGATCACGCACCAACCAGGCCGTGTTAAAGAGGGCACACTGTAT1.25 µMGMSA[169]
DNA,
57 nt
GTCTCTGTGTGCGCCAGAGACACTGGGGCAGATATGGGCCAGCACAGAATGAGGCCCndnd[170]
12L,
DNA,
31 nt
GGTGGCAGGAGGACTATTTATTTGCTTTTCT17 nMSPR[171]
12S,
DNA,
16 nt
GGTGGCAGGAGGACTA190 nMSPR[171]
IL62,
DNA,
30 nt
CTTCCAACGCTCGTATTGTCAGTCTTTAGTndnd[174]
IL63,
DNA,
30 nt
CTTCCGTGAAACCAACGTGCCCTCAATCCGndnd[174]
ATW0077,
DNA,
32 nt
No sequence published5.4 nMnd[178,179]
ATW0082No sequence publishedndnd[176]
ATW0083No sequence publishedndnd[177]
CRPDNA,
20 nt
GGGCCTCCGGTTCATGCCGCndnd[203]
DNA,
72 nt
GGCAGGAAGACAAACACACAAGCGGGTGGGTGTGTACTATTGCAGTATCTATTCTGTGGTCTGTGGTGCTGTndnd[204]
CRP-80-17,
DNA,
80 nt
AGCAGCACAGAGGTCAGATG CCCCCGCGGGTCGGCTTGCCGTTCCGTTCGGCGCTTCCCC CCTATGCGTGCTACCGTGAA3.9 nMSPR[193]
CRP-40-17,
DNA,
40 nt
CCCCCGCGGGTCGGCTTGCCGTTCCGTTCGGCGCTTCCCC16.2 nMSPR[193]
6th-62-40
DNA,
40 nt
CGAAGGGGATTCGAGGGGTGATTGCGTGCTCCATTTGGTG16.2 nMSPR[194]
Clone 1
DNA,
72 nt
GGCAGGAAGACAAACACGATGGGGGGGTATGATTTGATGTGGTTGTTGCATGATCGTGGTCTGTGGTGCTGT3.51 nMSPR[195]
DNA,
72 nt
GGCAGGAAGACAAACATATAATTGAGATCGTTTGATGACTTTGTAAGAGTGTGGAATGGTCTGTGGTGCTGTndnd[197,198,199]
CRP1-1
RNA,
104 nt
GGGCGAAUUCGGGACUUCGAUCCGUAGUACCCACCAGGCAUACACCAGCACGCGGAGCCAAGGAAAAAUAGUAAACUAGCACUCAGUGCUCGUAUGCGGAAGCU2.25 nMSPR[192]
RNA,
44 nt
GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC125 nMnd[191]
F27K-4
DNA,
60 nt
AGCAGCACAGAGGTCAGATGGCCCCCGAAGTTGCTTAGTCCCTATGCGTGCTACCGTGAA22.71 nMqPCR[200]
>27K-1
DNA,
60 nt
AGCAGCACAGAGGTCAGATGTCTGTAATTTATAGTTCCATCCTATGCGTGCTACCGTGAA7.65 nMqPCR[200]
20N AC > 200 K
DNA,
60 nt
AGCAGCACAGAGGTCAGATGAATTACAAATTTGGACTGTTCCTATGCGTGCTACCGTGAA8.35 nMqPCR[201]
20N AC F200K-1
DNA,
60 nt
AGCAGCACAGAGGTCAGATGGCATTGTATCACAGGTACTGCCTATGCGTGCTACCGTGAA12.49 nMqPCR[201]
sOS-AC-20N-1
DNA,
60 nt
AGCAGCACAGAGGTCAGATGGATACCAAGGTCCGCTGGTTCCTATGCGTGCTACCGTGAA5.96 nMqPCR[201]
OS-AC-20N-3
DNA,
60 nt
AGCAGCACAGAGGTCAGATGCGCTTGTGATGGGTGATGGGCCTATGCGTGCTACCGTGAA5.70 nMqPCR[201]
PF20N-RO-MARAS-84-1
DNA,
20 nt
GTTGACGGGCGATTGGTCTT23.58 nMqPCR[202]
TNFαDNA,
41 nt
GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC8 nMqPCR[218]
VR11,
DNA,
25 nt
TGGTGGATGGCGCAGTCGGCGACAA7 nMSPR[216]
T3.11.7,
2′-NH2-RNA,
28 nt
GGAGUAUCUGAUGACAAUUCGGAGCUCCndELONA[220]
T1-4,
DNA,
49 nt
TCCGATCGGTATATCCGTCGGATTTTTTTTTTGGTCACTGCATGTGACC67 nMCell cytotoxicity assay[219]
T1,
DNA,
17 nt
GGTCACTGCATGTGACC195 nMCell cytotoxicity assay[219]
T4,
DNA,
22 nt
TCCGATCGGTATATCCGTCGGA142 nMCell cytotoxicity assay[219]
S01,
DNA,
81 nt
ATCCAGAGTGACGCAGCATGCTTAAGGGGGGGGCGGGTTAAGGGAGTGGGGAGGGAGCTGGTGTGGACACGGTGGCTTAGT0.19 nM in buffer
0.27 nM in serum
FACS[228]
B01,
DNA,
80 nt
ATCCAGAGTGACGCAGCAGGTTAAGGTGTAGGTCCGGGTGGGGGGGTGGGTTGGGGGACTGGTGGACACGGTGGCTTAGT0.35 nMFACS[228]
DNA,
33 nt
GCGGCCGATAAGGTCTTTCCAAGCGAACGAAAAndnd[229]
* no data.

3. SOMAmers Targeting Cardiac Biomarkers

Being systematically developed by L. Gold’s group, SOMAmers were developed for a few thousand protein targets [272,273], with almost all the above-discussed cardiac biomarkers being among them [274], with the possible exception of neurohumoral markers (copeptin, MR-proADM, MR-proANP) as we did not find any mention of these in the scientific literature. SOMAscan is a commercial solution in which SOMAmers are used to analyze their targets in a sample [274]. SOMAscan is now applied as a high-throughput proteomics platform for the recognition of biomarkers based on the qualitative comparison of disease and control cohorts’ inputs, but it has potential for the quantitative measurements of biomarkers [274,275]. We did not include SOMAmer sequences, which are published for some biomarkers such CRP or IL-6, in this review, mainly due to the complexity of their synthesis. Regardless, the existence and success of SOMAscan solutions encourage the future real implementation of aptamers to routine diagnostics and medicinal research.

4. Future Research Directions

Aptamers have a real potential to displace antibodies in routine biochemical assays in the future but, today, aptamer-based detection is rather far from real practical implementation, at least regarding cardiovascular biomarkers. Table 2 illustrates the current state of aptamer research in respect to the detection of CVD biomarkers discussed in this review. DNA aptamers for cardiac biomarkers are prevalent over RNA ones. The primary reason for this seems to be due to the less laborious protocol for DNA aptamer isolation compared to RNA. However, DNA is more convenient for analytic purposes because of its higher thermal and nuclease stability, accompanied by a lower synthesis cost.
For cTnI, cTnT, myoglobin, CK-MB, BNP, NT-proBNP, IL-6, CRP, and TNFα, the aptamers are known which enable the detection of these biomarkers in clinically relevant ranges with good specificity. For HFABP, the existing aptamers do not allow detection in clinical ranges. No DNA/RNA aptamers are known for MR-proADM, MR-proANP, Copeptin, sST2, Gal3, GDF8, or GDF15. This restricts the transition from antibodies to aptamer-sensing platforms.
Dual-aptamer-based sandwich detection is available for cTnI (Tro 4 + Tro 6 and Apt 3 + Apt 6 are the best choices), cTnT, and CK-MB. For myoglobin, a split aptamer sensing strategy has been developed. This assay cannot serve for detection schemes assuming separated binding and detection steps such as ELONA, because a single part of a split aptamer cannot bind the target. The dual-aptamer sandwich assay for HFABP needs further development to improve its dynamic range. The sandwich assay for BNP lacks selectivity. For IL-6, both known aptamer pairs were initially developed for murine protein, and its application for human IL-6 is not obvious. The sequences of the aptamers used for CRP sandwich detection have not been provided. So far, dual-aptamer-based sandwich assays are unavailable for most cardiac biomarkers, while sandwich-type assays offer a strong basis for the universalization of single-analyte detection and for simultaneous multiple-target detection.
The detection of cardiac biomarkers from saliva, urine, and whole blood, in addition to serum, is demanded for POC testing. As derived from the literature, sensing from the saliva, in respect to CVDs, makes sense for troponins, myoglobin, CK-MB, BNP, NT-proBNP, and Gal-3, while detection from urine is appropriate for CRP. Among these biomarkers, troponins and BNP/NT-proBNP are of special interest for POC testing because these are the most popular biomarkers which can serve for diagnostics in acute settings. Aptamer-based detection from saliva is demonstrated only for troponins and myoglobin. The aptasensing of CRP from urine has also been described. The detection of BNP and NT-pro-BNP from saliva needs to be accomplished in the future. The practical implementation of aptamer-based POC devices appears to promise success in the near future; however, in this field, more efforts are required to gain knowledge of non-invasive CVD biomarker detection. This poses the need for both aptamer and medicinal research.
Aptamer-based assays for some popular cardiac biomarkers, such as cTnI, are offered within a huge variety of detection platforms, but the practical implementation of aptamer assays to diagnostics relies, firstly, on the unification of the detection platform and analysis schemes for the wider range of biomarkers, rather than on their diversification, as this can be learned from SOMAscan products and the commercial immunoassays normally used in laboratory detection.
So far, the following research directions can be derived to fulfill the gaps in the aptamer-based sensing of cardiac biomarkers:
  • The development of novel aptamers binding to MR-proADM, MR-proANP, Copeptin, sST2, Gal3, GDF8, and GDF15. During aptamer selection, specificity should be addressed using correct negative and counter targets, which should include proteins with similar structures, other biomarkers known to increase in the same disease conditions, and the most abundant proteins in the medium desired for detection, e.g., albumins and globulins for the detection from serum. Selection conditions should maximally imitate the intended aptamer usage;
  • The characterization of novel—and some already existing—aptamers. This includes the confirmation of binding, for which using several different methods is desired, the evaluation of cross-specificity, and the study of the influence of the experimental conditions on the aptamer–target binding (pH, buffer composition, temperature);
  • The development of sandwich detection assays based on aptamers. For this purpose, the existing aptamers can be systematically paired for the evaluation, and novel aptamers can be isolated using specific selection procedures intended to develop the aptamers recognizing different binding sites of the same target;
  • The characterization and validation of aptamer-based assays. LOD and dynamic detection ranges of sensors must allow the detection of biomarkers in clinically relevant ranges. The detection of the targets from real samples is strongly recommended, and the results should be compared with the validated alternative assays. The performance of the aptamer-targeting cardiac biomarkers from different biological fluids (saliva, urine, whole blood) is of specific interest for the development of POC biosensors. The range of analytical targets for the same analysis scheme should be maximally extended, because the universal assay platforms allowing the detection of multiple biomarkers within single or parallel measurements are required both for laboratory instrumental diagnostics and POC devices;
  • The implementation of the developed aptamer-based assays to clinical studies, alongside the validated assays. The assays should be carefully characterized with specificity, sensitivity, and accuracy. The cut-off levels for each assay should be examined individually, as their values may differ for different assays in some cases. Moreover, the combination of multiple biomarkers is an increasing trend in diagnostics and prognostics, and especially for the risk stratification of CVDs. Aptamer-based multiple-biomarker detection should be implemented more intensively to respective clinical studies;
  • Further medicinal research of salivary CVD biomarkers. The detection from saliva is a very attractive non-invasive method of CVD diagnostics using aptamers, but some pitfalls associated with saliva collection, storage, and analysis exist, which impede the routine use of saliva in clinical practice [19,214,276]. Aptamer-based assays specifically developed to detect cardiac biomarkers from saliva can assure the required sensitivity to measure lower biomarker concentrations in saliva compared to serum, and can thus assist to establish cut-off levels;
  • The further development and promotion of aptamer-based POC devices. Such devices should have low cost, convenient and affordable signal read-outs (such as visual or smartphone-assisted detection), and easy result interpretation for the unexperienced end-user. Both diagnostics and risk assessment devices are in demand.
We believe that overcoming these experimental issues will result in the real practical implementation of aptamers to routine clinical diagnostics.

5. Conclusions

A lot of effort in the field of aptamer research has resulted in the development of aptamer-based detection for cardiac biomarkers. This research is non-uniformly distributed among the known CVD biomarkers, with excessive respect to troponins, and lacking attention given to some other biomarkers such as neurohormones. The selection of novel aptamers and the development of aptasensors employing a universal detection scheme for the analysis of a wider range of biomarkers are required to assist the future expansion of aptamers and aptamer-based sensing to practical usage in clinical diagnostics and medicinal research.

Author Contributions

Conceptualization, N.K.; methodology, N.K., O.P. and A.T.; validation, N.K.; investigation, N.K., O.P., A.T. and A.K.; resources, N.K. and A.K.; data curation, N.K.; writing—original draft preparation, N.K., O.P. and A.K.; writing—review and editing, N.K. and A.K.; visualization, A.K.; supervision, N.K. and A.K.; project administration, N.K. and A.K.; funding acquisition, N.K. All authors have read and agreed to the published version of the manuscript.

Funding

The study was supported by the Russian Science Foundation grant No. 21-79-10175, https://rscf.ru/project/21-79-10175/ (accessed on 6 May 2020).

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

ACSacute coronary syndrome
ADHantidiuretic hormone
ADMadrenomedullin
AMIacute myocardial infarction
ANPatrial natriuretic peptide
AVParginine vasopressin
BNPB-type natriuretic peptide
BSAbovine serum albumin
CHDcoronary heart disease
CHFcongestive heart failure
CKcreatine phosphokinase
CRPC-reactive protein
cTnIcardiac troponin I
cTnTcardiac troponin T
CVcyclic voltammetry
CVDscardiovascular diseases
DNAdeoxyribonucleic acid
DPVdifferential pulse voltammetric
EISelectrochemical impedance spectroscopy
ELISAenzyme-linked immunosorbent assay
ELONAenzyme-linked oligonucleotide assay
FETfield-effect transistor
FICAfluorescence immunochromatographic assay
GDF15growth differentiation factor 15
GDF8growth differentiation factor 8, myostatin
HFheart failure
hFABPheart-type fatty acid-binding protein
HSAhuman serum albumin
IgEimmunoglobulin E
IL-6interleukin-6
LODlimit of detection
MR-proADMmid-region-proADM
Ntnucleotides
NT-proBNPN-terminal proBNP
POCpoint-of-care
RNAribonucleic acid
SELEXsystematic evolution of ligands by exponential enrichment
SERSsurface-enhanced Raman spectroscopy
SOMAmerslow off-rate modified aptamers
SPRsurface plasmon resonance
sST2soluble suppression of tumorigenicity 2
ST2suppression of tumorigenicity 2
ST2Ltransmembrane suppression of tumorigenicity 2
SWVsquare wave voltammetry
TGF-βtransforming growth factor-β
TNFαtumor necrosis factor alpha
WHOworld health organization

References

  1. Cardiovascular Diseases (CVDs). Available online: https://www.who.int/news-room/fact-sheets/detail/cardiovascular-diseases-(cvds) (accessed on 18 April 2022).
  2. Szunerits, S.; Mishyn, V.; Grabowska, I.; Boukherroub, R. Electrochemical Cardiovascular Platforms: Current State of the Art and Beyond. Biosens. Bioelectron. 2019, 131, 287–298. [Google Scholar] [CrossRef] [PubMed]
  3. Crapnell, R.D.; Dempsey, N.C.; Sigley, E.; Tridente, A.; Banks, C.E. Electroanalytical Point-of-Care Detection of Gold Standard and Emerging Cardiac Biomarkers for Stratification and Monitoring in Intensive Care Medicine—A Review. Microchim. Acta 2022, 189, 142. [Google Scholar] [CrossRef] [PubMed]
  4. Ouyang, M.; Tu, D.; Tong, L.; Sarwar, M.; Bhimaraj, A.; Li, C.; Coté, G.L.; Di Carlo, D. A Review of Biosensor Technologies for Blood Biomarkers toward Monitoring Cardiovascular Diseases at the Point-of-Care. Biosens. Bioelectron. 2021, 171, 112621. [Google Scholar] [CrossRef] [PubMed]
  5. Shatunova, E.A.; Korolev, M.A.; Omelchenko, V.O.; Kurochkina, Y.D.; Davydova, A.S.; Venyaminova, A.G.; Vorobyeva, M.A. Aptamers for Proteins Associated with Rheumatic Diseases: Progress, Challenges, and Prospects of Diagnostic and Therapeutic Applications. Biomedicines 2020, 8, 527. [Google Scholar] [CrossRef]
  6. Komarova, N.; Kuznetsov, A. Inside the Black Box: What Makes SELEX Better? Molecules 2019, 24, 3598. [Google Scholar] [CrossRef] [Green Version]
  7. Elskens, J.P.; Elskens, J.M.; Madder, A. Chemical Modification of Aptamers for Increased Binding Affinity in Diagnostic Applications: Current Status and Future Prospects. Int. J. Mol. Sci. 2020, 21, 4522. [Google Scholar] [CrossRef]
  8. Ellington, A.D.; Szostak, J.W. In Vitro Selection of RNA Molecules That Bind Specific Ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef]
  9. Tuerk, C.; Gold, L. Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef]
  10. Kaur, H.; Bruno, J.G.; Kumar, A.; Sharma, T.K. Aptamers in the Therapeutics and Diagnostics Pipelines. Theranostics 2018, 8, 4016–4032. [Google Scholar] [CrossRef]
  11. Ilgu, M.; Nilsen-Hamilton, M. Aptamers in Analytics. Analyst 2016, 141, 1551–1568. [Google Scholar] [CrossRef] [Green Version]
  12. Predki, P.F.; Mattoon, D.; Bangham, R.; Schweitzer, B.; Michaud, G. Protein Microarrays: A New Tool for Profiling Antibody Cross-Reactivity. Hum. Antibodies 2006, 14, 7–15. [Google Scholar] [CrossRef]
  13. Shen, J.; Li, Y.; Gu, H.; Xia, F.; Zuo, X. Recent Development of Sandwich Assay Based on the Nanobiotechnologies for Proteins, Nucleic Acids, Small Molecules, and Ions. Chem. Rev. 2014, 114, 7631–7677. [Google Scholar] [CrossRef]
  14. Katrukha, I.A. Human Cardiac Troponin Complex. Structure and Functions. Biochemistry 2013, 78, 1447–1465. [Google Scholar] [CrossRef] [PubMed]
  15. Chaulin, A. Clinical and Diagnostic Value of Highly Sensitive Cardiac Troponins in Arterial Hypertension. Vasc. Health Risk Manag. 2021, 17, 431–443. [Google Scholar] [CrossRef]
  16. Fathil, M.F.M.; Md Arshad, M.K.; Gopinath, S.C.B.; Hashim, U.; Adzhri, R.; Ayub, R.M.; Ruslinda, A.R.; Nuzaihan M.N., M.; Azman, A.H.; Zaki, M.; et al. Diagnostics on Acute Myocardial Infarction: Cardiac Troponin Biomarkers. Biosens. Bioelectron. 2015, 70, 209–220. [Google Scholar] [CrossRef]
  17. Patil, H.; Vaidya, O.; Bogart, D. A Review of Causes and Systemic Approach to Cardiac Troponin Elevation. Clin. Cardiol. 2011, 34, 723–728. [Google Scholar] [CrossRef] [PubMed]
  18. Szeitner, Z.; Lautner, G.; Nagy, S.K.; Gyurcsányi, R.E.; Mészáros, T. A Rational Approach for Generating Cardiac Troponin I Selective Spiegelmers. Chem. Commun. 2014, 50, 6801–6804. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Chaulin, A.M.; Karslyan, L.S.; Bazyuk, E.V.; Nurbaltaeva, D.A.; Duplyakov, D.V. Clinical and Diagnostic Value of Cardiac Markers in Human Biological Fluids. Kardiologiia 2019, 59, 66–75. [Google Scholar] [CrossRef]
  20. Jo, H.; Gu, H.; Jeon, W.; Youn, H.; Her, J.; Kim, S.-K.; Lee, J.; Shin, J.H.; Ban, C. Electrochemical Aptasensor of Cardiac Troponin I for the Early Diagnosis of Acute Myocardial Infarction. Anal. Chem. 2015, 87, 9869–9875. [Google Scholar] [CrossRef]
  21. Lang, M.; Luo, D.; Yang, G.; Mei, Q.; Feng, G.; Yang, Y.; Liu, Z.; Chen, Q.; Wu, L. An Ultrasensitive Electrochemical Sensing Platform for the Detection of CTnI Based on Aptamer Recognition and Signal Amplification Assisted by TdT. RSC Adv. 2020, 10, 36396–36403. [Google Scholar] [CrossRef]
  22. Liu, D.; Lu, X.; Yang, Y.; Zhai, Y.; Zhang, J.; Li, L. A Novel Fluorescent Aptasensor for the Highly Sensitive and Selective Detection of Cardiac Troponin I Based on a Graphene Oxide Platform. Anal. Bioanal. Chem. 2018, 410, 4285–4291. [Google Scholar] [CrossRef] [PubMed]
  23. Chekin, F.; Vasilescu, A.; Jijie, R.; Singh, S.K.; Kurungot, S.; Iancu, M.; Badea, G.; Boukherroub, R.; Szunerits, S. Sensitive Electrochemical Detection of Cardiac Troponin I in Serum and Saliva by Nitrogen-Doped Porous Reduced Graphene Oxide Electrode. Sens. Actuators B Chem. 2018, 262, 180–187. [Google Scholar] [CrossRef]
  24. Vasudevan, M.; Tai, M.J.Y.; Perumal, V.; Gopinath, S.C.B.; Murthe, S.S.; Ovinis, M.; Mohamed, N.M.; Joshi, N. Highly Sensitive and Selective Acute Myocardial Infarction Detection Using Aptamer-tethered MoS 2 Nanoflower and Screen-printed Electrodes. Biotechnol. Appl. Biochem. 2020, 68, 1386–1395. [Google Scholar] [CrossRef] [PubMed]
  25. Mokhtari, Z.; Khajehsharifi, H.; Hashemnia, S.; Solati, Z.; Azimpanah, R.; Shahrokhian, S. Evaluation of Molecular Imprinted Polymerized Methylene Blue/Aptamer as a Novel Hybrid Receptor for Cardiac Troponin I (CTnI) Detection at Glassy Carbon Electrodes Modified with New Biosynthesized ZnONPs. Sens. Actuators B Chem. 2020, 320, 128316. [Google Scholar] [CrossRef]
  26. Qiao, X.; Li, K.; Xu, J.; Cheng, N.; Sheng, Q.; Cao, W.; Yue, T.; Zheng, J. Novel Electrochemical Sensing Platform for Ultrasensitive Detection of Cardiac Troponin I Based on Aptamer-MoS2 Nanoconjugates. Biosens. Bioelectron. 2018, 113, 142–147. [Google Scholar] [CrossRef]
  27. Lopa, N.S.; Rahman, M.M.; Ahmed, F.; Ryu, T.; Sutradhar, S.C.; Lei, J.; Kim, J.; Kim, D.H.; Lee, Y.H.; Kim, W. Simple, Low-Cost, Sensitive and Label-Free Aptasensor for the Detection of Cardiac Troponin I Based on a Gold Nanoparticles Modified Titanium Foil. Biosens. Bioelectron. 2019, 126, 381–388. [Google Scholar] [CrossRef]
  28. Zhang, J.; Lakshmipriya, T.; Gopinath, S.C.B. Electroanalysis on an Interdigitated Electrode for High-Affinity Cardiac Troponin I Biomarker Detection by Aptamer–Gold Conjugates. ACS Omega 2020, 5, 25899–25905. [Google Scholar] [CrossRef]
  29. Rezaei, Z.; Ranjbar, B. Ultra-Sensitive, Rapid Gold Nanoparticle-Quantum Dot Plexcitonic Self-Assembled Aptamer-Based Nanobiosensor for the Detection of Human Cardiac Troponin I. Eng. Life Sci. 2017, 17, 165–174. [Google Scholar] [CrossRef]
  30. Kitte, S.A.; Bushira, F.A.; Soreta, T.R. An Impedimetric Aptamer-Based Sensor for Sensitive and Selective Determination of Cardiac Troponin I. J. Iran. Chem. Soc. 2022, 19, 505–511. [Google Scholar] [CrossRef]
  31. Jo, H.; Her, J.; Lee, H.; Shim, Y.-B.; Ban, C. Highly Sensitive Amperometric Detection of Cardiac Troponin I Using Sandwich Aptamers and Screen-Printed Carbon Electrodes. Talanta 2017, 165, 442–448. [Google Scholar] [CrossRef]
  32. Kitte, S.A.; Tafese, T.; Xu, C.; Saqib, M.; Li, H.; Jin, Y. Plasmon-Enhanced Quantum Dots Electrochemiluminescence Aptasensor for Selective and Sensitive Detection of Cardiac Troponin I. Talanta 2021, 221, 121674. [Google Scholar] [CrossRef] [PubMed]
  33. Luo, Z.; Sun, D.; Tong, Y.; Zhong, Y.; Chen, Z. DNA Nanotetrahedron Linked Dual-Aptamer Based Voltammetric Aptasensor for Cardiac Troponin I Using a Magnetic Metal-Organic Framework as a Label. Microchim. Acta 2019, 186, 374. [Google Scholar] [CrossRef] [PubMed]
  34. Lee, H.; Youn, H.; Hwang, A.; Lee, H.; Park, J.Y.; Kim, W.; Yoo, Y.; Ban, C.; Kang, T.; Kim, B. Troponin Aptamer on an Atomically Flat Au Nanoplate Platform for Detection of Cardiac Troponin I. Nanomaterials 2020, 10, 1402. [Google Scholar] [CrossRef] [PubMed]
  35. Tu, D.; Holderby, A.; Coté, G.L. Aptamer-Based Surface-Enhanced Resonance Raman Scattering Assay on a Paper Fluidic Platform for Detection of Cardiac Troponin I. J. Biomed. Opt. 2020, 25, 097001. [Google Scholar] [CrossRef] [PubMed]
  36. Dorraj, G.S.; Rassaee, M.J.; Latifi, A.M.; Pishgoo, B.; Tavallaei, M. Selection of DNA Aptamers against Human Cardiac Troponin I for Colorimetric Sensor Based Dot Blot Application. J. Biotechnol. 2015, 208, 80–86. [Google Scholar] [CrossRef] [PubMed]
  37. Li, Y.; Yang, Y.; Lü, X.; Deng, Y. Aptamer-Based Fluorescent Assay for Sensitive Detection of Cardiac Troponin I. J. BEIJING Inst. Technol. 2020, 29, 45–51. [Google Scholar] [CrossRef]
  38. Hlukhova, H.; Menger, M.; Offenhäusser, A.; Vitusevich, S. Highly Sensitive Aptamer-Based Method for the Detection of Cardiac Biomolecules on Silicon Dioxide Surfaces. MRS Adv. 2018, 3, 1535–1541. [Google Scholar] [CrossRef]
  39. Sinha, A.; Gopinathan, P.; Chung, Y.-D.; Lin, H.-Y.; Li, K.-H.; Ma, H.-P.; Huang, P.-C.; Shiesh, S.-C.; Lee, G.-B. An Integrated Microfluidic Platform to Perform Uninterrupted SELEX Cycles to Screen Affinity Reagents Specific to Cardiovascular Biomarkers. Biosens. Bioelectron. 2018, 122, 104–112. [Google Scholar] [CrossRef]
  40. Gopinathan, P.; Sinha, A.; Chung, Y.-D.; Shiesh, S.-C.; Lee, G.-B. Optimization of an Enzyme Linked DNA Aptamer Assay for Cardiac Troponin I Detection: Synchronous Multiple Sample Analysis on an Integrated Microfluidic Platform. Analyst 2019, 144, 4943–4951. [Google Scholar] [CrossRef]
  41. Cen, Y.; Wang, Z.; Ke, P.; Zhu, W.; Yuan, Z.; Feng, S.; Chen, Y.; Lin, C.; Liu, X.; Li, Y.; et al. Development of a Novel SsDNA Aptamer Targeting Cardiac Troponin I and Its Clinical Applications. Anal. Bioanal. Chem. 2021, 413, 7043–7053. [Google Scholar] [CrossRef]
  42. Tolnai, Z.J.; András, J.; Szeitner, Z.; Percze, K.; Simon, L.F.; Gyurcsányi, R.E.; Mészáros, T. Spiegelmer-Based Sandwich Assay for Cardiac Troponin I Detection. Int. J. Mol. Sci. 2020, 21, 4963. [Google Scholar] [CrossRef] [PubMed]
  43. Szeitner, Z.; Doleschall, A.; Varga, M.; Keltai, K.; Révész, K.; Gyurcsányi, R.E.; Mészáros, T. Spiegelmers as Potential Receptors for CTnI Diagnostics. Anal. Methods 2017, 9, 5091–5093. [Google Scholar] [CrossRef]
  44. Saremi, M.; Amini, A.; Heydari, H. An Aptasensor for Troponin I Based on the Aggregation-Induced Electrochemiluminescence of Nanoparticles Prepared from a Cyclometallated Iridium(III) Complex and Poly(4-Vinylpyridine-Co-Styrene) Deposited on Nitrogen-Doped Graphene. Microchim. Acta 2019, 186, 254. [Google Scholar] [CrossRef] [PubMed]
  45. Negahdary, M.; Behjati-Ardakani, M.; Sattarahmady, N.; Heli, H. An Aptamer-Based Biosensor for Troponin I Detection in Diagnosis of Myocardial Infarction. J. Biomed. Phys. Eng. 2018, 8, 167–178. [Google Scholar] [CrossRef] [Green Version]
  46. Krasitskaya, V.V.; Goncharova, N.S.; Biriukov, V.V.; Bashmakova, E.E.; Kabilov, M.R.; Baykov, I.K.; Sokolov, A.E.; Frank, L.A. The Ca2+-Regulated Photoprotein Obelin as a Tool for SELEX Monitoring and DNA Aptamer Affinity Evaluation. Photochem. Photobiol. 2020, 96, 1041–1046. [Google Scholar] [CrossRef]
  47. Lin, C.; Li, L.; Feng, J.; Zhang, Y.; Lin, X.; Guo, H.; Li, R. Aptamer-Modified Magnetic SERS Substrate for Label-Based Determination of Cardiac Troponin I. Microchim. Acta 2022, 189, 22. [Google Scholar] [CrossRef]
  48. Han, Z.; Shu, J.; Liang, X.; Cui, H. Label-Free Ratiometric Electrochemiluminescence Aptasensor Based on Nanographene Oxide Wrapped Titanium Dioxide Nanoparticles with Potential-Resolved Electrochemiluminescence. Anal. Chem. 2019, 91, 12260–12267. [Google Scholar] [CrossRef]
  49. Prajesh, R.; Goyal, V.; Kakkar, S.; Sharma, J.; Alam, M.A.; Maurya, R.K.; Bhalla, V.; Agarwal, A. Polysilicon Field Effect Transistor Biosensor for the Detection of Cardiac Troponin-I (CTnI). J. Electrochem. Soc. 2021, 168, 027501. [Google Scholar] [CrossRef]
  50. Jiang, S.-H.; Jiang, S.-H.; Fan, T.; Liu, L.-J.; Chen, Y.; Zhang, X.-Q.; Sha, Z.-L.; Liu, Y.-L.; Zhang, J.-K. The Detection of CTnI by The Aptamer Biosensor. Prog. Biochem. Biophys. 2014, 41, 916–920. [Google Scholar] [CrossRef]
  51. Kazemi Asl, S.; Rahimzadegan, M. Recent Advances in the Fabrication of Nano-Aptasensors for the Detection of Troponin as a Main Biomarker of Acute Myocardial Infarction. Crit. Rev. Anal. Chem. 2021, 1–20. [Google Scholar] [CrossRef]
  52. Lee, T.; Ahn, J.-H.; Choi, J.; Lee, Y.; Kim, J.-M.; Park, C.; Jang, H.; Kim, T.-H.; Lee, M.-H. Development of the Troponin Detection System Based on the Nanostructure. Micromachines 2019, 10, 203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Sun, D.; Luo, Z.; Lu, J.; Zhang, S.; Che, T.; Chen, Z.; Zhang, L. Electrochemical Dual-Aptamer-Based Biosensor for Nonenzymatic Detection of Cardiac Troponin I by Nanohybrid Electrocatalysts Labeling Combined with DNA Nanotetrahedron Structure. Biosens. Bioelectron. 2019, 134, 49–56. [Google Scholar] [CrossRef] [PubMed]
  54. Negahdary, M. Aptamers in Nanostructure-Based Electrochemical Biosensors for Cardiac Biomarkers and Cancer Biomarkers: A Review. Biosens. Bioelectron. 2020, 152, 112018. [Google Scholar] [CrossRef] [PubMed]
  55. Rubini Gimenez, M.; Twerenbold, R.; Reichlin, T.; Wildi, K.; Haaf, P.; Schaefer, M.; Zellweger, C.; Moehring, B.; Stallone, F.; Sou, S.M.; et al. Direct Comparison of High-Sensitivity-Cardiac Troponin I vs. T for the Early Diagnosis of Acute Myocardial Infarction. Eur. Heart J. 2014, 35, 2303–2311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Mirzaii-Dizgah, I.; Riahi, E. Salivary High-Sensitivity Cardiac Troponin T Levels in Patients with Acute Myocardial Infarction. Oral Dis. 2013, 19, 180–184. [Google Scholar] [CrossRef] [PubMed]
  57. Negahdary, M.; Behjati-Ardakani, M.; Heli, H. An Electrochemical Troponin T Aptasensor Based on the Use of a Macroporous Gold Nanostructure. Microchim. Acta 2019, 186, 377. [Google Scholar] [CrossRef] [PubMed]
  58. Negahdary, M.; Behjati-Ardakani, M.; Heli, H.; Sattarahmady, N. A Cardiac Troponin T Biosensor Based on Aptamer Self-Assembling on Gold. Int. J. Mol. Cell. Med. 2019, 8, 271–283. [Google Scholar] [CrossRef]
  59. Torrini, F.; Palladino, P.; Brittoli, A.; Baldoneschi, V.; Minunni, M.; Scarano, S. Characterization of Troponin T Binding Aptamers for an Innovative Enzyme-Linked Oligonucleotide Assay (ELONA). Anal. Bioanal. Chem. 2019, 411, 7709–7716. [Google Scholar] [CrossRef]
  60. Sharma, A.; Jang, J. Flexible Electrical Aptasensor Using Dielectrophoretic Assembly of Graphene Oxide and Its Subsequent Reduction for Cardiac Biomarker Detection. Sci. Rep. 2019, 9, 5970. [Google Scholar] [CrossRef] [Green Version]
  61. Ara, M.N.; Hyodo, M.; Ohga, N.; Hida, K.; Harashima, H. Development of a Novel DNA Aptamer Ligand Targeting to Primary Cultured Tumor Endothelial Cells by a Cell-Based SELEX Method. PLoS ONE 2012, 7, e50174. [Google Scholar] [CrossRef] [Green Version]
  62. Ara, M.N.; Hyodo, M.; Ohga, N.; Akiyama, K.; Hida, K.; Hida, Y.; Shinohara, N.; Harashima, H. Identification and Expression of Troponin T, a New Marker on the Surface of Cultured Tumor Endothelial Cells by Aptamer Ligand. Cancer Med. 2014, 3, 825–834. [Google Scholar] [CrossRef] [PubMed]
  63. Yang, X.; Zhao, Y.; Sun, L.; Qi, H.; Gao, Q.; Zhang, C. Electrogenerated Chemiluminescence Biosensor Array for the Detection of Multiple AMI Biomarkers. Sens. Actuators B Chem. 2018, 257, 60–67. [Google Scholar] [CrossRef]
  64. Agarwal, D.K.; Kandpal, M.; Surya, S.G. Characterization and Detection of Cardiac Troponin-T Protein by Using ‘Aptamer’ Mediated Biofunctionalization of ZnO Thin-Film Transistor. Appl. Surf. Sci. 2019, 466, 874–881. [Google Scholar] [CrossRef]
  65. Surya, S.G.; Majhi, S.M.; Agarwal, D.K.; Lahcen, A.A.; Yuvaraja, S.; Chappanda, K.N.; Salama, K.N. A Label-Free Aptasensor FET Based on Au Nanoparticle Decorated Co3O4 Nanorods and a SWCNT Layer for Detection of Cardiac Troponin T Protein. J. Mater. Chem. B 2020, 8, 18–26. [Google Scholar] [CrossRef] [Green Version]
  66. Qureshi, A.; Gurbuz, Y.; Niazi, J.H. Biosensors for Cardiac Biomarkers Detection: A Review. Sens. Actuators B Chem. 2012, 171, 62–76. [Google Scholar] [CrossRef] [Green Version]
  67. Clinical Chemistry, Immunology and Laboratory Quality Control; Elsevier: Amsterdam, The Netherlands, 2014; ISBN 9780124078215.
  68. Lewandrowski, K.; Chen, A.; Januzzi, J. Cardiac Markers for Myocardial Infarction. Pathol. Patterns Rev. 2002, 118, S93–S99. [Google Scholar] [CrossRef]
  69. Mohamed, R.; Campbell, J.; Cooper-White, J.; Dimeski, G.; Punyadeera, C. The Impact of Saliva Collection and Processing Methods on CRP, IgE, and Myoglobin Immunoassays. Clin. Transl. Med. 2012, 1, 19. [Google Scholar] [CrossRef] [Green Version]
  70. Floriano, P.N.; Christodoulides, N.; Miller, C.S.; Ebersole, J.L.; Spertus, J.; Rose, B.G.; Kinane, D.F.; Novak, M.J.; Steinhubl, S.; Acosta, S.; et al. Use of Saliva-Based Nano-Biochip Tests for Acute Myocardial Infarction at the Point of Care: A Feasibility Study. Clin. Chem. 2009, 55, 1530–1538. [Google Scholar] [CrossRef] [Green Version]
  71. Abdul Rehman, S.; Khurshid, Z.; Hussain Niazi, F.; Naseem, M.; Al Waddani, H.; Sahibzada, H.; Sannam Khan, R. Role of Salivary Biomarkers in Detection of Cardiovascular Diseases (CVD). Proteomes 2017, 5, 21. [Google Scholar] [CrossRef]
  72. Rodriíguez-Capote, K.; Balion, C.M.; Hill, S.A.; Cleve, R.; Yang, L.; El Sharif, A. Utility of Urine Myoglobin for the Prediction of Acute Renal Failure in Patients with Suspected Rhabdomyolysis: A Systematic Review. Clin. Chem. 2009, 55, 2190–2197. [Google Scholar] [CrossRef] [Green Version]
  73. Loun, B.; Astles, R.; Copeland, K.R.; Sedor, F.A. Adaptation of a Quantitative Immunoassay for Urine Myoglobin: Predictor in Detecting Renal Dysfunction. Am. J. Clin. Pathol. 1996, 105, 479–486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  74. Wu, A.H.; Laios, I.; Green, S.; Gornet, T.G.; Wong, S.S.; Parmley, L.; Tonnesen, A.S.; Plaisier, B.; Orlando, R. Immunoassays for Serum and Urine Myoglobin: Myoglobin Clearance Assessed as a Risk Factor for Acute Renal Failure. Clin. Chem. 1994, 40, 796–802. [Google Scholar] [CrossRef] [PubMed]
  75. Wang, Q.; Liu, W.; Xing, Y.; Yang, X.; Wang, K.; Jiang, R.; Wang, P.; Zhao, Q. Screening of DNA Aptamers against Myoglobin Using a Positive and Negative Selection Units Integrated Microfluidic Chip and Its Biosensing Application. Anal. Chem. 2014, 86, 6572–6579. [Google Scholar] [CrossRef]
  76. Asl, S.K.; Rahimzadegan, M. The Recent Progress in the Early Diagnosis of Acute Myocardial Infarction Based on Myoglobin Biomarker: Nano-Aptasensors Approaches. J. Pharm. Biomed. Anal. 2022, 211, 114624. [Google Scholar] [CrossRef]
  77. Wang, Q.; Liu, L.; Yang, X.; Wang, K.; Chen, N.; Zhou, C.; Luo, B.; Du, S. Evaluation of Medicine Effects on the Interaction of Myoglobin and Its Aptamer or Antibody Using Atomic Force Microscopy. Anal. Chem. 2015, 87, 2242–2248. [Google Scholar] [CrossRef] [PubMed]
  78. Wang, Q.; Liu, F.; Yang, X.; Wang, K.; Wang, H.; Deng, X. Sensitive Point-of-Care Monitoring of Cardiac Biomarker Myoglobin Using Aptamer and Ubiquitous Personal Glucose Meter. Biosens. Bioelectron. 2015, 64, 161–164. [Google Scholar] [CrossRef] [PubMed]
  79. Li, S.; Zheng, Y.; Zou, Q.; Liao, G.; Liu, X.; Zou, L.; Yang, X.; Wang, Q.; Wang, K. Engineering and Application of a Myoglobin Binding Split Aptamer. Anal. Chem. 2020, 92, 14576–14581. [Google Scholar] [CrossRef] [PubMed]
  80. Sharma, A.; Bhardwaj, J.; Jang, J. Label-Free, Highly Sensitive Electrochemical Aptasensors Using Polymer-Modified Reduced Graphene Oxide for Cardiac Biomarker Detection. ACS Omega 2020, 5, 3924–3931. [Google Scholar] [CrossRef]
  81. Kumar, V.; Shorie, M.; Ganguli, A.K.; Sabherwal, P. Graphene-CNT Nanohybrid Aptasensor for Label Free Detection of Cardiac Biomarker Myoglobin. Biosens. Bioelectron. 2015, 72, 56–60. [Google Scholar] [CrossRef]
  82. Shorie, M.; Kumar, V.; Kaur, H.; Singh, K.; Tomer, V.K.; Sabherwal, P. Plasmonic DNA Hotspots Made from Tungsten Disulfide Nanosheets and Gold Nanoparticles for Ultrasensitive Aptamer-Based SERS Detection of Myoglobin. Microchim. Acta 2018, 185, 158. [Google Scholar] [CrossRef]
  83. Kumar, V.; Brent, J.R.; Shorie, M.; Kaur, H.; Chadha, G.; Thomas, A.G.; Lewis, E.A.; Rooney, A.P.; Nguyen, L.; Zhong, X.L.; et al. Nanostructured Aptamer-Functionalized Black Phosphorus Sensing Platform for Label-Free Detection of Myoglobin, a Cardiovascular Disease Biomarker. ACS Appl. Mater. Interfaces 2016, 8, 22860–22868. [Google Scholar] [CrossRef] [PubMed]
  84. Chen, J.; Ran, F.; Chen, Q.; Luo, D.; Ma, W.; Han, T.; Wang, C.; Wang, C. A Fluorescent Biosensor for Cardiac Biomarker Myoglobin Detection Based on Carbon Dots and Deoxyribonuclease I-Aided Target Recycling Signal Amplification. RSC Adv. 2019, 9, 4463–4468. [Google Scholar] [CrossRef] [Green Version]
  85. Pur, M.R.K.; Hosseini, M.; Faridbod, F.; Ganjali, M.R. Highly Sensitive Label-Free Electrochemiluminescence Aptasensor for Early Detection of Myoglobin, a Biomarker for Myocardial Infarction. Microchim. Acta 2017, 184, 3529–3537. [Google Scholar] [CrossRef]
  86. Cabaniss, D. Creatine Kinase. In Clinical Methods: The History, Physical, and Laboratory Examinations; Walker, H., Hall, W., Hurst, J., Eds.; Butterworth Publishers: Boston, MA, USA, 1990; ISBN 040990077X. [Google Scholar]
  87. Apple, F.S.; Saenger, A.K. The State of Cardiac Troponin Assays: Looking Bright and Moving in the Right Direction. Clin. Chem. 2013, 59, 1014–1016. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  88. Singh, G.; Baweja, P.S. Creatine Kinase–MB. Am. J. Clin. Pathol. 2014, 141, 415–419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  89. Collinson, P.O.; van Dieijen-Visser, M.P.; Pulkki, K.; Hammerer-Lercher, A.; Suvisaari, J.; Ravkilde, J.; Stavljenic-Rukavina, A.; Baum, H.; Laitinen, P. Evidence-Based Laboratory Medicine: How Well Do Laboratories Follow Recommendations and Guidelines? The Cardiac Marker Guideline Uptake in Europe (CARMAGUE) Study. Clin. Chem. 2012, 58, 305–306. [Google Scholar] [CrossRef]
  90. Lopes, R.D.; Lokhnygina, Y.; Hasselblad, V.; Newby, K.L.; Yow, E.; Granger, C.B.; Armstrong, P.W.; Hochman, J.S.; Mills, J.S.; Ruzyllo, W.; et al. Methods of Creatine Kinase-MB Analysis to Predict Mortality in Patients with Myocardial Infarction Treated with Reperfusion Therapy. Trials 2013, 14, 123. [Google Scholar] [CrossRef] [Green Version]
  91. Mirzaii-Dizgah, I.; Hejazi, S.F.; Riahi, E.; Salehi, M.M. Saliva-Based Creatine Kinase MB Measurement as a Potential Point-of-Care Testing for Detection of Myocardial Infarction. Clin. Oral Investig. 2012, 16, 775–779. [Google Scholar] [CrossRef]
  92. Foley, J.D.; Sneed, J.D.; Steinhubl, S.R.; Kolasa, J.R.; Ebersole, J.L.; Lin, Y.; Kryscio, R.J.; McDevitt, J.T.; Campbell, C.L.; Miller, C.S. Salivary Biomarkers Associated with Myocardial Necrosis: Results from an Alcohol Septal Ablation Model. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. 2012, 114, 616–623. [Google Scholar] [CrossRef] [Green Version]
  93. Miller, C.S.; Foley, J.D.; Floriano, P.N.; Christodoulides, N.; Ebersole, J.L.; Campbell, C.L.; Bailey, A.L.; Rose, B.G.; Kinane, D.F.; Novak, M.J.; et al. Utility of Salivary Biomarkers for Demonstrating Acute Myocardial Infarction. J. Dent. Res. 2014, 93, 72S–79S. [Google Scholar] [CrossRef]
  94. Brandt, D.R.; Gates, R.C.; Eng, K.K.; Forsythe, C.M.; Korom, G.K.; Nitro, A.S.; Koffler, P.A.; Ogunro, E.A. Quantifying the MB Isoenzyme of Creatine Kinase with the Abbott “IMx” Immunoassay Analyzer. Clin. Chem. 1990, 36, 375–378. [Google Scholar] [CrossRef] [PubMed]
  95. Gerhardt, W.; Waldenström, J. Creatine Kinase B-Subunit Activity in Serum after Immunoinhibition of M-Subunit Activity. Clin. Chem. 1979, 25, 1274–1280. [Google Scholar] [CrossRef] [PubMed]
  96. Zhang, J.; Lv, X.; Feng, W.; Li, X.; Li, K.; Deng, Y. Aptamer-Based Fluorometric Lateral Flow Assay for Creatine Kinase MB. Microchim. Acta 2018, 185, 364. [Google Scholar] [CrossRef] [PubMed]
  97. Chen, M.; Wang, Y.; Zhao, X.; Zhang, J.; Peng, Y.; Bai, J.; Li, S.; Han, D.; Ren, S.; Qin, K.; et al. Target-Responsive DNA Hydrogel with Microfluidic Chip Smart Readout for Quantitative Point-of-Care Testing of Creatine Kinase MB. Talanta 2022, 243, 123338. [Google Scholar] [CrossRef]
  98. Kakoti, A.; Goswami, P. Heart Type Fatty Acid Binding Protein: Structure, Function and Biosensing Applications for Early Detection of Myocardial Infarction. Biosens. Bioelectron. 2013, 43, 400–411. [Google Scholar] [CrossRef] [PubMed]
  99. Binas, B.; Danneberg, H.; Mcwhir, J.; Mullins, L.; Clark, A.J. Requirement for the Heart-type Fatty Acid Binding Protein in Cardiac Fatty Acid Utilization. FASEB J. 1999, 13, 805–812. [Google Scholar] [CrossRef] [Green Version]
  100. Alhadi, H.A.; Fox, K.A.A. Do We Need Additional Markers of Myocyte Necrosis: The Potential Value of Heart Fatty-Acid-Binding Protein. QJM 2004, 97, 187–198. [Google Scholar] [CrossRef] [Green Version]
  101. Kakoti, A.; Goswami, P. Multifaceted Analyses of the Interactions between Human Heart Type Fatty Acid Binding Protein and Its Specific Aptamers. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 3289–3299. [Google Scholar] [CrossRef]
  102. Rezar, R.; Jirak, P.; Gschwandtner, M.; Derler, R.; Felder, T.K.; Haslinger, M.; Kopp, K.; Seelmaier, C.; Granitz, C.; Hoppe, U.C.; et al. Heart-Type Fatty Acid-Binding Protein (H-FABP) and Its Role as a Biomarker in Heart Failure: What Do We Know So Far? J. Clin. Med. 2020, 9, 164. [Google Scholar] [CrossRef] [Green Version]
  103. Tanaka, T.; Hirota, Y.; Sohmiya, K.-I.; Nishimura, S.; Kawamura, K. Serum and Urinary Human Heart Fatty Acid-Binding Protein in Acute Myocardial Infarction. Clin. Biochem. 1991, 24, 195–201. [Google Scholar] [CrossRef]
  104. Tani, K.; Shirakabe, A.; Kobayashi, N.; Okazaki, H.; Matsushita, M.; Shibata, Y.; Shigihara, S.; Sawatani, T.; Otsuka, Y.; Takayasu, T.; et al. The Prognostic Impact of the Serum Heart-Type Fatty Acid-Binding Protein Level in Patients with Sepsis Who Were Admitted to the Non-Surgical Intensive-Care Unit. Heart Vessels 2021, 36, 1765–1774. [Google Scholar] [CrossRef] [PubMed]
  105. Hasanzadeh, M.; Shadjou, N.; Eskandani, M.; de la Guardia, M.; Omidinia, E. Electrochemical Nano-Immunosensing of Effective Cardiac Biomarkers for Acute Myocardial Infarction. TrAC Trends Anal. Chem. 2013, 49, 20–30. [Google Scholar] [CrossRef]
  106. Dahiya, T.; Yadav, S.; Yadav, N.; Mann, A.; Sharma, M.; Rana, J.S. Monitoring of BNP Cardiac Biomarker with Major Emphasis on Biosensing Methods: A Review. Sens. Int. 2021, 2, 100103. [Google Scholar] [CrossRef]
  107. Clerico, A.; Passino, C.; Franzini, M.; Emdin, M. Cardiac Biomarker Testing in the Clinical Laboratory: Where Do We Stand? General Overview of the Methodology with Special Emphasis on Natriuretic Peptides. Clin. Chim. Acta 2015, 443, 17–24. [Google Scholar] [CrossRef]
  108. Goryacheva, O.A.; Ponomaryova, T.D.; Drozd, D.D.; Kokorina, A.A.; Rusanova, T.Y.; Mishra, P.K.; Goryacheva, I.Y. Heart Failure Biomarkers BNP and NT-ProBNP Detection Using Optical Labels. TrAC Trends Anal. Chem. 2022, 146, 116477. [Google Scholar] [CrossRef]
  109. Gachpazan, M.; Mohammadinejad, A.; Saeidinia, A.; Rahimi, H.R.; Ghayour-Mobarhan, M.; Vakilian, F.; Rezayi, M. A Review of Biosensors for the Detection of B-Type Natriuretic Peptide as an Important Cardiovascular Biomarker. Anal. Bioanal. Chem. 2021, 413, 5949–5967. [Google Scholar] [CrossRef] [PubMed]
  110. Thygesen, K.; Mair, J.; Mueller, C.; Huber, K.; Weber, M.; Plebani, M.; Hasin, Y.; Biasucci, L.M.; Giannitsis, E.; Lindahl, B.; et al. Recommendations for the Use of Natriuretic Peptides in Acute Cardiac Care: A Position Statement from the Study Group on Biomarkers in Cardiology of the ESC Working Group on Acute Cardiac Care. Eur. Heart J. 2012, 33, 2001–2006. [Google Scholar] [CrossRef] [Green Version]
  111. Grabowska, I.; Sharma, N.; Vasilescu, A.; Iancu, M.; Badea, G.; Boukherroub, R.; Ogale, S.; Szunerits, S. Electrochemical Aptamer-Based Biosensors for the Detection of Cardiac Biomarkers. ACS Omega 2018, 3, 12010–12018. [Google Scholar] [CrossRef] [Green Version]
  112. Foo, J.Y.Y.; Wan, Y.; Kostner, K.; Arivalagan, A.; Atherton, J.; Cooper-White, J.; Dimeski, G.; Punyadeera, C. NT-ProBNP Levels in Saliva and Its Clinical Relevance to Heart Failure. PLoS ONE 2012, 7, e48452. [Google Scholar] [CrossRef] [Green Version]
  113. Joharimoghadam, A.; Tajdini, M.; Bozorgi, A. Salivary B-Type Natriuretic Peptide: A New Method for Heart Failure Diagnosis and Follow-Up. Kardiol. Pol. 2017, 75, 71–77. [Google Scholar] [CrossRef]
  114. Bellagambi, F.G.; Petersen, C.; Salvo, P.; Ghimenti, S.; Franzini, M.; Biagini, D.; Hangouët, M.; Trivella, M.G.; Di Francesco, F.; Paolicchi, A.; et al. Determination and Stability of N-Terminal pro-Brain Natriuretic Peptide in Saliva Samples for Monitoring Heart Failure. Sci. Rep. 2021, 11, 13088. [Google Scholar] [CrossRef]
  115. Lin, M.-C.; Nawarak, J.; Chen, T.-Y.; Tsai, H.-Y.; Hsieh, J.-F.; Sinchaikul, S.; Chen, S.-T. Rapid Detection of Natriuretic Peptides by a Microfluidic LabChip Analyzer with DNA Aptamers: Application of Natriuretic Peptide Detection. Biomicrofluidics 2009, 3, 034101. [Google Scholar] [CrossRef] [Green Version]
  116. Zhu, Z.; Li, H.; Xiang, Y.; Koh, K.; Hu, X.; Chen, H. Pyridinium Porphyrins and AuNPs Mediated Bionetworks as SPR Signal Amplification Tags for the Ultrasensitive Assay of Brain Natriuretic Peptide. Microchim. Acta 2020, 187, 327. [Google Scholar] [CrossRef] [PubMed]
  117. Jang, H.R.; Wark, A.W.; Baek, S.H.; Chung, B.H.; Lee, H.J. Ultrasensitive and Ultrawide Range Detection of a Cardiac Biomarker on a Surface Plasmon Resonance Platform. Anal. Chem. 2014, 86, 814–819. [Google Scholar] [CrossRef] [PubMed]
  118. Tu, A.; Shang, J.; Wang, Y.; Li, D.; Liu, L.; Gan, Z.; Yin, Y.; Zhang, P. Detection of B-Type Natriuretic Peptide by Establishing a Low-Cost and Replicable Fluorescence Resonance Energy Transfer Platform. Microchim. Acta 2020, 187, 331. [Google Scholar] [CrossRef] [PubMed]
  119. Zhao, J.; Zhu, Z.-Z.; Huang, X.; Hu, X.; Chen, H. Magnetic Gold Nanocomposite and Aptamer Assisted Triple Recognition Electrochemical Immunoassay for Determination of Brain Natriuretic Peptide. Microchim. Acta 2020, 187, 231. [Google Scholar] [CrossRef]
  120. Bruno, J.G.; Richarte, A.M.; Phillips, T. Preliminary Development of a DNA Aptamer-Magnetic Bead Capture Electrochemiluminescence Sandwich Assay for Brain Natriuretic Peptide. Microchem. J. 2014, 115, 32–38. [Google Scholar] [CrossRef] [Green Version]
  121. Wang, Y.; Wu, J.; Chen, Y.; Xue, F.; Teng, J.; Cao, J.; Lu, C.; Chen, W. Magnetic Microparticle-Based SELEX Process for the Identification of Highly Specific Aptamers of Heart Marker--Brain Natriuretic Peptide. Microchim. Acta 2015, 182, 331–339. [Google Scholar] [CrossRef]
  122. Hu, X.; Zhang, N.; Shen, L.; Yu, L.; Huang, L.-Y.; Wang, A.-J.; Shan, D.; Yuan, P.-X.; Feng, J.-J. The Enhanced Photoelectrochemical Platform Constructed by N-Doped ZnO Nanopolyhedrons and Porphyrin for Ultrasensitive Detection of Brain Natriuretic Peptide. Anal. Chim. Acta 2021, 1183, 338870. [Google Scholar] [CrossRef]
  123. Sinha, A.; Gopinathan, P.; Chung, Y.-D.; Shiesh, S.-C.; Lee, G.-B. Simultaneous Detection of Multiple NT-ProBNP Clinical Samples Utilizing an Aptamer-Based Sandwich Assay on an Integrated Microfluidic System. Lab Chip 2019, 19, 1676–1685. [Google Scholar] [CrossRef]
  124. Voors, A.A.; Kremer, D.; Geven, C.; ter Maaten, J.M.; Struck, J.; Bergmann, A.; Pickkers, P.; Metra, M.; Mebazaa, A.; Düngen, H.-D.; et al. Adrenomedullin in Heart Failure: Pathophysiology and Therapeutic Application. Eur. J. Heart Fail. 2019, 21, 163–171. [Google Scholar] [CrossRef] [PubMed]
  125. Lopes, D.; Menezes Falcão, L. Mid-Regional pro-Adrenomedullin and ST2 in Heart Failure: Contributions to Diagnosis and Prognosis. Rev. Port. Cardiol. 2017, 36, 465–472. [Google Scholar] [CrossRef] [PubMed]
  126. Koyama, T.; Kuriyama, N.; Suzuki, Y.; Saito, S.; Tanaka, R.; Iwao, M.; Tanaka, M.; Maki, T.; Itoh, H.; Ihara, M.; et al. Mid-Regional pro-Adrenomedullin Is a Novel Biomarker for Arterial Stiffness as the Criterion for Vascular Failure in a Cross-Sectional Study. Sci. Rep. 2021, 11, 305. [Google Scholar] [CrossRef] [PubMed]
  127. Önal, U.; Valenzuela-Sánchez, F.; Vandana, K.; Rello, J. Mid-Regional Pro-Adrenomedullin (MR-ProADM) as a Biomarker for Sepsis and Septic Shock: Narrative Review. Healthcare 2018, 6, 110. [Google Scholar] [CrossRef] [Green Version]
  128. Pourafkari, L.; Tajlil, A.; Nader, N.D. Biomarkers in Diagnosing and Treatment of Acute Heart Failure. Biomark. Med. 2019, 13, 1235–1249. [Google Scholar] [CrossRef]
  129. Lenka, Š.; Špinarová, M.; Goldbergová, M.P.; Špinar, J.; Pařenica, J.; Ludka, O.; Lábr, K.; Malek, F.; Ostadal, P.; Vondrakova, D.; et al. Prognostic Impact of Copeptin and Mid-Regional Pro-Adrenomedullin in Chronic Heart Failure with Regard to Comorbidities. J. Cardiovasc. Dis. Diagn. 2018, 6, 1–5. [Google Scholar] [CrossRef]
  130. Xue, Y.; Taub, P.; Iqbal, N.; Fard, A.; Clopton, P.; Maisel, A. Mid-Region pro-Adrenomedullin Adds Predictive Value to Clinical Predictors and Framingham Risk Score for Long-Term Mortality in Stable Outpatients with Heart Failure. Eur. J. Heart Fail. 2013, 15, 1343–1349. [Google Scholar] [CrossRef]
  131. Moore, N.; Williams, R.; Mori, M.; Bertolusso, B.; Vernet, G.; Lynch, J.; Philipson, P.; Ledgerwood, T.; Kidd, S.P.; Thomas, C.; et al. Mid-Regional Proadrenomedullin (MR-ProADM), C-Reactive Protein (CRP) and Other Biomarkers in the Early Identification of Disease Progression in Patients with COVID-19 in the Acute NHS Setting. J. Clin. Pathol. 2022, jclinpath-2021-207750. [Google Scholar] [CrossRef]
  132. Tzikas, S.; Keller, T.; Ojeda, F.M.; Zeller, T.; Wild, P.S.; Lubos, E.; Kunde, J.; Baldus, S.; Bickel, C.; Lackner, K.J.; et al. MR-ProANP and MR-ProADM for Risk Stratification of Patients with Acute Chest Pain. Heart 2013, 99, 388–395. [Google Scholar] [CrossRef]
  133. Saito, Y. Roles of Atrial Natriuretic Peptide and Its Therapeutic Use. J. Cardiol. 2010, 56, 262–270. [Google Scholar] [CrossRef] [Green Version]
  134. Potter, L.R.; Yoder, A.R.; Flora, D.R.; Antos, L.K.; Dickey, D.M. Natriuretic Peptides: Their Structures, Receptors, Physiologic Functions and Therapeutic Applications. In Handbook of Experimental Pharmacology; Springer: Berlin/Heidelberg, Germany, 2009; pp. 341–366. [Google Scholar]
  135. Nagai-Okatani, C.; Kangawa, K.; Minamino, N. Three Molecular Forms of Atrial Natriuretic Peptides: Quantitative Analysis and Biological Characterization. J. Pept. Sci. 2017, 23, 486–495. [Google Scholar] [CrossRef] [PubMed]
  136. Gohar, A.; Rutten, F.H.; Ruijter, H.; Kelder, J.C.; Haehling, S.; Anker, S.D.; Möckel, M.; Hoes, A.W. Mid-regional Pro-atrial Natriuretic Peptide for the Early Detection of Non-acute Heart Failure. Eur. J. Heart Fail. 2019, 21, 1219–1227. [Google Scholar] [CrossRef] [PubMed]
  137. Yagmur, E.; Sckaer, J.H.; Koek, G.H.; Weiskirchen, R.; Trautwein, C.; Koch, A.; Tacke, F. Elevated MR-ProANP Plasma Concentrations Are Associated with Sepsis and Predict Mortality in Critically Ill Patients. J. Transl. Med. 2019, 17, 415. [Google Scholar] [CrossRef]
  138. Mueller, C.; McDonald, K.; de Boer, R.A.; Maisel, A.; Cleland, J.G.F.; Kozhuharov, N.; Coats, A.J.S.; Metra, M.; Mebazaa, A.; Ruschitzka, F.; et al. Heart Failure Association of the European Society of Cardiology Practical Guidance on the Use of Natriuretic Peptide Concentrations. Eur. J. Heart Fail. 2019, 21, 715–731. [Google Scholar] [CrossRef] [Green Version]
  139. Maisel, A.; Mueller, C.; Nowak, R.; Peacock, W.F.; Landsberg, J.W.; Ponikowski, P.; Mockel, M.; Hogan, C.; Wu, A.H.B.; Richards, M.; et al. Mid-Region Pro-Hormone Markers for Diagnosis and Prognosis in Acute Dyspnea. J. Am. Coll. Cardiol. 2010, 55, 2062–2076. [Google Scholar] [CrossRef] [Green Version]
  140. Wang, X.-Y.; Zhang, F.; Zhang, C.; Zheng, L.-R.; Yang, J. The Biomarkers for Acute Myocardial Infarction and Heart Failure. Biomed Res. Int. 2020, 2020, 2018035. [Google Scholar] [CrossRef] [Green Version]
  141. Ponikowski, P.; Voors, A.A.; Anker, S.D.; Bueno, H.; Cleland, J.G.F.; Coats, A.J.S.; Falk, V.; González-Juanatey, J.R.; Harjola, V.-P.; Jankowska, E.A.; et al. 2016 ESC Guidelines for the Diagnosis and Treatment of Acute and Chronic Heart Failure. Eur. Heart J. 2016, 37, 2129–2200. [Google Scholar] [CrossRef]
  142. Lindberg, S.; Jensen, J.S.; Pedersen, S.H.; Galatius, S.; Goetze, J.P.; Mogelvang, R. MR-ProANP Improves Prediction of Mortality and Cardiovascular Events in Patients with STEMI. Eur. J. Prev. Cardiol. 2015, 22, 693–700. [Google Scholar] [CrossRef]
  143. Katan, M.; Fluri, F.; Schuetz, P.; Morgenthaler, N.G.; Zweifel, C.; Bingisser, R.; Kappos, L.; Steck, A.; Engelter, S.T.; Müller, B.; et al. Midregional Pro-Atrial Natriuretic Peptide and Outcome in Patients With Acute Ischemic Stroke. J. Am. Coll. Cardiol. 2010, 56, 1045–1053. [Google Scholar] [CrossRef] [Green Version]
  144. Bolignano, D.; Cabassi, A.; Fiaccadori, E.; Ghigo, E.; Pasquali, R.; Peracino, A.; Peri, A.; Plebani, M.; Santoro, A.; Settanni, F.; et al. Copeptin (CTproAVP), a New Tool for Understanding the Role of Vasopressin in Pathophysiology. Clin. Chem. Lab. Med. 2014, 52, 1447–1456. [Google Scholar] [CrossRef]
  145. Chiotoroiu, A.-L.; Buicu, C.-F.; Neagu, C.; Benedek, T. Recent Advances in Biomarker Discovery—from Serum to Imaging-Based Biomarkers for a Complex Assessment of Heart Failure Patients. J. Interdiscip. Med. 2016, 1, 125–130. [Google Scholar] [CrossRef] [Green Version]
  146. Morgenthaler, N.G.; Struck, J.; Jochberger, S.; Dünser, M.W. Copeptin: Clinical Use of a New Biomarker. Trends Endocrinol. Metab. 2008, 19, 43–49. [Google Scholar] [CrossRef] [PubMed]
  147. Acher, R.; Chauvet, J.; Rouille, Y. Dynamic Processing of Neuropeptides. J. Mol. Neurosci. 2002, 18, 223–228. [Google Scholar] [CrossRef]
  148. Reichlin, T.; Hochholzer, W.; Stelzig, C.; Laule, K.; Freidank, H.; Morgenthaler, N.G.; Bergmann, A.; Potocki, M.; Noveanu, M.; Breidthardt, T.; et al. Incremental Value of Copeptin for Rapid Rule Out of Acute Myocardial Infarction. J. Am. Coll. Cardiol. 2009, 54, 60–68. [Google Scholar] [CrossRef] [Green Version]
  149. Pop, C.; Crişan, G.C.; Loghin, F.; Mogoşan, C.I. Advances in the Detection and Quantification of Candidate and Established Biomarkers in Heart Failure. Rom. Rev. Lab. Med. 2013, 21, 255–265. [Google Scholar] [CrossRef] [Green Version]
  150. Morgenthaler, N.G. Assay for the Measurement of Copeptin, a Stable Peptide Derived from the Precursor of Vasopressin. Clin. Chem. 2006, 52, 112–119. [Google Scholar] [CrossRef] [Green Version]
  151. Liu, Y.; Haghighatbin, M.A.; Shen, W.; Cui, H. Functionalized Polydopamine Nanospheres with Chemiluminescence and Immunoactivity for Label-Free Copeptin Immunosensing. ACS Appl. Nano Mater. 2020, 3, 4681–4689. [Google Scholar] [CrossRef]
  152. Zhu, X.-D.; Chen, J.-S.; Zhou, F.; Liu, Q.-C.; Chen, G.; Zhang, J.-M. Detection of Copeptin in Peripheral Blood of Patients with Aneurysmal Subarachnoid Hemorrhage. Crit. Care 2011, 15, R288. [Google Scholar] [CrossRef] [Green Version]
  153. Staub, D.; Morgenthaler, N.G.; Buser, C.; Breidthardt, T.; Potocki, M.; Noveanu, M.; Reichlin, T.; Bergmann, A.; Mueller, C. Use of Copeptin in the Detection of Myocardial Ischemia. Clin. Chim. Acta 2009, 399, 69–73. [Google Scholar] [CrossRef]
  154. Struck, J.; Morgenthaler, N.G.; Bergmann, A. Copeptin, a Stable Peptide Derived from the Vasopressin Precursor, Is Elevated in Serum of Sepsis Patients. Peptides 2005, 26, 2500–2504. [Google Scholar] [CrossRef]
  155. Jochberger, S.; Morgenthaler, N.G.; Mayr, V.D.; Luckner, G.; Wenzel, V.; Ulmer, H.; Schwarz, S.; Hasibeder, W.R.; Friesenecker, B.E.; Dünser, M.W. Copeptin and Arginine Vasopressin Concentrations in Critically Ill Patients. J. Clin. Endocrinol. Metab. 2006, 91, 4381–4386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  156. Williams, K.P.; Liu, X.H.; Schumacher, T.N.; Lin, H.Y.; Ausiello, D.A.; Kim, P.S.; Bartel, D.P. Bioactive and Nuclease-Resistant L-DNA Ligand of Vasopressin. Proc. Natl. Acad. Sci. USA 1997, 94, 11285–11290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  157. Simpson, R.J.; Hammacher, A.; Smith, D.K.; Matthews, J.M.; Ward, L.D. Interleukin-6: Structure-Function Relationships. Protein Sci. 1997, 6, 929–955. [Google Scholar] [CrossRef] [PubMed]
  158. Lotz, M. Interleukin-6: A Comprehensive Review. In Cancer Treatment and Research; Springer: Boston, MA, USA, 1995; pp. 209–233. [Google Scholar]
  159. Haegeman, G.; Content, J.; Volckaert, G.; Derynck, R.; Tavernier, J.; Fiers, W. Structural Analysis of the Sequence Coding for an Inducible 26-KDa Protein in Human Fibroblasts. Eur. J. Biochem. 1986, 159, 625–632. [Google Scholar] [CrossRef] [PubMed]
  160. Uciechowski, P.; Dempke, W.C.M. Interleukin-6: A Masterplayer in the Cytokine Network. Oncology 2020, 98, 131–137. [Google Scholar] [CrossRef]
  161. Abeywardena, M.; Leifert, W.; Warnes, K.; Varghese, J.; Head, R. Cardiovascular Biology of Interleukin-6. Curr. Pharm. Des. 2009, 15, 1809–1821. [Google Scholar] [CrossRef] [Green Version]
  162. Kanda, T.; Takahashi, T. Interleukin-6 and Cardiovascular Diseases. Jpn. Heart J. 2004, 45, 183–193. [Google Scholar] [CrossRef] [Green Version]
  163. Deswal, A.; Petersen, N.J.; Feldman, A.M.; Young, J.B.; White, B.G.; Mann, D.L. Cytokines and Cytokine Receptors in Advanced Heart Failure. Circulation 2001, 103, 2055–2059. [Google Scholar] [CrossRef] [Green Version]
  164. Geppert, A.; Dorninger, A.; Delle-Karth, G.; Zorn, G.; Heinz, G.; Huber, K. Plasma Concentrations of Interleukin-6, Organ Failure, Vasopressor Support, and Successful Coronary Revascularization in Predicting 30-Day Mortality of Patients with Cardiogenic Shock Complicating Acute Myocardial Infarction. Crit. Care Med. 2006, 34, 2035–2042. [Google Scholar] [CrossRef]
  165. Khozeymeh, F.; Mortazavi, M.; Khalighinejad, N.; Akhavankhaleghi, M.; Alikhani, M. Salivary Levels of Interleukin-6 and Tumor Necrosis Factor-α in Patients Undergoing Hemodialysis. Dent. Res. J. 2016, 13, 69. [Google Scholar] [CrossRef]
  166. Aleksandra Nielsen, A.; Nederby Nielsen, J.; Schmedes, A.; Brandslund, I.; Hey, H. Saliva Interleukin-6 in Patients with Inflammatory Bowel Disease. Scand. J. Gastroenterol. 2005, 40, 1444–1448. [Google Scholar] [CrossRef] [PubMed]
  167. Javaid, M.A.; Ahmed, A.S.; Durand, R.; Tran, S.D. Saliva as a Diagnostic Tool for Oral and Systemic Diseases. J. Oral Biol. Craniofacial Res. 2016, 6, 67–76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  168. Jackson, K.; Rao, V.; Hanberg, J.; Mahoney, D.; Chunara, Z.; Thomas, D.; Hodson, D.; Tarleton, C.; Chen, M.; Jacoby, D.; et al. Inflammation and Cardio-Renal Interactions in Heart Failure: A Potential Role for Interleukin-6. J. Card. Fail. 2017, 23, S25. [Google Scholar] [CrossRef] [Green Version]
  169. Kim, M.; Jeoung, Y.H.; Lee, S.J.; Choi, I.; Pyun, K.H.; Lee, Y. In Vitro Selection of DNA Aptamers Binding to the Recombinant Human Interleukin-6. Mol. Cells 1995, 5, 555–562. [Google Scholar]
  170. Tertis, M.; Leva, P.I.; Bogdan, D.; Suciu, M.; Graur, F.; Cristea, C. Impedimetric Aptasensor for the Label-Free and Selective Detection of Interleukin-6 for Colorectal Cancer Screening. Biosens. Bioelectron. 2019, 137, 123–132. [Google Scholar] [CrossRef]
  171. Spiridonova, V.A.; Novikova, T.M.; Snigirev, O.V. Obtaining DNA Aptamers to Human Interleukin-6 for Biomagnetic Immunoassay Nanosensors. Moscow Univ. Phys. Bull. 2016, 71, 135–138. [Google Scholar] [CrossRef]
  172. Tertiş, M.; Ciui, B.; Suciu, M.; Săndulescu, R.; Cristea, C. Label-Free Electrochemical Aptasensor Based on Gold and Polypyrrole Nanoparticles for Interleukin 6 Detection. Electrochim. Acta 2017, 258, 1208–1218. [Google Scholar] [CrossRef]
  173. Chen, N.; Yang, H.; Li, Q.; Song, L.; Gopinath, S.C.B.; Wu, D. An Interdigitated Aptasensor to Detect Interleukin-6 for Diagnosing Rheumatoid Arthritis in Serum. Biotechnol. Appl. Biochem. 2020, 68, 1479–1485. [Google Scholar] [CrossRef]
  174. Rhinehardt, K.L.; Vance, S.A.; Mohan, R.V.; Sandros, M.; Srinivas, G. Molecular Modeling and SPRi Investigations of Interleukin 6 (IL6) Protein and DNA Aptamers. J. Biomol. Struct. Dyn. 2018, 36, 1934–1947. [Google Scholar] [CrossRef]
  175. Muhammad, M.; Shao, C.; Huang, Q. Aptamer-Functionalized Au Nanoparticles Array as the Effective SERS Biosensor for Label-Free Detection of Interleukin-6 in Serum. Sens. Actuators B Chem. 2021, 334, 129607. [Google Scholar] [CrossRef]
  176. Giorgi-Coll, S.; Marín, M.J.; Sule, O.; Hutchinson, P.J.; Carpenter, K.L.H. Aptamer-Modified Gold Nanoparticles for Rapid Aggregation-Based Detection of Inflammation: An Optical Assay for Interleukin-6. Microchim. Acta 2020, 187, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  177. Locke, A.K.; Norwood, N.; Marks, H.L.; Schechinger, M.; Jackson, G.W.; Graham, D.; Coté, G.L. Aptamer Conjugated Silver Nanoparticles for the Detection of Interleukin 6; Vo-Dinh, T., Lakowicz, J.R., Eds.; SPIE: San Francisco, CA, USA, 2016; p. 972412. [Google Scholar] [CrossRef] [Green Version]
  178. Khosravi, F.; Loeian, S.; Panchapakesan, B. Ultrasensitive Label-Free Sensing of IL-6 Based on PASE Functionalized Carbon Nanotube Micro-Arrays with RNA-Aptamers as Molecular Recognition Elements. Biosensors 2017, 7, 17. [Google Scholar] [CrossRef] [PubMed]
  179. Khan, N.I.; Song, E. Detection of an IL-6 Biomarker Using a GFET Platform Developed with a Facile Organic Solvent-Free Aptamer Immobilization Approach. Sensors 2021, 21, 1335. [Google Scholar] [CrossRef]
  180. Hammacher, A.; Ward, L.D.; Simpson, R.J.; Weinstock, J.; Treutlein, H.; Yasukawa, K. Structure-Function Analysis of Human IL-6: Identification of Two Distinct Regions That Are Important for Receptor Binding. Protein Sci. 1994, 3, 2280–2293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  181. Gupta, S.; Hirota, M.; Waugh, S.M.; Murakami, I.; Suzuki, T.; Muraguchi, M.; Shibamori, M.; Ishikawa, Y.; Jarvis, T.C.; Carter, J.D.; et al. Chemically Modified DNA Aptamers Bind Interleukin-6 with High Affinity and Inhibit Signaling by Blocking Its Interaction with Interleukin-6 Receptor. J. Biol. Chem. 2014, 289, 8706–8719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  182. Gelinas, A.D.; Davies, D.R.; Edwards, T.E.; Rohloff, J.C.; Carter, J.D.; Zhang, C.; Gupta, S.; Ishikawa, Y.; Hirota, M.; Nakaishi, Y.; et al. Crystal Structure of Interleukin-6 in Complex with a Modified Nucleic Acid Ligand. J. Biol. Chem. 2014, 289, 8720–8734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  183. Sproston, N.R.; Ashworth, J.J. Role of C-Reactive Protein at Sites of Inflammation and Infection. Front. Immunol. 2018, 9, 754. [Google Scholar] [CrossRef]
  184. Sheriff, A.; Kayser, S.; Brunner, P.; Vogt, B. C-Reactive Protein Triggers Cell Death in Ischemic Cells. Front. Immunol. 2021, 12. [Google Scholar] [CrossRef]
  185. Avan, A.; Tavakoly Sany, S.B.; Ghayour-Mobarhan, M.; Rahimi, H.R.; Tajfard, M.; Ferns, G. Serum C-reactive Protein in the Prediction of Cardiovascular Diseases: Overview of the Latest Clinical Studies and Public Health Practice. J. Cell. Physiol. 2018, 233, 8508–8525. [Google Scholar] [CrossRef]
  186. Castro, A.R.; Silva, S.O.; Soares, S.C. The Use of High Sensitivity C-Reactive Protein in Cardiovascular Disease Detection. J. Pharm. Pharm. Sci. 2018, 21, 496–503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  187. Sohrabi, H.; kholafazad Kordasht, H.; Pashazadeh-Panahi, P.; Nezhad-Mokhtari, P.; Hashemzaei, M.; Majidi, M.R.; Mosafer, J.; Oroojalian, F.; Mokhtarzadeh, A.; de la Guardia, M. Recent Advances of Electrochemical and Optical Biosensors for Detection of C-Reactive Protein as a Major Inflammatory Biomarker. Microchem. J. 2020, 158, 105287. [Google Scholar] [CrossRef]
  188. Pay, J.B.; Shaw, A.M. Towards Salivary C-Reactive Protein as a Viable Biomarker of Systemic Inflammation. Clin. Biochem. 2019, 68, 1–8. [Google Scholar] [CrossRef] [PubMed]
  189. Marimuthu, S. Association of Urine Levels of C-Reactive Protein with Clinical Outcomes in Patients with Pneumonia: A Pilot Study. J. Respir. Infect. 2019, 3, 2. [Google Scholar] [CrossRef]
  190. Oh, T.K.; Song, I.-A.; Lee, J.H. Clinical Usefulness of C-Reactive Protein to Albumin Ratio in Predicting 30-Day Mortality in Critically Ill Patients: A Retrospective Analysis. Sci. Rep. 2018, 8, 14977. [Google Scholar] [CrossRef]
  191. Bini, A.; Centi, S.; Tombelli, S.; Minunni, M.; Mascini, M. Development of an Optical RNA-Based Aptasensor for C-Reactive Protein. Anal. Bioanal. Chem. 2008, 390, 1077–1086. [Google Scholar] [CrossRef]
  192. Orito, N.; Umekage, S.; Sato, K.; Kawauchi, S.; Tanaka, H.; Sakai, E.; Tanaka, T.; Kikuchi, Y. High-Affinity RNA Aptamers to C-Reactive Protein (CRP): Newly Developed Pre-Elution Methods for Aptamer Selection. J. Phys. Conf. Ser. 2012, 352, 012042. [Google Scholar] [CrossRef]
  193. Yang, X.; Wang, Y.; Wang, K.; Wang, Q.; Wang, P.; Lin, M.; Chen, N.; Tan, Y. DNA Aptamer-Based Surface Plasmon Resonance Sensing of Human C-Reactive Protein. RSC Adv. 2014, 4, 30934–30937. [Google Scholar] [CrossRef]
  194. Wu, B.; Jiang, R.; Wang, Q.; Huang, J.; Yang, X.; Wang, K.; Li, W.; Chen, N.; Li, Q. Detection of C-Reactive Protein Using Nanoparticle-Enhanced Surface Plasmon Resonance Using an Aptamer-Antibody Sandwich Assay. Chem. Commun. 2016, 52, 3568–3571. [Google Scholar] [CrossRef] [Green Version]
  195. Huang, C.-J.; Lin, H.-I.; Shiesh, S.-C.; Lee, G.-B. Integrated Microfluidic System for Rapid Screening of CRP Aptamers Utilizing Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Biosens. Bioelectron. 2010, 25, 1761–1766. [Google Scholar] [CrossRef]
  196. Lee, W.-B.; Chen, Y.-H.; Lin, H.-I.; Shiesh, S.-C.; Lee, G.-B. An Integrated Microfluidic System for Fast, Automatic Detection of C-Reactive Protein. Sensors Actuators B Chem. 2011, 157, 710–721. [Google Scholar] [CrossRef]
  197. Liu, Z.; Luo, D.; Ren, F.; Ran, F.; Chen, W.; Zhang, B.; Wang, C.; Chen, H.; Wei, J.; Chen, Q. Ultrasensitive Fluorescent Aptasensor for CRP Detection Based on the RNase H Assisted DNA Recycling Signal Amplification Strategy. RSC Adv. 2019, 9, 11960–11967. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  198. Zubiate, P.; Zamarreño, C.R.; Sánchez, P.; Matias, I.R.; Arregui, F.J. High Sensitive and Selective C-Reactive Protein Detection by Means of Lossy Mode Resonance Based Optical Fiber Devices. Biosens. Bioelectron. 2017, 93, 176–181. [Google Scholar] [CrossRef] [PubMed]
  199. Wang, Z.; Dong, P.; Sun, Z.; Sun, C.; Bu, H.; Han, J.; Chen, S.; Xie, G. NH 2 -Ni-MOF Electrocatalysts with Tunable Size/Morphology for Ultrasensitive C-Reactive Protein Detection via an Aptamer Binding Induced DNA Walker–antibody Sandwich Assay. J. Mater. Chem. B 2018, 6, 2426–2431. [Google Scholar] [CrossRef] [PubMed]
  200. Lai, J.-C.; Hong, C.-Y. Magnetic-Assisted Rapid Aptamer Selection (MARAS) for Generating High-Affinity DNA Aptamer Using Rotating Magnetic Fields. ACS Comb. Sci. 2014, 16, 321–327. [Google Scholar] [CrossRef]
  201. Lai, J.-C.; Hong, C.-Y. A Novel Protocol for Generating High-Affinity SsDNA Aptamers by Using Alternating Magnetic Fields. J. Mater. Chem. B 2014, 2, 4114–4121. [Google Scholar] [CrossRef] [PubMed]
  202. Tsao, S.-M.; Lai, J.-C.; Horng, H.-E.; Liu, T.-C.; Hong, C.-Y. Generation of Aptamers from A Primer-Free Randomized SsDNA Library Using Magnetic-Assisted Rapid Aptamer Selection. Sci. Rep. 2017, 7, 45478. [Google Scholar] [CrossRef] [Green Version]
  203. Vance, S.A.; Sandros, M.G. Zeptomole Detection of C-Reactive Protein in Serum by a Nanoparticle Amplified Surface Plasmon Resonance Imaging Aptasensor. Sci. Rep. 2015, 4, 5129. [Google Scholar] [CrossRef] [Green Version]
  204. Hwang, J.; Seo, Y.; Jo, Y.; Son, J.; Choi, J. Aptamer-Conjugated Live Human Immune Cell Based Biosensors for the Accurate Detection of C-Reactive Protein. Sci. Rep. 2016, 6, 34778. [Google Scholar] [CrossRef] [Green Version]
  205. Eid, C.; Palko, J.W.; Katilius, E.; Santiago, J.G. Rapid Slow Off-Rate Modified Aptamer (SOMAmer)-Based Detection of C-Reactive Protein Using Isotachophoresis and an Ionic Spacer. Anal. Chem. 2015, 87, 6736–6743. [Google Scholar] [CrossRef]
  206. Minagawa, H.; Kataoka, Y.; Fujita, H.; Kuwahara, M.; Horii, K.; Shiratori, I.; Waga, I. Modified DNA Aptamers for C-Reactive Protein and Lactate Dehydrogenase-5 with Sub-Nanomolar Affinities. Int. J. Mol. Sci. 2020, 21, 2683. [Google Scholar] [CrossRef] [PubMed]
  207. Tang, M.-Q.; Xie, J.; Rao, L.-M.; Kan, Y.-J.; Luo, P.; Qing, L.-S. Advances in Aptamer-Based Sensing Assays for C-Reactive Protein. Anal. Bioanal. Chem. 2022, 414, 867–884. [Google Scholar] [CrossRef] [PubMed]
  208. António, M.; Ferreira, R.; Vitorino, R.; Daniel-da-Silva, A.L. A Simple Aptamer-Based Colorimetric Assay for Rapid Detection of C-Reactive Protein Using Gold Nanoparticles. Talanta 2020, 214, 120868. [Google Scholar] [CrossRef] [PubMed]
  209. Kao, W.-C.; Chu, C.-H.; Chang, W.-H.; Wang, Y.-L.; Lee, G.-B. Dual-Aptamer Assay for C-Reactive Protein Detection by Using Field-Effect Transistors on an Integrated Microfluidic System. In Proceedings of the 2016 IEEE 11th Annual International Conference on Nano/Micro Engineered and Molecular Systems (NEMS), Sendai, Japan, 17–20 April 2016; pp. 583–586. [Google Scholar]
  210. Kalliolias, G.D.; Ivashkiv, L.B. TNF Biology, Pathogenic Mechanisms and Emerging Therapeutic Strategies. Nat. Rev. Rheumatol. 2016, 12, 49–62. [Google Scholar] [CrossRef]
  211. Beutler, B.; Cerami, A. The Biology of Cachectin/TNF—A Primary Mediator of the Host Response. Annu. Rev. Immunol. 1989, 7, 625–655. [Google Scholar] [CrossRef]
  212. Zhang, H.; Park, Y.; Wu, J.; Chen, X.P.; Lee, S.; Yang, J.; Dellsperger, K.C.; Zhang, C. Role of TNF-α in Vascular Dysfunction. Clin. Sci. 2009, 116, 219–230. [Google Scholar] [CrossRef] [Green Version]
  213. Collier, P.; Watson, C.J.; Voon, V.; Phelan, D.; Jan, A.; Mak, G.; Martos, R.; Baugh, J.A.; Ledwidge, M.T.; McDonald, K.M. Can Emerging Biomarkers of Myocardial Remodelling Identify Asymptomatic Hypertensive Patients at Risk for Diastolic Dysfunction and Diastolic Heart Failure? Eur. J. Heart Fail. 2011, 13, 1087–1095. [Google Scholar] [CrossRef] [Green Version]
  214. Rammos, A.; Bechlioulis, A.; Kalogeras, P.; Tripoliti, E.E.; Goletsis, Y.; Kalivi, A.; Blathra, E.; Salvo, P.; Trivella, M.G.; Lomonaco, T.; et al. Salivary Biomarkers for Diagnosis and Therapy Monitoring in Patients with Heart Failure. A Systematic Review. Diagnostics 2021, 11, 824. [Google Scholar] [CrossRef]
  215. Sirera, R.; Salvador, A.; Roldán, I.; Talens, R.; González-Molina, A.; Rivera, M. Quantification of Proinflammatory Cytokines in the Urine of Congestive Heart Failure Patients. Its Relationship with Plasma Levels. Eur. J. Heart Fail. 2003, 5, 27–31. [Google Scholar] [CrossRef] [Green Version]
  216. Orava, E.W.; Jarvik, N.; Shek, Y.L.; Sidhu, S.S.; Gariépy, J. A Short DNA Aptamer That Recognizes TNFα and Blocks Its Activity in Vitro. ACS Chem. Biol. 2013, 8, 170–178. [Google Scholar] [CrossRef]
  217. Kim, J.; Park, H.; Saravanakumar, G.; Kim, W.J. Polymer/Aptamer-Integrated Gold Nanoconstruct Suppresses the Inflammatory Process by Scavenging ROS and Capturing Pro-Inflammatory Cytokine TNF-α. ACS Appl. Mater. Interfaces 2021, 13, 9390–9401. [Google Scholar] [CrossRef] [PubMed]
  218. Lai, W.-Y.; Wang, J.-W.; Huang, B.-T.; Lin, E.P.-Y.; Yang, P.-C. A Novel TNF-α-Targeting Aptamer for TNF-α-Mediated Acute Lung Injury and Acute Liver Failure. Theranostics 2019, 9, 1741–1751. [Google Scholar] [CrossRef] [PubMed]
  219. Mashayekhi, K.; Ganji, A.; Sankian, M. Designing a New Dimerized Anti Human TNF-α Aptamer with Blocking Activity. Biotechnol. Prog. 2020, 36, e2969. [Google Scholar] [CrossRef]
  220. Yan, X.; Gao, X.; Zhang, Z. Isolation and Characterization of 2′-Amino-Modified RNA Aptamers for Human TNFα. Genomics. Proteom. Bioinform. 2004, 2, 32–42. [Google Scholar] [CrossRef] [Green Version]
  221. Hosseini Ghalehno, M.; Mirzaei, M.; Torkzadeh-Mahani, M. Electrochemical Aptasensor for Tumor Necrosis Factor α Using Aptamer–antibody Sandwich Structure and Cobalt Hexacyanoferrate for Signal Amplification. J. Iran. Chem. Soc. 2019, 16, 1783–1791. [Google Scholar] [CrossRef]
  222. Ghalehno, M.H.; Mirzaei, M.; Torkzadeh-Mahani, M. Aptamer-Based Determination of Tumor Necrosis Factor α Using a Screen-Printed Graphite Electrode Modified with Gold Hexacyanoferrate. Microchim. Acta 2018, 185, 165. [Google Scholar] [CrossRef]
  223. Hao, Z.; Wang, Z.; Li, Y.; Zhu, Y.; Wang, X.; De Moraes, C.G.; Pan, Y.; Zhao, X.; Lin, Q. Measurement of Cytokine Biomarkers Using an Aptamer-Based Affinity Graphene Nanosensor on a Flexible Substrate toward Wearable Applications. Nanoscale 2018, 10, 21681–21688. [Google Scholar] [CrossRef]
  224. Ghosh, S.; Datta, D.; Chaudhry, S.; Dutta, M.; Stroscio, M.A. Rapid Detection of Tumor Necrosis Factor-Alpha Using Quantum Dot-Based Optical Aptasensor. IEEE Trans. Nanobioscience 2018, 17, 417–423. [Google Scholar] [CrossRef]
  225. Gao, S.; Cheng, Y.; Zhang, S.; Zheng, X.; Wu, J. A Biolayer Interferometry-Based, Aptamer–antibody Receptor Pair Biosensor for Real-Time, Sensitive, and Specific Detection of the Disease Biomarker TNF-α. Chem. Eng. J. 2022, 433, 133268. [Google Scholar] [CrossRef]
  226. Liu, Y.; Zhou, Q.; Revzin, A. An Aptasensor for Electrochemical Detection of Tumor Necrosis Factor in Human Blood. Analyst 2013, 138, 4321. [Google Scholar] [CrossRef]
  227. Liu, Y.; Kwa, T.; Revzin, A. Simultaneous Detection of Cell-Secreted TNF-α and IFN-γ Using Micropatterned Aptamer-Modified Electrodes. Biomaterials 2012, 33, 7347–7355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  228. Wang, J.; Yu, J.; Yang, Q.; McDermott, J.; Scott, A.; Vukovich, M.; Lagrois, R.; Gong, Q.; Greenleaf, W.; Eisenstein, M.; et al. Multiparameter Particle Display (MPPD): A Quantitative Screening Method for the Discovery of Highly Specific Aptamers. Angew. Chemie Int. Ed. 2017, 56, 744–747. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  229. Liu, L.; Liu, F.; Jiang, D.; Xiang, G.; Liu, C.; Yang, J.; Pu, X. Hybridization Chain Reaction and Target Recycling Enhanced Tumor Necrosis Factor Alpha Aptasensor with Host-Guest Interaction for Signal Probe Collection. Sens. Actuators B Chem. 2016, 231, 680–687. [Google Scholar] [CrossRef]
  230. Suthahar, N.; Meijers, W.C.; Silljé, H.H.W.; Ho, J.E.; Liu, F.-T.; de Boer, R.A. Galectin-3 Activation and Inhibition in Heart Failure and Cardiovascular Disease: An Update. Theranostics 2018, 8, 593–609. [Google Scholar] [CrossRef] [PubMed]
  231. Christenson, R.H.; Duh, S.-H.; Wu, A.H.B.; Smith, A.; Abel, G.; DeFilippi, C.R.; Wang, S.; Adourian, A.; Adiletto, C.; Gardiner, P. Multi-Center Determination of Galectin-3 Assay Performance Characteristics. Clin. Biochem. 2010, 43, 683–690. [Google Scholar] [CrossRef] [PubMed]
  232. Gruson, D.; Mancini, M.; Ahn, S.A.; Rousseau, M.F. Galectin-3 Testing: Validity of a Novel Automated Assay in Heart Failure Patients with Reduced Ejection Fraction. Clin. Chim. Acta 2014, 429, 189–193. [Google Scholar] [CrossRef] [PubMed]
  233. Gruson, D.; Mancini, M.; Ahn, S.A.; Rousseau, M.F. Measurement of Galectin-3 with the ARCHITECT Assay: Clinical Validity and Cost-Effectiveness in Patients with Heart Failure. Clin. Biochem. 2014, 47, 1006–1009. [Google Scholar] [CrossRef] [PubMed]
  234. McCullough, P.A.; Olobatoke, A.; Vanhecke, T.E. Galectin-3: A Novel Blood Test for the Evaluation and Management of Patients With Heart Failure. Rev. Cardiovasc. Med. 2011, 12, 200–210. [Google Scholar] [CrossRef]
  235. Giamdzhian, K.A.; Kukes, V.G. The Role of Galectin-3 in the Diagnosis and Control of the Effectiveness of Pharmacotherapy of Chronic Heart Failure. CardioSomatics 2017, 8, 5–10. [Google Scholar] [CrossRef]
  236. Zhong, X.; Qian, X.; Chen, G.; Song, X. The Role of Galectin-3 in Heart Failure and Cardiovascular Disease. Clin. Exp. Pharmacol. Physiol. 2019, 46, 197–203. [Google Scholar] [CrossRef] [Green Version]
  237. Ip, C.; Luk, K.S.; Yuen, V.L.C.; Chiang, L.; Chan, C.K.; Ho, K.; Gong, M.; Lee, T.T.L.; Leung, K.S.K.; Roever, L.; et al. Soluble Suppression of Tumorigenicity 2 (SST2) for Predicting Disease Severity or Mortality Outcomes in Cardiovascular Diseases: A Systematic Review and Meta-Analysis. IJC Heart Vasc. 2021, 37, 100887. [Google Scholar] [CrossRef] [PubMed]
  238. Li, M.; Duan, L.; Cai, Y.; Hao, B.; Chen, J.; Li, H.; Liu, H. Prognostic Value of Soluble Suppression of Tumorigenesis-2 (SST2) for Cardiovascular Events in Coronary Artery Disease Patients with and without Diabetes Mellitus. Cardiovasc. Diabetol. 2021, 20, 49. [Google Scholar] [CrossRef] [PubMed]
  239. Soyfoo, M.S.; Nicaise, C. Pathophysiologic Role of Interleukin-33/ST2 in Sjögren’s Syndrome. Autoimmun. Rev. 2021, 20, 102756. [Google Scholar] [CrossRef]
  240. Emdin, M.; Aimo, A.; Vergaro, G.; Bayes-Genis, A.; Lupón, J.; Latini, R.; Meessen, J.; Anand, I.S.; Cohn, J.N.; Gravning, J.; et al. SST2 Predicts Outcome in Chronic Heart Failure Beyond NT−proBNP and High-Sensitivity Troponin T. J. Am. Coll. Cardiol. 2018, 72, 2309–2320. [Google Scholar] [CrossRef] [PubMed]
  241. Altara, R.; Ghali, R.; Mallat, Z.; Cataliotti, A.; Booz, G.W.; Zouein, F.A. Conflicting Vascular and Metabolic Impact of the IL-33/SST2 Axis. Cardiovasc. Res. 2018, 114, 1578–1594. [Google Scholar] [CrossRef] [Green Version]
  242. O’Donoghue, M.L.; Morrow, D.A.; Cannon, C.P.; Jarolim, P.; Desai, N.R.; Sherwood, M.W.; Murphy, S.A.; Gerszten, R.E.; Sabatine, M.S. Multimarker Risk Stratification in Patients With Acute Myocardial Infarction. J. Am. Heart Assoc. 2016, 5, e002586. [Google Scholar] [CrossRef] [Green Version]
  243. Aleksova, A.; Paldino, A.; Beltrami, A.; Padoan, L.; Iacoviello, M.; Sinagra, G.; Emdin, M.; Maisel, A. Cardiac Biomarkers in the Emergency Department: The Role of Soluble ST2 (SST2) in Acute Heart Failure and Acute Coronary Syndrome—There Is Meat on the Bone. J. Clin. Med. 2019, 8, 270. [Google Scholar] [CrossRef] [Green Version]
  244. Chow, S.L.; Maisel, A.S.; Anand, I.; Bozkurt, B.; de Boer, R.A.; Felker, G.M.; Fonarow, G.C.; Greenberg, B.; Januzzi, J.L.; Kiernan, M.S.; et al. Role of Biomarkers for the Prevention, Assessment, and Management of Heart Failure: A Scientific Statement From the American Heart Association. Circulation 2017, 135, e1054–e1091. [Google Scholar] [CrossRef]
  245. Januzzi, J.L.; Mebazaa, A.; Di Somma, S. ST2 and Prognosis in Acutely Decompensated Heart Failure: The International ST2 Consensus Panel. Am. J. Cardiol. 2015, 115, 26B–31B. [Google Scholar] [CrossRef]
  246. Aimo, A.; Vergaro, G.; Passino, C.; Ripoli, A.; Ky, B.; Miller, W.L.; Bayes-Genis, A.; Anand, I.; Januzzi, J.L.; Emdin, M. Prognostic Value of Soluble Suppression of Tumorigenicity-2 in Chronic Heart Failure. JACC Heart Fail. 2017, 5, 280–286. [Google Scholar] [CrossRef]
  247. Gentile, F.; Aimo, A.; Jannuzzi, J.L.; Richards, M.; Lam, C.S.; De Boer, R.A.; Meems, L.M.; Latini, R.; Staszewsky, L.; Anand, I.S.; et al. 41 Circulating Levels and Prognostic Cut-Offs of SST2, High-Sensitivity Troponin T, and NT-ProBNP in Women vs. Men with Chronic Heart Failure. Eur. Heart J. Suppl. 2021, 23, suab139-017. [Google Scholar] [CrossRef]
  248. You, M.; Lin, M.; Gong, Y.; Wang, S.; Li, A.; Ji, L.; Zhao, H.; Ling, K.; Wen, T.; Huang, Y.; et al. Household Fluorescent Lateral Flow Strip Platform for Sensitive and Quantitative Prognosis of Heart Failure Using Dual-Color Upconversion Nanoparticles. ACS Nano 2017, 11, 6261–6270. [Google Scholar] [CrossRef] [PubMed]
  249. Mueller, T.; Jaffe, A.S. Soluble ST2—Analytical Considerations. Am. J. Cardiol. 2015, 115, 8B–21B. [Google Scholar] [CrossRef] [PubMed]
  250. Breitbart, A.; Auger-Messier, M.; Molkentin, J.D.; Heineke, J. Myostatin from the Heart: Local and Systemic Actions in Cardiac Failure and Muscle Wasting. Am. J. Physiol. Circ. Physiol. 2011, 300, H1973–H1982. [Google Scholar] [CrossRef]
  251. Butcher, J.T.; Ali, M.I.; Ma, M.W.; McCarthy, C.G.; Islam, B.N.; Fox, L.G.; Mintz, J.D.; Larion, S.; Fulton, D.J.; Stepp, D.W. Effect of Myostatin Deletion on Cardiac and Microvascular Function. Physiol. Rep. 2017, 5, e13525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  252. George, I.; Bish, L.T.; Kamalakkannan, G.; Petrilli, C.M.; Oz, M.C.; Naka, Y.; Lee Sweeney, H.; Maybaum, S. Myostatin Activation in Patients with Advanced Heart Failure and after Mechanical Unloading. Eur. J. Heart Fail. 2010, 12, 444–453. [Google Scholar] [CrossRef]
  253. Sharma, M.; Kambadur, R.; Matthews, K.G.; Somers, W.G.; Devlin, G.P.; Conaglen, J.V.; Fowke, P.J.; Bass, J.J. Myostatin, a Transforming Growth Factor-Beta Superfamily Member, Is Expressed in Heart Muscle and Is Upregulated in Cardiomyocytes after Infarct. J. Cell. Physiol. 1999, 180, 1–9. [Google Scholar] [CrossRef]
  254. Meloux, A.; Rochette, L.; Maza, M.; Bichat, F.; Tribouillard, L.; Cottin, Y.; Zeller, M.; Vergely, C. Growth Differentiation Factor-8 (GDF8)/Myostatin Is a Predictor of Troponin I Peak and a Marker of Clinical Severity after Acute Myocardial Infarction. J. Clin. Med. 2019, 9, 116. [Google Scholar] [CrossRef] [Green Version]
  255. Gruson, D.; Ahn, S.A.; Ketelslegers, J.-M.; Rousseau, M.F. Increased Plasma Myostatin in Heart Failure. Eur. J. Heart Fail. 2011, 13, 734–736. [Google Scholar] [CrossRef]
  256. Chen, P.; Liu, Z.; Luo, Y.; Chen, L.; Li, S.; Pan, Y.; Lei, X.; Wu, D.; Xu, D. Predictive Value of Serum Myostatin for the Severity and Clinical Outcome of Heart Failure. Eur. J. Intern. Med. 2019, 64, 33–40. [Google Scholar] [CrossRef]
  257. Wirtz, T.H.; Loosen, S.H.; Buendgens, L.; Kurt, B.; Abu Jhaisha, S.; Hohlstein, P.; Brozat, J.F.; Weiskirchen, R.; Luedde, T.; Tacke, F.; et al. Low Myostatin Serum Levels Are Associated with Poor Outcome in Critically Ill Patients. Diagnostics 2020, 10, 574. [Google Scholar] [CrossRef] [PubMed]
  258. Thompson, D.S.; Ferguson, T.S.; Wilks, R.J.; Phillips, D.I.; Osmond, C.; Samms-Vaughan, M.; Forrester, T.E.; Boyne, M.S. Early-Life Factors Are Associated with Nocturnal Cortisol and Glucose Effectiveness in Afro-Caribbean Young Adults. Clin. Endocrinol. 2015, 82, 352–358. [Google Scholar] [CrossRef] [PubMed]
  259. Peng, L.; Gagliano-Jucá, T.; Pencina, K.M.; Krishnan, S.; Li, Z.; Tracy, R.P.; Jasuja, R.; Bhasin, S. Age Trends in Growth and Differentiation Factor-11 and Myostatin Levels in Healthy Men, and Differential Response to Testosterone, Measured Using Liquid Chromatography–Tandem Mass Spectrometry. J. Gerontol. Ser. A 2022, 77, 763–769. [Google Scholar] [CrossRef] [PubMed]
  260. Egerman, M.A.; Cadena, S.M.; Gilbert, J.A.; Meyer, A.; Nelson, H.N.; Swalley, S.E.; Mallozzi, C.; Jacobi, C.; Jennings, L.L.; Clay, I.; et al. GDF11 Increases with Age and Inhibits Skeletal Muscle Regeneration. Cell Metab. 2015, 22, 164–174. [Google Scholar] [CrossRef] [Green Version]
  261. Ochsner, U.A.; Green, L.S.; Rice, T.P.; Olivas, E.; Janjic, N.; Katilius, E. Targeting Unique Epitopes on Highly Similar Proteins GDF-11 and GDF-8 with Modified DNA Aptamers. Biochemistry 2019, 58, 4632–4640. [Google Scholar] [CrossRef]
  262. Lockhart, S.M.; Saudek, V.; O’Rahilly, S. GDF15: A Hormone Conveying Somatic Distress to the Brain. Endocr. Rev. 2020, 41, bnaa007. [Google Scholar] [CrossRef] [Green Version]
  263. Wang, D.; Day, E.A.; Townsend, L.K.; Djordjevic, D.; Jørgensen, S.B.; Steinberg, G.R. GDF15: Emerging Biology and Therapeutic Applications for Obesity and Cardiometabolic Disease. Nat. Rev. Endocrinol. 2021, 17, 592–607. [Google Scholar] [CrossRef]
  264. Assadi, A.; Zahabi, A.; Hart, R.A. GDF15, an Update of the Physiological and Pathological Roles It Plays: A Review. Pflügers Arch. Eur. J. Physiol. 2020, 472, 1535–1546. [Google Scholar] [CrossRef]
  265. Emmerson, P.J.; Duffin, K.L.; Chintharlapalli, S.; Wu, X. GDF15 and Growth Control. Front. Physiol. 2018, 9, 1712. [Google Scholar] [CrossRef] [Green Version]
  266. Rathnayake, N.; Buhlin, K.; Kjellström, B.; Klinge, B.; Löwbeer, C.; Norhammar, A.; Rydén, L.; Sorsa, T.; Tervahartiala, T.; Gustafsson, A. Saliva and Plasma Levels of Cardiac-Related Biomarkers in Post-Myocardial Infarction Patients. J. Clin. Periodontol. 2017, 44, 692–699. [Google Scholar] [CrossRef]
  267. Thorsteinsdottir, H.; Salvador, C.L.; Mjøen, G.; Lie, A.; Sugulle, M.; Tøndel, C.; Brun, A.; Almaas, R.; Bjerre, A. Growth Differentiation Factor 15 in Children with Chronic Kidney Disease and after Renal Transplantation. Dis. Markers 2020, 2020, 6162892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  268. Perez-Gomez, M.V.; Pizarro-Sanchez, S.; Gracia-Iguacel, C.; Cano, S.; Cannata-Ortiz, P.; Sanchez-Rodriguez, J.; Sanz, A.B.; Sanchez-Niño, M.D.; Ortiz, A. Urinary Growth Differentiation Factor-15 (GDF15) Levels as a Biomarker of Adverse Outcomes and Biopsy Findings in Chronic Kidney Disease. J. Nephrol. 2021, 34, 1819–1832. [Google Scholar] [CrossRef] [PubMed]
  269. Simonson, M.S.; Tiktin, M.; Debanne, S.M.; Rahman, M.; Berger, B.; Hricik, D.; Ismail-Beigi, F. The Renal Transcriptome of Db/Db Mice Identifies Putative Urinary Biomarker Proteins in Patients with Type 2 Diabetes: A Pilot Study. Am. J. Physiol. Physiol. 2012, 302, F820–F829. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  270. Adela, R.; Banerjee, S.K. GDF-15 as a Target and Biomarker for Diabetes and Cardiovascular Diseases: A Translational Prospective. J. Diabetes Res. 2015, 2015, 490842. [Google Scholar] [CrossRef] [PubMed]
  271. Echouffo-Tcheugui, J.B.; Daya, N.; Ndumele, C.E.; Matsushita, K.; Hoogeveen, R.C.; Ballantyne, C.M.; Coresh, J.; Shah, A.M.; Selvin, E. Diabetes, GDF-15 and Incident Heart Failure: The Atherosclerosis Risk in Communities Study. Diabetologia 2022, 1–9. [Google Scholar] [CrossRef]
  272. Kraemer, S.; Vaught, J.D.; Bock, C.; Gold, L.; Katilius, E.; Keeney, T.R.; Kim, N.; Saccomano, N.A.; Wilcox, S.K.; Zichi, D.; et al. From SOMAmer-Based Biomarker Discovery to Diagnostic and Clinical Applications: A SOMAmer-Based, Streamlined Multiplex Proteomic Assay. PLoS ONE 2011, 6, e26332. [Google Scholar] [CrossRef] [Green Version]
  273. Gold, L.; Ayers, D.; Bertino, J.; Bock, C.; Bock, A.; Brody, E.N.; Carter, J.; Dalby, A.B.; Eaton, B.E.; Fitzwater, T.; et al. Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery. Nat. Preced. 2010, 5, e15004. [Google Scholar] [CrossRef]
  274. Kukova, L.Z.; Mansour, S.G.; Coca, S.G.; de Fontnouvelle, C.A.; Thiessen-Philbrook, H.R.; Shlipak, M.G.; El-Khoury, J.M.; Parikh, C.R. Comparison of Urine and Plasma Biomarker Concentrations Measured by Aptamer-Based versus Immunoassay Methods in Cardiac Surgery Patients. J. Appl. Lab. Med. 2019, 4, 331–342. [Google Scholar] [CrossRef]
  275. Duo, J.; Chiriac, C.; Huang, R.Y.-C.; Mehl, J.; Chen, G.; Tymiak, A.; Sabbatini, P.; Pillutla, R.; Zhang, Y. Slow Off-Rate Modified Aptamer (SOMAmer) as a Novel Reagent in Immunoassay Development for Accurate Soluble Glypican-3 Quantification in Clinical Samples. Anal. Chem. 2018, 90, 5162–5170. [Google Scholar] [CrossRef]
  276. Michishige, F.; Kanno, K.; Yoshinaga, S.; Hinode, D.; Takehisa, Y.; Yasuoka, S. Effect of Saliva Collection Method on the Concentration of Protein Components in Saliva. J. Med. Investig. 2006, 53, 140–146. [Google Scholar] [CrossRef] [Green Version]
Figure 1. Classification of cardiac biomarkers (adopted from reference [3]). CK-MB—creatine kinase; BNP—B-type natriuretic peptide; NT-proBNP—N-terminal pro-B-type natriuretic peptide; MR-proADM—mid-regional proadrenomedullin; MR-proANP—mid-regional pro-atrial natriuretic peptide; IL-6—interleukin-6; CRP—C-reactive protein; TNFα—tumor necrosis factor alpha; sST2—soluble suppression of tumorigenicity 2; Gal3—galectin-3; GDF8—growth differentiation factor 8; GDF15—growth differentiation factor 15. Aptamers are well established as an analytical tool for the biomarkers highlighted in green; aptamers are known, but not sufficient for practical analysis, for the biomarkers highlighted in yellow. No aptamers are known for the biomarkers in red.
Figure 1. Classification of cardiac biomarkers (adopted from reference [3]). CK-MB—creatine kinase; BNP—B-type natriuretic peptide; NT-proBNP—N-terminal pro-B-type natriuretic peptide; MR-proADM—mid-regional proadrenomedullin; MR-proANP—mid-regional pro-atrial natriuretic peptide; IL-6—interleukin-6; CRP—C-reactive protein; TNFα—tumor necrosis factor alpha; sST2—soluble suppression of tumorigenicity 2; Gal3—galectin-3; GDF8—growth differentiation factor 8; GDF15—growth differentiation factor 15. Aptamers are well established as an analytical tool for the biomarkers highlighted in green; aptamers are known, but not sufficient for practical analysis, for the biomarkers highlighted in yellow. No aptamers are known for the biomarkers in red.
Biomedicines 10 01085 g001
Table 2. Summary of aptamer-based detection methods for the most common cardiac biomarkers.
Table 2. Summary of aptamer-based detection methods for the most common cardiac biomarkers.
BiomarkerAptamerAptasensing in Relevant Concentration RangeDual-Aptamer-Based Sandwich DetectionAptasensing in Biological Fluids
SerumWhole BloodSalivaUrine
cTnIDNA, L-DNA+Tro4 + Tro6
Apt 3 + Apt 6
B10 + C6 (L-DNA)
TnAp2t3 + TnAp10
++++
cTnTDNA+Apt.1 + Apt.2+++
MyoglobinDNA+Split aptamer
Myo40-7-27
+++
CK-MBDNA+C.Apt.21 + C.Apt.30+
HFABPDNAN13 + N53
BNPDNA+25c + 2F,
poor selectivity
++
NT-proBNPDNA++
MR-proADM
MR-proANP
Copeptin
IL-6DNA+IL62 + IL63
ATW0077 + ATW0082/ATW0082,
mouse IL-6-specific
+
CRPDNA, RNA++
No aptamer sequences available
+++
TNFαDNA, RNA+++
Gal-3
sST2
GDF8
GDF15
cTnI—cardiac troponin I; cTnT—cardiac troponin T; CK-MB—creatine kinase; BNP—B-type natriuretic peptide; NT-proBNP—N-terminal pro-B-type natriuretic peptide; MR-proADM—mid-regional proadrenomedullin; MR-proANP—mid-regional pro-atrial natriuretic peptide; IL-6—interleukin-6; CRP—C-reactive protein; TNFα—tumor necrosis factor alpha; sST2—soluble suppression of tumorigenicity 2; Gal3—galectin-3; GDF8—growth differentiation factor 8; GDF15—growth differentiation factor 15. “−”—not known, “+”—known.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Komarova, N.; Panova, O.; Titov, A.; Kuznetsov, A. Aptamers Targeting Cardiac Biomarkers as an Analytical Tool for the Diagnostics of Cardiovascular Diseases: A Review. Biomedicines 2022, 10, 1085. https://doi.org/10.3390/biomedicines10051085

AMA Style

Komarova N, Panova O, Titov A, Kuznetsov A. Aptamers Targeting Cardiac Biomarkers as an Analytical Tool for the Diagnostics of Cardiovascular Diseases: A Review. Biomedicines. 2022; 10(5):1085. https://doi.org/10.3390/biomedicines10051085

Chicago/Turabian Style

Komarova, Natalia, Olga Panova, Alexey Titov, and Alexander Kuznetsov. 2022. "Aptamers Targeting Cardiac Biomarkers as an Analytical Tool for the Diagnostics of Cardiovascular Diseases: A Review" Biomedicines 10, no. 5: 1085. https://doi.org/10.3390/biomedicines10051085

APA Style

Komarova, N., Panova, O., Titov, A., & Kuznetsov, A. (2022). Aptamers Targeting Cardiac Biomarkers as an Analytical Tool for the Diagnostics of Cardiovascular Diseases: A Review. Biomedicines, 10(5), 1085. https://doi.org/10.3390/biomedicines10051085

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop