Next Article in Journal
Human Umbilical Mesenchymal Stem Cell Xenografts Repair UV-Induced Photokeratitis in a Rat Model
Next Article in Special Issue
Impact of Lung Microbiota on COPD
Previous Article in Journal
Visualizing 3D Embryo and Tissue Morphology—A Decade of Using High-Resolution Episcopic Microscopy (HREM) in Biomedical Imaging
Previous Article in Special Issue
The Emerging Role of the Gut Microbiome in Cardiovascular Disease: Current Knowledge and Perspectives
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 10
Issue 5
10.3390/biomedicines10051122
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Descriptive Analysis of Circulating Antimicrobial Resistance Genes in Vancomycin-Resistant Enterococcus (VRE) during the COVID-19 Pandemic

by
Dan Alexandru Toc
1,2,
Anca Livia Butiuc-Keul
3,4,*,
Dumitrana Iordache
3,4,
Alexandru Botan
1,
Razvan Marian Mihaila
2,
Carmen Anca Costache
1,2,
Ioana Alina Colosi
1,
Claudia Chiorean
2,
Dan Stefan Neagoe
2,
Liana Gheorghiu
2 and
Lia Monica Junie
1
1
Department of Microbiology, Iuliu Hatieganu University of Medicine and Pharmacy, 400012 Cluj-Napoca, Romania
2
Cluj County Emergency Hospital, 400000 Cluj-Napoca, Romania
3
Department of Molecular Biology and Biotechnology, Faculty of Biology and Geology, Babeş-Bolyai University, 1 M. Kogalniceanu Street, 400084 Cluj-Napoca, Romania
4
Centre for Systems Biology, Biodiversity and Bioresources, Babes-Bolyai University, 5–7 Clinicilor Street, 400006 Cluj-Napoca, Romania
*
Author to whom correspondence should be addressed.
Biomedicines 2022, 10(5), 1122; https://doi.org/10.3390/biomedicines10051122
Submission received: 24 February 2022 / Revised: 25 April 2022 / Accepted: 9 May 2022 / Published: 12 May 2022
(This article belongs to the Special Issue Microbial Ecology in Health and Disease 2.0)
Browse Figures
Versions Notes

Abstract

:
COVID-19 offers ideal premises for bacteria to develop antimicrobial resistance. In this study, we evaluated the presence of several antimicrobial resistance genes (ARG) in vancomycin-resistant Enterococcus (VRE) isolated from rectal swabs from patients at a hospital in Cluj-Napoca, Romania. Rectal swabs were cultivated on CHROMID® VRE (bioMérieux, Marcy—l’ Étoile, France) and positive isolates were identified using MALDI-TOF Mass Spectrometry (Bruker Daltonics, Bremen, Germany) and further analyzed using the PCR technique for the presence of the following ARGs: van A, van B, tet(M), tet(L), ermB, msrA, mefA, aac(6′)-Im, aph(2)-Ib, ant(4′)-Ia, sul1, sul2, sul3, and NDM1. We isolated and identified 68 isolates of Enterococcus faecium and 11 isolates of Enterococcus faecalis. The molecular analysis showed 66 isolates positive for the vanA gene and eight positive for vanB. The most frequent association of ARG in VRE was vanA-tet(M)-ermB. There was no statistically significant difference between Enterococcus faecium and Enterococcus faecalis regarding ARGs. Our work proves that during the COVID-19 pandemic, highly resistant isolates of Enterococcus were present in patients in the intensive care unit; thus, better healthcare policies should be implemented for the management and control of these highly resistant isolates in the future.

1. Introduction

Enterococcus is genus of Gram-positive cocci, commensals of the human gastrointestinal tract. However, Enterococci can produce life-threatening opportunistic infections, particularly nosocomial infections, due to their ability to acquire antimicrobial resistance genes, notably vanA for resistance to glycopeptides. Over the past decades, interest in the Enterococcus genus has spiked, with the most relevant species, Enterococcus faecium and Enterococcus faecalis, being in the spotlight due to their antimicrobial resistance and high adaptability features. Other species of the Enterococcus genus that harbor an intrinsic resistance to glycopeptides, such as Enterococcus gallinarum and Enterococcus caseliflavus, and even other rarer findings such as Enterococcus avium, Enterococcus durans, Enterococcus raffinosus, and Enterococcus cecorum have been approached in several studies to examine their involvement in human infections [1,2,3].
Since its discovery, vancomycin-resistant Enterococcus faecium (VREfm) has been considered as a threat to human healthcare. The vancomycin resistance phenotype is induced by several van operons, with vanA and vanB being the most common [4]. These operons are involved in the alteration of the peptidoglycan, changing the final amino acid sequence with either D-Alanine-D-Lactate (D-Ala-D-Lac) or D-Alanine-D-Serine (D-Ala-D-Ser) and thus altering the affinity of the glycopeptides, followed by the alteration of the peptidoglycan synthesis. Although in the past, the vanA gene was isolated almost everywhere worldwide, with the vanB gene being frequent only in some regions such as Australia, recent studies indicate a change in this pattern and thus the need for extensive research regarding these genes worldwide for a better understanding of their distribution and clinical impact [5,6,7,8].
E. faecium is intrinsically resistant to a large variety of antibiotics, including aminoglycosides and some beta-lactam antibiotics such as cephalosporins. Since vancomycin was used as a last-resort antibiotic in infections with E. faecium for a long time, acquiring vancomycin resistance genes narrows the treatment options to only a few alternatives such as linezolid, tigecycline, or quinupristin/dalfopristin [2]. Recently, there were several isolates of E. faecium reported as resistant even to linezolid. These findings show the high risk VREfm poses to humans from treatment and public health perspectives [9,10,11].
Information regarding the circulating antimicrobial resistance genes in Eastern Europe is scarce, and to promote better surveillance policies for VRE, knowing the existing resistance patterns is essential [8,12]. With this study, we aim to provide information regarding the circulating antimicrobial resistance genes in VRE isolates from hospitalized patients during the fourth wave of COVID-19 in Cluj-Napoca, Romania. Due to the extraordinary impact of the COVID-19 pandemic, we are facing a resurgence of multi-drug-resistant (MDR) bacteria, and we must be prepared to tackle this issue appropriately [13].

2. Materials and Methods

Rectal swabs of patients admitted to Cluj County Emergency Hospital in the intensive care unit between 1 January 2021 and 1 July 2021, during the COVID-19 pandemic, were cultivated on CHROMID® VRE (bioMérieux, Marcy—l’ Étoile, France). Bacterial isolates were obtained from hospital screening samples through routine clinical protocol and patients’ identifiable information was already anonymized. The isolates were further identified with MALDI-TOF Mass Spectrometry (Bruker Daltonics, Bremen, Germany).
To assess the presence of the antimicrobial resistance genes (ARGs), we used a direct PCR technique. Bacterial isolates were incubated overnight on sheep blood agar (bioMérieux, Marcy—l’ Étoile, France) and several colonies were then suspended in 100 mL of sterile water, adjusted to a 0.5 McFarland concentration. DNA isolation was skipped, and bacterial suspension was used as a template in PCR amplification [14,15]. The PCR reaction mix contained 12.5 μL DreamTaq Green PCR master mix (2x) (Thermo Fisher Scientific, Waltham, MA, USA), 10.25 μL nuclease-free water (Lonza, Basel, Switzerland), 25 pmol of each primer (Eurogentec, Liege, Belgium), and 2 μL bacterial suspension, for a total volume of 25 μL. The PCR reactions were performed in the thermocycler Mastercycler Nexus (Eppendorf AG, Hamburg, Germany). The combinations of primers are displayed in Table 1 and the reaction conditions are shown in Table 2. As a negative control, we used 2 µL of sterile water added to the PCR mixture, and as a positive control, we used 2 µL of the suspension with vanA-positive Enterococcus faecium ATCC 700221. The PCR amplification was repeated twice.
The amplicons were separated on 1.5% agarose (Cleaver Scientific, Warwickshire, UK) gel in 1× TBE buffer (Lonza, Basel, Switzerland) and stained with 0.5 μg/mL ethidium bromide (Thermo Fischer Scientific, Waltham, MA, USA). The BDA Digital Compact System and BioDocAnalyze Software (Analytik Jena, Germany) were used for data acquisition. Data analysis was performed with IBM SPSS Statistics 26.0 using statistical tests, chi-square or Fisher’s exact test, where appropriate.

3. Results

We included in this study 79 isolates of Enterococcus that were positive on CHROMID® VRE (bioMérieux, Marcy—l’ Étoile, France), which were further identified as Enterococcus faecalis (11 isolates) and Enterococcus faecium (68 isolates).
Regarding the resistance to glycopeptides, most of the isolates showed the vanA gene (81.8% of E. faecalis and 83.8% of E. faecium). The vanB gene was found only in E. faecium (11.8%). Other ARGs encoding resistance to different antibiotics were also studied, as shown in Table 3. The most frequent ARG was ermB, present in 97.1% of E. faecium isolates and in 81.8% of E. faecalis isolates. The electropherograms of vanA and vanB genes are presented in Figure 1 and Figure 2.
E. faecalis isolates showed different patterns of resistance to different classes of antibiotics (Table 4). The most frequent pattern was vanA-ermB (27.3%) encoding resistance to vancomycin and macrolides; vanA-tetM-ermB (27.3%) encoding resistance to vancomycin, tetracycline, and macrolides; followed by vanA-ermB-ant4la (18.2%) encoding resistance to vancomycin, macrolides, and aminoglycosides. The other associations of antimicrobial resistance genes found in E. faecalis are presented in Table 4.
The most common associations of ARGs in E. faecium were vanA-tetM-ermB (29.4%), vanA-ermB (17.6%), and vanA-ermB-ant4la (14.7%). Other associations are listed in Table 5.
The ARG associations identified in this study are presented briefly in Figure 3, which shows that the most common associations of ARGs identified for each species also represent three out of the four gene associations identified for both E. faecalis and E. faecium.

4. Discussion

In the past few years, there has been a global effort to reduce the impact of antimicrobial resistance. However, since the beginning of the COVID-19 pandemic, the focus has shifted to ways to decrease the complications and mortality of hospitalized patients that burden medical systems worldwide [16,17,18]. Unfortunately, due to the extended duration of the pandemic, several threats are emerging for human health. One of the most important is the risk of acquisition of new antimicrobial resistance genes. There are several reasons why this risk is certain, and Ukuhor et al. summarize some of the most relevant, including the increased use of antibiotics associated with uncontrolled access to them, mainly in developing countries [19]. Moreover, based on the lessons provided by past pandemics, coinfections with different bacteria or fungi are expected. Moreover, several reports underline the impact of associated bacterial and fungal infections in past pandemics, and similar effects are thus expected now [20,21]. The mortality and morbidity in these situations are extremely high if the microorganisms are resistant to several antimicrobial drugs. One bacterium constantly reported as an associated agent is Enterococcus faecium [22]. Rawson et al. underline the importance of a comprehensive analysis of the circulating antimicrobial resistance genes in countries facing the COVID-19 pandemic to install proper guidelines designed for those regions in particular [17].
Vancomycin is a glycopeptide used to treat infections produced mostly by Gram-positive bacteria. Its mechanism of action relies on binding to the terminal sequence D-Ala-D-Ala of the peptidoglycan, therefore inhibiting the bacterial cell wall synthesis [14]. Resistance to vancomycin was reported in enterococci in the late 1980s and since then, it has become a serious public health issue due to the life-threatening infections produced by vancomycin-resistant enterococci. Resistance to vancomycin involves an alteration in the terminal sequence of the peptidoglycan, changing the structure from D-Ala-D-Ala to D-Ala-D-Lac (for vanA, vanB, vanD, and vanM) or D-Ala-D-Ser (for vanC, vanE, vanG, vanL, and vanN). This mutation lowers the affinity of vancomycin to the binding site and thus promotes a resistant phenotype [8,23,24].
Our study analyzed the vanA and vanB genes in E. faecalis and E. faecium. For E. faecalis, vanA was the only one present, being positive in 9 out of 11 isolates. Similarly, vanA was dominant in E. faecium, being present in 57 out of 68 isolates. We also found eight E. faecium isolates that were positive for the vanB gene. These results are similar to the existing literature showing that in Romania, circulating isolates of VREfm predominantly harbor the vanA gene [12,25]. Statistically, no significant difference was determined between E. faecalis and E. faecium regarding the vanA and vanB genes.
Interestingly, two of these isolates were positive for both vanA and vanB genes. This observation was previously described in rare occasions with high clinical significance [26,27]. Unfortunately, we did not determine the phenotype expressed by this combination. Still, this observation implies high genome mobility between the species in the hospital environment [28,29,30].
Another relevant observation is that there are two isolates of E. faecalis and five isolates of E. faecium that were negative for both vanA and vanB genes. Based on the existing literature, we hypothesize that this finding might be due to the existence of other vancomycin resistance genes that we did not test for [24].
Regarding the resistance to tetracyclines, two mechanisms were tested in this study: drug efflux mediated via the tet(L) gene and target protection mediated via the tet(M) gene [8,31]. In E. faecalis isolates, tet(M) was the most frequent, being present in 5/11 isolates, while tet(L) was present only in one strain. Similarly, E. faecium isolates were positive for tet(M) in 38/68 isolates, while tet(L) was present in only 5/68 isolates. Although we can conclude that tet(M) is the most frequent resistance gene in this population of Enterococci, we did not observe any statistically significant difference between E. faecium and E. faecalis regarding these two genes (p > 0.05).
It was previously shown by Molechan et al. that tet(M) is often associated with ermB [32]. In our study, this association was present in four isolates of E. faecalis (three associated also with the vanA gene) and 35 isolates of E. faecium. This association has clinical relevance, with these isolates being resistant to a wider variety of antimicrobial agents. However, due to the lack of multilocus sequence typing (MLS) or whole-genome sequencing (WGS), we are not able to provide more extensive molecular epidemiology information concerning these isolates.
Tigecycline is a new antibiotic from the class of tetracyclines, which is effective against tet(M)- or tet(L)-positive isolates due to the low affinity for the efflux proteins and the ribosomal protection mechanisms [24,33]. Thus, it is used in different types of infections with Enterococcus, such as endocarditis and intra-abdominal infections [34]. Recently, Fiedler et al. demonstrated that some isolates harboring both tet(M) and tet(L) genes are resistant to tigecycline [35]. Our study shows one isolate of E. faecalis and five isolates of E. faecium that display this genotype, being positive for both tet(M) and tet(L). The presence of these associations in strains isolated from hospitals shows the importance of molecular analysis of antimicrobial resistance genes to implement the best long-term healthcare policies.
Resistance to macrolide–lincosamide–streptogramin antibiotics was evaluated by the presence of mefA, msrA, and ermB genes. While mefA and msrA genes are responsible for producing an active efflux pump mechanism, the ermB gene produces a methylase that modifies the drug’s target [36,37,38,39]. In our study, only 9 out of 11 E. faecalis isolates were positive for ermB. We also noticed the association of vanA and ermB genes in seven of those nine isolates. This pairing was also described by Dziri et al. and Lopez et al. [40,41]. We hypothesize that these associations, most described in E. faecium, were possible due to the horizontal gene transfer. A total of 66 out of 68 isolates of E. faecium presented the ermB gene, being the most prevalent ARG out of all that we tested. Moreover, the vanA-tetM-ermB association was present in 20 isolates, and an additional 13 isolates presented the same association in combination with other genes. These findings are in accordance with other studies and usually describe highly resistant isolates of E. faecium [24,40,41]. In our study, there was no statistically significant difference between E. faecalis and E. faecium concerning the mefA, msrA, and ermB genes.
Enterococci are intrinsically resistant to aminoglycosides due to the poor penetration through the bacterial cell wall. However, aminoglycosides proved to be useful in the clinical setting in combination with active agents against the cell wall. Thus, resistance to aminoglycosides is the consequence of modifying enzymes that work against this synergistic benefit. In our study, we evaluated the presence of three genes related to the aminoglycoside resistance, namely, aac(6′)-Im, aph(2)-Ib, and ant(4′)-Ia. The first two genes are responsible for the synthesis of an acetyltransferase and a phosphotransferase, respectively, and they provide resistance to most aminoglycosides (with the notable exception of streptomycin). The ant(4′)-Ia gene encodes a nucleotidyltransferase responsible for resistance to streptomycin [42,43,44,45,46,47]. In our study, none of the isolates tested presented the aac(6′)-Im or aph(2)-Ib genes. On the other hand, ant(4′)-Ia was positive in 2 out of the 11 E. faecalis isolates and in 20 out of 68 isolates of E. faecium. The association of vanA-ermB-ant(4′)-Ia was the most frequent among the isolates positive for aminoglycoside resistance, being present in both isolates of E. faecalis and in 10 out of the 20 isolates of E. faecium. This genotype is often translated in a phenotype resistant to glycopeptides, macrolides, and aminoglycosides, being difficult to treat in a clinical setting. No statistically significant difference between E. faecalis and E. faecium regarding the ant(4′)-Ia gene was found in our study.
Usually, antimicrobial resistance genes are transferred horizontally through different mobile genetic elements. More often, vanA operon is associated with a transposon (Tn), Tn1546 [33]. For vanB, there are different Tns that facilitate the transfer of the gene, such as Tn1547 and Tn1549 [8]. There are other possible gene associations that may use transposons as means of dissemination, such as tet(M) and ermB, as previously stated [32]. All these observations suggest a frequent horizontal transfer present in the intensive care unit of our hospital that needs to be monitored and addressed according to the existing guidelines.
Intensive care units represent an environment of intense antibiotic pressure, which provides ideal premises for acquiring different antimicrobial resistance genes via horizontal or vertical transfer, described by Rehman et al. as the main routes of dissemination of resistance [48]. For this reason, we also checked the presence of the sulfonamide resistance genes (sul1, sul2, and sul3) and carbapenem resistance via the New Delhi metallo-beta-lactamase gene (NDM-1) in vancomycin-resistant enterococci, despite their natural resistance to these antibiotic classes. sul1, sul2, and sul3 are the only known genes that provide resistance to sulfonamides by producing an alternative dihydropteroatesynthase [49,50,51,52]. The NDM-1 gene produces an enzyme capable of hydrolyzing the carbapenem antibiotics [53]. It was first reported by Yong et al. in 2009 [54] and it quickly became a major public health issue. Although it is usually harbored by Gram-negative Enterobacteriaceae, Walsh et al. describe other possible environmental hosts for this gene, such as Kingella dentrificans or Sutonella indologenes [55]. Even if highly unlikely, the presence of these genes in Gram-positive bacteria has the potential to pose a new challenge in fighting antimicrobial resistance. In our study, none of the isolated strains presented the sul1, sul2, sul3, or NDM1 gene.
Genotypic analyses of Enterococcus strains isolated from Romania are scarce. The few articles that tackle the antimicrobial resistance profile of Enterococcus species usually approach only the phenotype, and based on them, the resistance to glycopeptides seems to be low [56,57,58,59]. However, regarding the genotype of the resistance to glycopeptides in Romania, Ducu et al. found that the vanA gene was present in 19 out of 84 Enterococcus isolates and the vanB gene was present in 10 out of 84 Enterococcus isolates [25]. Based on that, we observe that before COVID-19, resistance to glycopeptides was relatively low, in opposition to our study, which shows a higher presence of vanA and vanB genes alone and in association with other ARGs in screening samples from ICU patients during the COVID-19 pandemic. This suggests that in the post-COVID-19 era, we might experience infections with highly resistant isolates of Enterococcus.
Regarding the limitations of our study, the most relevant is the relatively small number of isolates collected in a short period from one facility only. Moreover, the lack of multilocus sequence typing or whole-genome sequencing prevents a better understanding of the epidemiology of these isolates.
On the other hand, the strengths of the study include the number of ARGs tested and the efficient method of identification of the isolates, thus providing accurate and comprehensive information regarding the circulating ARGs in VRE during the COVID-19 pandemic in Cluj-Napoca, Romania.

5. Conclusions

Enterococcus faecalis and Enterococcus faecium are the main species of the genus Enterococcus, considered the most important in terms of antimicrobial resistance and potential healthcare threats. The COVID-19 pandemic offers an unprecedented ground for developing highly resistant isolates considering the irresponsible use of antibiotics and the pressure on the healthcare system.
Based on our analysis, in the first six months of 2021, during the COVID-19 pandemic in Romania, the dominant species isolated from rectal screening was Enterococcus faecium. These isolates harbored mostly the vanA gene, and the most prevalent association of antimicrobial resistance genes was vanA-tet(M)-ermB. Although Enterococcus faecalis was isolated less frequently, the clinical importance remains due to the high prevalence of the vanA gene. Based on our analysis, the most frequently associated antimicrobial resistance genes in vancomycin-resistant Enterococcus faecium and Enterococcus faecalis are, in order, ermB, tet(M), and ant(4′)-Ia.
To our knowledge, this paper provides the most extensive analysis of circulating antimicrobial resistance genes in Enterococcus in Romania. According to our results, the COVID-19 pandemic seems to produce a dangerous aftermath in terms of highly resistant strains of Enterococcus that may be a threat in the near future.

Author Contributions

Conceptualization D.A.T. and L.M.J.; methodology D.A.T. and R.M.M.; software, A.B. and R.M.M.; validation, C.A.C., I.A.C. and A.L.B.-K.; formal analysis, R.M.M. and A.B.; investigation, C.C., D.S.N. and L.G.; resources, A.L.B.-K. and D.I.; data curation, D.A.T., A.B. and R.M.M.; writing—original draft preparation, D.A.T.; writing—review and editing, C.A.C., I.A.C., A.L.B.-K. and D.I.; visualization, A.B. and R.M.M.; supervision, L.M.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was granted by project PDI-PFE-CDI 2021, entitled Increasing the Performance of Scientific Research, Supporting Excellence in Medical Research and Innovation, PROGRES, no. 40PFE/30.12.2021.

Institutional Review Board Statement

This study does not involve human subjects, human materials (including tissues), or human data. Bacterial isolates were obtained from hospital screening samples and the article meets national and international guidelines.

Informed Consent Statement

Not applicable for this study. The study was conducted on isolates collected through routine clinical work and patients’ identifiable information had already been anonymized.

Data Availability Statement

Not applicable.

Acknowledgments

We thank Mirela Flonta and the Infectious Diseases Clinical Hospital, Cluj-Napoca, Romania, for the support in identifying the bacterial isolates.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yim, J.; Smith, J.R.; Rybak, M.J. Role of Combination Antimicrobial Therapy for Vancomycin-Resistant Enterococcus faecium Infections: Review of the Current Evidence. J. Hum. Pharmacol. Drug Ther. 2017, 37, 579–592. [Google Scholar] [CrossRef] [PubMed]
  2. Jahansepas, A.; Aghazadeh, M.; Rezaee, M.A.; Hasani, A.; Sharifi, Y.; Aghazadeh, T.; Mardaneh, J. Occurrence of Enterococcus faecalis and Enterococcus faecium in Various Clinical Infections: Detection of Their Drug Resistance and Virulence Determinants. Microb. Drug Resist. 2018, 24, 76–82. [Google Scholar] [CrossRef] [PubMed]
  3. Monticelli, J.; Knezevich, A.; Luzzati, R.; di Bella, S. Clinical management of non-faecium non-faecalis vancomycin-resistant enterococci infection. Focus on Enterococcus gallinarum and Enterococcus casseliflavus/flavescens. J. Infect. Chemother. 2018, 24, 237–246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Gorrie, C.; Higgs, C.; Carter, G.; Stinear, T.P.; Howden, B. Genomics of vancomycin-resistant Enterococcus faecium. Microb. Genom. 2019, 5, e000283. [Google Scholar] [CrossRef] [PubMed]
  5. Courvalin, P. Vancomycin Resistance in Gram-Positive Cocci. Clin. Infect. Dis. 2006, 42, S25–S34. Available online: http://cid.oxfordjournals.org/ (accessed on 4 February 2022). [CrossRef] [PubMed]
  6. Coombs, G.W.; Pearson, J.C.; Daly, D.A.; Le, T.T.; Robinson, J.O.; Gottlieb, T.; Howden, B.P.; Johnson, P.D.R.; Bennett, C.M.; Stinear, T.P.; et al. Australian Enterococcal Sepsis Outcome Programme annual report, 2013. Commun. Dis. Intell. Q. Rep. 2014, 38, E320–E326. [Google Scholar] [PubMed]
  7. Bender, J.K.; Kalmbach, A.; Fleige, C.; Klare, I.; Fuchs, S.; Werner, G. Population structure and acquisition of the vanB resistance determinant in German clinical isolates of Enterococcus faecium ST192. Sci. Rep. 2016, 6, 21847. [Google Scholar] [CrossRef]
  8. Ahmed, M.O.; Baptiste, K.E. Vancomycin-Resistant Enterococci: A Review of Antimicrobial Resistance Mechanisms and Perspectives of Human and Animal Health. Microb. Drug Resist. 2018, 24, 590–606. [Google Scholar] [CrossRef] [Green Version]
  9. Olearo, F.; Both, A.; Campos, C.B.; Hilgarth, H.; Klupp, E.-M.; Hansen, J.L.; Maurer, F.P.; Christner, M.; Aepfelbacher, M.; Rohde, H. Emergence of linezolid-resistance in vancomycin-resistant Enterococcus faecium ST117 associated with increased linezolid-consumption. Int. J. Med. Microbiol. 2021, 311, 151477. [Google Scholar] [CrossRef]
  10. Torres, C.; Alonso, C.A.; Ruiz-Ripa, L.; León-Sampedro, R.; del Campo, R.; Coque, T.M. Antimicrobial Resistance in Enterococcus spp. of animal origin. Microbiol. Spectr. 2018, 6, 24. [Google Scholar] [CrossRef]
  11. Bender, J.K.; Cattoir, V.; Hegstad, K.; Sadowy, E.; Coque, T.M.; Westh, H.; Hammerum, A.M.; Schaffer, K.; Burns, K.; Murchan, S.; et al. Update on prevalence and mechanisms of resistance to linezolid, tigecycline and daptomycin in enterococci in Europe: Towards a common nomenclature. Drug Resist. Updat. 2018, 40, 25–39. [Google Scholar] [CrossRef] [PubMed]
  12. Ayobami, O.; Willrich, N.; Reuss, A.; Eckmanns, T.; Markwart, R. The ongoing challenge of vancomycin-resistant Enterococcus faecium and Enterococcus faecalis in Europe: An epidemiological analysis of bloodstream infections. Emerg. Microbes Infect. 2020, 9, 1180–1193. [Google Scholar] [CrossRef] [PubMed]
  13. Yam, E.L.Y. COVID-19 will further exacerbate global antimicrobial resistance. J. Travel Med. 2020, 27, taaa098. [Google Scholar] [CrossRef]
  14. Crăciunaş, C.; Butiuc-Keul, A.; Flonta, M.; Brad, A.; Sigarteu, M. Applications of molecular techniques to the study of Pseudomonas aeruginosa clinical isolate in Cluj-Napoca, Romania. Ann. Oradea Univ. Biol. Fascicle 2010, 243–247. [Google Scholar]
  15. Butiuc-Keul, A.; Carpa, R.; Podar, D.; Szekeres, E.; Muntean, V.; Iordache, D.; Farkas, A. Antibiotic Resistance in Pseudomonas spp. Through the Urban Water Cycle. Curr. Microbiol. 2021, 78, 1227–1237. [Google Scholar] [CrossRef] [PubMed]
  16. Rawson, T.M.; Moore, L.S.; Zhu, N.; Ranganathan, N.; Skolimowska, K.; Gilchrist, M.; Satta, G.; Cooke, G.; Holmes, A. Bacterial and fungal co-infection in individuals with coronavirus: A rapid review to support COVID-19 antimicrobial prescribing. Clin. Infect. Dis. 2020, 71, 2459–2468. [Google Scholar]
  17. Rawson, T.M.; Moore, L.; Castro-Sanchez, E.; Charani, E.; Davies, F.; Satta, G.; Ellington, M.J.; Holmes, A.H. COVID-19 and the potential long-term impact on antimicrobial resistance. J. Antimicrob. Chemother. 2020, 75, 1681–1684. [Google Scholar] [CrossRef]
  18. Knight, G.M.; Glover, R.E.; McQuaid, C.F.; Olaru, I.D.; Gallandat, K.; Leclerc, Q.J.; Fuller, N.M.; Willcocks, S.J.; Hasan, R.; van Kleef, E.; et al. Antimicrobial resistance and COVID-19: Intersections and implications. eLife 2021, 10, e64139. [Google Scholar] [CrossRef]
  19. Ukuhor, H.O. The interrelationships between antimicrobial resistance, COVID-19, past, and future pandemics. J. Infect. Public Health 2020, 14, 53–60. [Google Scholar] [CrossRef]
  20. Hughes, S.; Troise, O.; Donaldson, H.; Mughal, N.; Moore, L.S.P. Bacterial and fungal coinfection among hospitalized patients with COVID-19: A retrospective cohort study in a UK secondary-care setting. Clin. Microbiol. Infect. 2020, 26, 1395–1399. [Google Scholar] [CrossRef]
  21. Toc, D.A.; Costache, C.; Botan, A.; Mihaila, R.M.; Colosi, I.A.; Buksa, S.B.; Chiorescu, R.M. Mixed Etiology COVID-19 Associated Pulmonary Aspergillosis (CAPA)—A Case Report and Brief Review of the Literature. J. Fungi 2021, 7, 877. [Google Scholar] [CrossRef] [PubMed]
  22. Giacobbe, D.R.; Battaglini, D.; Ball, L.; Brunetti, I.; Bruzzone, B.; Codda, G.; de Maria, A.; Dentone, C.; di Biagio, A.; Icardi, G.; et al. Bloodstream infections in critically ill patients with COVID-19. Eur. J. Clin. Investig. 2020, 10, e13319. [Google Scholar] [CrossRef] [PubMed]
  23. Raza, T.; Ullah, S.R.; Mehmood, K.; Andleeb, S. Vancomycin resistant Enterococci: A brief review. J. Pak. Med. Assoc. 2018, 68, 768–772. [Google Scholar] [PubMed]
  24. Miller, W.R.; Murray, B.E.; Rice, L.B.; Arias, C.A. Resistance in Vancomycin-Resistant Enterococci. Infect. Dis. Clin. N. Am. 2020, 34, 751–771. [Google Scholar] [CrossRef]
  25. Ducu, R.; Gheorghe, I.; Chifiriuc, M.C.; Mihăescu, G.; Sârbu, I. Prevalence of vancomycin resistance phenotypes among Enterococcus species isolated from clinical samples in a Romanian hospital. Biointerface Res. Appl. Chem. 2019, 9, 4699–4704. [Google Scholar] [CrossRef]
  26. Mirzaei, B.; Babaei, R.; Asiabar, A.P.D.; Bameri, Z. Detection of both vanA & vanB genes in vanA phenotypes of Enterococci by Taq Man RT-PCR. Braz. J. Microbiol. 2015, 46, 161–165. [Google Scholar] [CrossRef]
  27. Papagiannitsis, C.; Malli, E.; Florou, Z.; Medvecky, M.; Sarrou, S.; Hrabak, J.; Petinaki, E. First description in Europe of the emergence of Enterococcus faecium ST117 carrying both vanA and vanB genes, isolated in Greece. J. Glob. Antimicrob. Resist. 2017, 11, 68–70. [Google Scholar] [CrossRef]
  28. Laverde Gomez, J.A.; Hendrickx, A.P.A.; Willems, R.J.; Top, J.; Sava, I.; Huebner, J.; Witte, W.; Werner, G. Intra- and interspecies genomic transfer of the Enterococcus faecalis pathogenicity Island. PLoS ONE 2011, 6, e16720. [Google Scholar]
  29. Manson, J.M.; Hancock, L.E.; Gilmore, M.S. Mechanism of chromosomal transfer of Enterococcus faecalis pathogenicity island, capsule, antimicrobial resistance, and other traits. Proc. Natl. Acad. Sci. USA 2010, 107, 12269–12274. [Google Scholar] [CrossRef] [Green Version]
  30. Palmer, K.L.; Kos, V.N.; Gilmore, M.S. Horizontal gene transfer and the genomics of enterococcal antibiotic resistance. Curr. Opin. Microbiol. 2010, 13, 632–639. [Google Scholar] [CrossRef] [Green Version]
  31. Dos Santos, L.D.R.; Furlan, J.P.R.; Gallo, I.F.L.; Ramos, M.S.; Savazzi, E.A.; Stehling, E.G. Occurrence of multidrug-resistant Enterococcus faecium isolated from environmental samples. Lett. Appl. Microbiol. 2021, 73, 237–246. [Google Scholar] [CrossRef] [PubMed]
  32. Molechan, C.; Amoako, D.G.; Abia, A.L.K.; Somboro, A.M.; Bester, L.A.; Essack, S.Y. Molecular epidemiology of antibiotic-resistant Enterococcus spp. from the farm-to-fork continuum in intensive poultry production in KwaZulu-Natal, South Africa. Sci. Total Environ. 2019, 692, 868–878. [Google Scholar] [CrossRef] [PubMed]
  33. García-Solache, M.; Rice, L.B. The Enterococcus: A Model of Adaptability to Its Environment. Clin. Microbiol. Rev. 2019, 32, e00058-18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Kresken, M.; Becker, K.; Seifert, H.; Leitner, E.; Körber-Irrgang, B.; Von Eiff, C.; Löschmann, P.-A. Study group. Resistance trends and in vitro activity of tigecycline and 17 other antimicrobial agents against Gram-positive and Gram-negative organisms, including multidrug-resistant pathogens, in Germany. Eur. J. Clin. Microbiol. 2011, 30, 1095–1103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Fiedler, S.; Bender, J.K.; Klare, I.; Halbedel, S.; Grohmann, E.; Szewzyk, U.; Werner, G. Tigecycline resistance in clinical isolates of Enterococcus faecium is mediated by an upregulation of plasmid-encoded tetracycline determinants tet(L) and tet(M). J. Antimicrob. Chemother. 2016, 71, 871–881. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Wan, T.-W.; Hung, W.-C.; Tsai, J.-C.; Lin, Y.-T.; Lee, H.; Hsueh, P.-R.; Lee, T.-F.; Teng, L.-J. Novel Structure of Enterococcus faecium-Originated ermB -Positive Tn 1546 -Like Element in Staphylococcus aureus. Antimicrob. Agents Chemother. 2016, 60, 6108–6114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Portillo, A.; Ruiz-Larrea, F.; Zarazaga, M.; Alonso, A.; Martinez, J.L.; Torres, C. Macrolide Resistance Genes in Enterococcus spp. Antimicrob. Agents Chemother. 2000, 44, 967–971. [Google Scholar] [CrossRef] [Green Version]
  38. Adesida, S.A.; Ezenta, C.C.; Adagbada, A.O.; Aladesokan, A.A.; Coker, A.O. Carriage of Multidrug Resistant Enterococcus Faecium and Enterococcus Faecalis Among Apparently Healthy Humans. Afr. J. Infect. Dis. 2017, 11, 83–89. [Google Scholar] [CrossRef] [Green Version]
  39. Li, X.Z.; Nikaido, H. Efflux-mediated drug resistance in bacteria: An update. Drugs 2009, 69, 1555–1623. [Google Scholar] [CrossRef]
  40. Dziri, R.; Lozano, C.; Ben Said, L.; Bellaaj, R.; Boudabous, A.; Ben Slama, K.; Torres, C.; Klibi, N. Multidrug-resistant enterococci in the hospital environment: Detection of novel vancomycin-resistant E. faecium clone ST910. J. Infect. Dev. Ctries. 2016, 10, 799–806. [Google Scholar] [CrossRef] [Green Version]
  41. López, M.; Sáenz, Y.; Rojo-Bezares, B.; Martínez, S.; del Campo, R.; Ruiz-Larrea, F.; Zarazaga, M.; Torres, C. Detection of vanA and vanB2-containing enterococci from food samples in Spain, including Enterococcus faecium strains of CC17 and the new singleton ST425. Int. J. Food Microbiol. 2009, 133, 172–178. [Google Scholar] [CrossRef] [PubMed]
  42. Barreto, Â.; Guimarães, B.; Radhouani, H.; Araújo, C.; Gonçalves, A.; Gaspar, E.; Rodrigues, J.; Igrejas, G.; Poeta, P. Detection of antibiotic resistant E. coli and Enterococcus spp. in stool of healthy growing children in Portugal. J. Basic Microbiol. 2009, 49, 503–512. [Google Scholar] [CrossRef] [PubMed]
  43. Chen, Y.-H.; Lin, S.-Y.; Lin, Y.-T.; Tseng, S.-P.; Chang, C.-C.; Yu, S.-Y.; Hung, W.-W.; Jao, Y.-T.; Lin, C.-Y.; Chen, Y.-H. Emergence of aac(6′)-Ie-aph(2′′)-Ia-positive enterococci with non-high-level gentamicin resistance mediated by IS1216V: Adaptation to decreased aminoglycoside usage in Taiwan. J. Antimicrob. Chemother. 2021, 76, 1689–1697. [Google Scholar] [CrossRef] [PubMed]
  44. Ounissi, H.; Derlot, E.; Carlier, C.; Courvalin, P. Gene homogeneity for aminoglycoside-modifying enzymes in gram-positive cocci. Antimicrob. Agents Chemother. 1990, 34, 2164–2168. [Google Scholar] [CrossRef] [Green Version]
  45. Chow, J.W.; Zervos, M.J.; Lerner, S.A.; Thal, L.A.; Donabedian, S.M.; Jaworski, D.D.; Tsai, S.; Shaw, K.J.; Clewell, D.B. A novel gentamicin resistance gene in Enterococcus. Antimicrob. Agents Chemother. 1997, 41, 511–514. [Google Scholar] [CrossRef] [Green Version]
  46. Moellering, R.C.; Weinberg, A.N. Effect of various antibiotics on the uptake of 4C-labeles streptomycin by Enterococci. J. Clin. Investig. 1971, 50, 2580–2584. [Google Scholar] [CrossRef] [Green Version]
  47. Geraci, J.E.; Martin, W.J. Antibiotic Therapy of Bacterial Endocarditis-Pathologic and Therapeutic Consideration of 33 Cases. Circulation 1954, 10, 173–194. Available online: http://ahajournals.org (accessed on 4 February 2022). [CrossRef] [Green Version]
  48. Rehman, M.U.; Zhang, H.; Huang, S.; Iqbal, M.K.; Mehmood, K.; Luo, H.; Li, J. Characteristics of Integrons and Associated Gene Cassettes in Antibiotic-Resistant Escherichia coli Isolated from Free-Ranging Food Animals in China. J. Food Sci. 2017, 82, 1902–1907. [Google Scholar] [CrossRef]
  49. Wu, S.; Dalsgaard, A.; Hammerum, A.M.; Porsbo, L.J.; Jensen, L.B. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human. Acta Veter. Scand. 2010, 52, 47. [Google Scholar] [CrossRef] [Green Version]
  50. Ben, W.; Wang, J.; Pan, X.; Qiang, Z. Dissemination of antibiotic resistance genes and their potential removal by on-farm treatment processes in nine swine feedlots in Shandong Province, China. Chemosphere 2017, 167, 262–268. [Google Scholar] [CrossRef]
  51. Changkaew, K.; Utrarachkij, F.; Siripanichgon, K.; Nakajima, C.; Suthienkul, O.; Suzuki, Y. Characterization of Antibiotic Resistance in Escherichia coli Isolated from Shrimps and Their Environment. J. Food Prot. 2014, 77, 1394–1401. [Google Scholar] [CrossRef] [PubMed]
  52. Jiang, H.; Cheng, H.; Liang, Y.; Yu, S.; Yu, T.; Fang, J.; Zhu, C. Diverse Mobile Genetic Elements and Conjugal Transferability of Sulfonamide Resistance Genes (sul1, sul2, and sul3) in Escherichia coli Isolates from Penaeus vannamei and Pork from Large Markets in Zhejiang, China. Front. Microbiol. 2019, 10, 1787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Wailan, A.M.; Paterson, D.L. The spread and acquisition of NDM-1: A multifactorial problem. Expert Rev. Anti-Infect. Ther. 2014, 12, 91–115. [Google Scholar] [CrossRef]
  54. Yong, D.; Toleman, M.A.; Giske, C.G.; Cho, H.S.; Sundman, K.; Lee, K.; Walsh, T.R. Characterization of a new metallo-β-lactamase gene, bla NDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob. Agents Chemother. 2009, 53, 5046–5054. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Walsh, T.R.; Weeks, J.; Livermore, D.M.; Toleman, M.A. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: An environmental point prevalence study. Lancet Infect. Dis. 2011, 11, 355–362. [Google Scholar] [CrossRef]
  56. Arbune, M.; Gurau, G.; Niculet, E.; Iancu, A.V.; Lupasteanu, G.; Fotea, S.; Vasile, M.C.; Tatu, A.L. Prevalence of Antibiotic Resistance of ESKAPE Pathogens Over Five Years in an Infectious Diseases Hospital from South-East of Romania. Infect. Drug Resist. 2021, 14, 2369–2378. [Google Scholar] [CrossRef]
  57. Lazăr, V.; Gheorghe, I.; Curutiu, C.; Savin, I.; Marinescu, F.; Cristea, V.C.; Dobre, D.; Popa, G.L.; Chifiriuc, M.C.; Popa, M.I. Antibiotic resistance profiles in cultivable microbiota isolated from some romanian natural fishery lakes included in Natura 2000 network. BMC Veter. Res. 2021, 17, 52. [Google Scholar] [CrossRef]
  58. Almahdawy, O.T.; Pricop, R.; Sadik, O.; Najee, H.; Pircalabioru, G.G.; Marutescu, L.; Barbu, I.C.; Banu, O.; Cristea, V.; Grigore, R.; et al. Description of vancomycin resistance genes in Enterococcus sp. clinical strains isolated from Bucharest, Romania. Rom. Biotechnol. Lett. 2019, 24, 395–399. [Google Scholar] [CrossRef]
  59. Toc, D.A.; Pandrea, S.L.; Botan, A.; Mihaila, R.M.; Costache, C.A.; Colosi, I.A.; Junie, L.M. Enterococcus raffinosus, Enterococcus durans and Enterococcus avium Isolated from a Tertiary Care Hospital in Romania—Retrospective Study and Brief Review. Biology 2022, 11, 598. [Google Scholar] [CrossRef]
Biomedicines 10 01122 g001 550
Figure 1. The vanA electrophoresis results of E. faecium isolates (NC = negative control, PC = positive control, S = sample, bp = base pairs).
Figure 1. The vanA electrophoresis results of E. faecium isolates (NC = negative control, PC = positive control, S = sample, bp = base pairs).
Biomedicines 10 01122 g001
Biomedicines 10 01122 g002 550
Figure 2. The vanB electrophoresis results of E. faecium isolates (S = sample, bp = base pairs).
Figure 2. The vanB electrophoresis results of E. faecium isolates (S = sample, bp = base pairs).
Biomedicines 10 01122 g002
Biomedicines 10 01122 g003 550
Figure 3. Associations of antimicrobial resistance genes in E. faecium and E. faecalis.
Figure 3. Associations of antimicrobial resistance genes in E. faecium and E. faecalis.
Biomedicines 10 01122 g003
Table
Table 1. Characteristics of the primers used for the antimicrobial resistance genes’ amplification and the dimension of the amplicons (bp—base pairs).
Table 1. Characteristics of the primers used for the antimicrobial resistance genes’ amplification and the dimension of the amplicons (bp—base pairs).
GenePrimer PairsAmplicon (bp)
ForwardReverse
vanAGCTATTCAGCTGTACTCAGCGGCCATCATACGG781
vanBCGCCATATTCTCCCCGGATAGAAGCCCTCTGCATCCAAGCAC647
tet(M)CCGTCTGAACTTTGCGGAAACAACGGAAGCGGTGATACAG627
tet(L)TATTCAAGGGGCTGGTGCAGCGGCAGTACTTAGCTGGTGA545
ermBGAAAAGGTACTCAACCAAATAAGTAACGGTACTTAAATTGTTTAC639
msrAAGGGAAAGGTCATTTTACTGCCCCTACCTATAACTAAACATT343
mefACATCGACGTATTGGGTGCTGCCGAAAGCCCCATTATTGCA516
aac(6′)-ImGGCTGACAGATGACCGTGTTCTTGGTAGATATTGGCATACTACTCTGC482
aph(2)-IbCTGAACACAGCAGCGACTACTTGTAATCGCCATGCACCAG646
ant(4′)-IaGTCAAAAACTGCTAACACAAGAATAATACTGCTAACGATAAT135
sul1AGGCATGATCTAACCCTCGGGGCCGATGAGATCAGACGTA665
sul2GACAGTTATCAACCCGCGACGAAACAGACAGAAGCACCGG380
sul3GTGGGCGTTGTGGAAGAAATAAAAGAAGCCCATACCCGGA370
NDM-1GGTTTGGCGATCTGGTTTTCCGGAATGGCTCATCACGATC621
Table
Table 2. PCR conditions used for each antimicrobial resistance gene tested.
Table 2. PCR conditions used for each antimicrobial resistance gene tested.
GeneInitial DenaturationSteps (30 Cycles)Final Elongation
vanA, ermB94 °C for 4 minDenaturation at 94 °C for 1 min
Annealing at 51 °C for 45 s
Elongation at 72 °C for 45 s		72 °C for 8 min
ant(4′)-la, msrADenaturation at 94 °C for 1 min
Annealing at 53 °C for 45 s
Elongation at 72 °C for 45 s
aph(2)-lb, mefA, TetM, sul3Denaturation at 94 °C for 1 min
Annealing at 55 °C for 45 s
Elongation at 72 °C for 45 s
TetL, sul1, sul2Denaturation at 94 °C for 1 min
Annealing at 57 °C for 45 s
Elongation at 72 °C for 45 s
aac(6′)–Im, vanBDenaturation at 94 °C for 1 min
Annealing at 61 °C for 45 s
Elongation at 72 °C for 45 s
Table
Table 3. Number and percentage of E. faecalis and E. faecium isolates positive for the ARGs among the total number of isolates tested.
Table 3. Number and percentage of E. faecalis and E. faecium isolates positive for the ARGs among the total number of isolates tested.
Enterococcus Faecalis (n = 11)Enterococcus Faecium (n = 68)p
van A9 (81.8%)57 (83.8%)1.000
van B0 (0%)8 (11.8%)0.591
tet(M)5 (45.5%)38 (55.9%)0.529
tet(L)1 (9.1%)5 (7.4%)1.000
ermB9 (81.8%)66 (97.1%)0.091
msrA0 (0%)2 (2.9%)1.000
mefA0 (0%)1 (1.5%)1.000
aac(6′)-Im//N/A
aph(2)-Ib//N/A
ant(4′)-Ia2 (18.2%)20 (29.41%)0.718
sul1//N/A
sul2//N/A
sul3//N/A
NDM1//N/A
Table
Table 4. Number of E. faecalis isolates and percentage from all the included isolates for each ARG combination.
Table 4. Number of E. faecalis isolates and percentage from all the included isolates for each ARG combination.
FrequencyPercentage
Resistance gene19.1%
tetM-ermB19.1%
vanA-tetM-tetL19.1%
vanA-ermB-ant4la218.2%
vanA-ermB327.3%
vanA-tetM-ermB327.3%
Total11100.0%
Table
Table 5. Number of E. faecium isolates and percentage from all the included isolates for each ARG combination.
Table 5. Number of E. faecium isolates and percentage from all the included isolates for each ARG combination.
FrequencyPercentage
Resistance gene11.5%
tetM-ermB11.5%
tetM-ermB-ant4la11.5%
vanA-tetM-ermB-msrA11.5%
vanA-tetM-ermB-msrA-ant4la11.5%
vanA-tetM-tetL-ermB-ant4la11.5%
vanA-tetM-tetL-ermB-mefA11.5%
vanA-vanB-ermB11.5%
vanA-vanB-tetM-ant4la11.5%
ermB22.9%
vanB-tetM-ermB22.9%
vanA-tetM-tetL-ermB34.4%
vanB-ermB45.9%
vanA-tetM-ermB-ant4la68.8%
vanA-ermB-ant4la1014.7%
vanA-ermB1217.6%
vanA-tetM-ermB2029.4%
Total68100.0%
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Toc, D.A.; Butiuc-Keul, A.L.; Iordache, D.; Botan, A.; Mihaila, R.M.; Costache, C.A.; Colosi, I.A.; Chiorean, C.; Neagoe, D.S.; Gheorghiu, L.; et al. Descriptive Analysis of Circulating Antimicrobial Resistance Genes in Vancomycin-Resistant Enterococcus (VRE) during the COVID-19 Pandemic. Biomedicines 2022, 10, 1122. https://doi.org/10.3390/biomedicines10051122

AMA Style

Toc DA, Butiuc-Keul AL, Iordache D, Botan A, Mihaila RM, Costache CA, Colosi IA, Chiorean C, Neagoe DS, Gheorghiu L, et al. Descriptive Analysis of Circulating Antimicrobial Resistance Genes in Vancomycin-Resistant Enterococcus (VRE) during the COVID-19 Pandemic. Biomedicines. 2022; 10(5):1122. https://doi.org/10.3390/biomedicines10051122

Chicago/Turabian Style

Toc, Dan Alexandru, Anca Livia Butiuc-Keul, Dumitrana Iordache, Alexandru Botan, Razvan Marian Mihaila, Carmen Anca Costache, Ioana Alina Colosi, Claudia Chiorean, Dan Stefan Neagoe, Liana Gheorghiu, and et al. 2022. "Descriptive Analysis of Circulating Antimicrobial Resistance Genes in Vancomycin-Resistant Enterococcus (VRE) during the COVID-19 Pandemic" Biomedicines 10, no. 5: 1122. https://doi.org/10.3390/biomedicines10051122

APA Style

Toc, D. A., Butiuc-Keul, A. L., Iordache, D., Botan, A., Mihaila, R. M., Costache, C. A., Colosi, I. A., Chiorean, C., Neagoe, D. S., Gheorghiu, L., & Junie, L. M. (2022). Descriptive Analysis of Circulating Antimicrobial Resistance Genes in Vancomycin-Resistant Enterococcus (VRE) during the COVID-19 Pandemic. Biomedicines, 10(5), 1122. https://doi.org/10.3390/biomedicines10051122

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop