Next Article in Journal
Drug-Induced Pulmonary Fibrosis: National Database Analysis
Previous Article in Journal
Mitral Valve Transcatheter Edge-to-Edge Repair (MV-TEER) in Patients with Secondary Mitral Regurgitation Improves Hemodynamics, Enhances Renal Function, and Optimizes Quality of Life in Patients with Advanced Renal Insufficiency
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 12
Issue 11
10.3390/biomedicines12112649
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation

by
Di Wu
†,
Ye Liu
†,
Xiaogang Luo
,
Zhiqing Chen
,
Qiuli Fu
and
Ke Yao
*
Eye Center, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Zhejiang Provincial Key Laboratory of Ophthalmology, Zhejiang Provincial Clinical Research Center for Eye Diseases, Zhejiang Provincial Engineering Institute on Eye Diseases, Hangzhou 310051, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Biomedicines 2024, 12(11), 2649; https://doi.org/10.3390/biomedicines12112649
Submission received: 28 October 2024 / Revised: 12 November 2024 / Accepted: 18 November 2024 / Published: 20 November 2024
(This article belongs to the Section Cell Biology and Pathology)
Browse Figures
Versions Notes

Abstract

:
Background: Lgals3/galectin-3 plays a pivotal role in many vascular diseases. However, the involvement of Lgals3/galectin-3 in eyes with neovascular age-related macular degeneration (nAMD) remains unknown. Methods: In the laser-induced CNV model, a whole mount retina stained with Isolectin B4 and collagen type I revealed the vascular bed and CNV-associated subretinal fibrosis on day 7 after laser treatment. Results: We show that the expression levels of Lgals3/galectin-3 were significantly increased in the RPE/choroidal complex of CNV mice. An intravitreal injection of Lgals3-siRNA significantly suppressed the area of CNV and subretinal fibrosis, together with Mcp-1 decline. The mixture of Lgals3-siRNA and Ranibizumab showed more efficiency than each drug used separately. Hypoxia induced Lgals3/galectin-3 production in ARPE-19 cells, which was reduced by the silencing hypoxia-inducible factor -1α (Hif-1a). Conclusions: Our data indicated that Lgals3/galectin-3 is involved in the pathogenesis of CNV and subretinal fibrosis, and Lgals3/galectin-3 could be a potential therapeutic target for nAMD.

1. Introduction

Age-related macular degeneration (AMD) is the leading cause of irreversible blindness worldwide in the elderly, which affects over 196 million people, with this number rising to 288 million by the year 2040 with the growth of the elderly population [1]. AMD is characterized by the progressive degeneration/dysregulation of the neuronal retina, choriocapillaris, and retinal pigment epithelium (RPE) complex. Clinically, AMD is classified into the neovascular form (wet AMD) and non-neovascular form (dry AMD). Wet AMD (also known as nAMD) is primarily characterized by the formation of choroidal neovascularization (CNV) in the macular region, ultimately resulting in the formation of a fibrotic scar [2,3]. Despite anti-vascular endothelial growth factor (VEGF) therapy as the first-line treatment in nAMD being able to stabilize or even enhance visual function, a large percentage of patients suffer from an incomplete response to anti-VEGF therapy, manifested as persistent subretinal or sub-retinal pigment epithelium (RPE) fluid; persistent or new hemorrhage; and/or progressive lesion fibrosis [4]. Thus, it is urgent to explore the mechanisms beyond VEGF-mediated choroidal neovascularization (CNV) and subretinal fibrosis in nAMD.
Etiologically, a decreased flow of oxygen from the chorio-capillaries causes hypoxia in the RPE cells, which accelerates degeneration. The expression of HIFs (hypoxia-inducible transcription factors) has been detected in CNV membranes from nAMD patients [5]. The principal explanations for the expression of HIF in human CNV are that drusen maculopathy and the age-related thickening of the Bruch’s membrane (BM) together contribute to accelerated RPE hypoxia, and therefore cause increased levels of HIF transcription factors [6]. Moreover, a large number of hypoxia-induced factor (HIF) target genes contribute to nAMD, such as angiopoietins and plasminogen activator inhibitor 1 (PAI-1) [7,8]. In addition, hypoxia causes an inflammatory reaction in RPE cells, which are closely linked to angiogenesis and fibrosis. During this process, the inflammatory mediators such as monocyte chemoattractant protein-1/chemoattractant CC chemokine ligand 2 (MCP-1/CCL-2) were important in the inflammation reaction of nAMD [9,10].
Recently, we reported that Lgals1/galectin-1, as the first member of the galectin family, plays a key role in both angiogenesis and subretinal fibrosis in eyes with nAMD [11]. Galectins, which are carbohydrate-binding proteins, were discovered for their ability to bind galactoside in order to identify proteins that can decode complex cell-surface glycans [12]. Currently, 15 members of the galectin family are found in mammals, and they are widely distributed in different types of cells and tissues [13]. They are characterized as a protein family due to the conserved β-galactoside-binding sites found within their unique ~130 amino acid (aa) carbohydrate recognition domains (CRDs) and their participation in cell activation, differentiation, proliferation, and apoptosis. Different from other subtypes, Lgals3/galectin-3, as the only chimera-type galectin, was involved in various physiological functions, such as proliferation, apoptosis, differentiation, cellular adhesion, and tissue repair. Due to its multifunctional properties, Lgals3/galectin-3 plays different roles in several diseases, such as cancer, chronic inflammation, atherosclerosis, and cardiovascular diseases [14,15,16]. For instance, Lgals3/galectin-3 promotes EMT in a carbohydrate-dependent manner and enhances the metastatic potential of cancer cells [17]. In the eye, Lgals3/galectin-3 has been observed in migrating corneal epithelial cells [18], inflammatory conjunctival epithelium [19], and differentiated RPE cells [20]. So far, in vivo and in vitro studies indicated that Lgals3/galectin-3 plays critical roles in several ocular diseases, e.g., dry eye, glaucoma, uveitis, and diabetic retinopathy [21,22,23]. Recently, Lgals3/galectin-3 was found to be highly expressed in RPE cells from AMD donors than in age-matched healthy donors [24]. However, little is known about the alteration of Lgals3/galectin-3 expression in the retina in nAMD. In this study, we investigated the involvement of Lgals3/galectin-3 in CNV and subretinal fibrosis using a CNV mouse model and RPE cell culture.

2. Materials and Methods

2.1. Animals

In this study, C57BL/6 mice (6–8 weeks old) were supplied by the Laboratory Animal Center of Hangzhou Medical College (Hangzhou, China), and fed with standard laboratory food and water in a condition with a 12 h light-dark cycle. All animal experiments were conducted in accordance with the Association for Research in Vision and Ophthalmology’s Statement for the Use of Animal in Ophthalmic and Vision Research and were approved by the Institutional Animal Care and Use Committee at Zhejiang University.

2.2. Laser-Induced CNV Model

Mice were anesthetized with 1% pentobarbital, and their pupils were dilated with 0.5% tropicamide and 0.5% phenylephrine hydrochloride eyedrops (Santen Pharmaceutical Co., Osaka, Japan). Two minutes after pupil dilation, laser photocoagulation (532 nm, 400 mW, 80 ms) was induced in four spots per eye around the optic disk using the image-guided laser system (Micron IV, Phoenix Reserch Laboratories, Pleasanton, CA, USA). Immediately after laser injury, intravitreal injections were performed as described previously [25]. In brief, 1 μL of Lgals3-siRNA (Genechem, Shanghai, China) was diluted to 100 pM and intravitreally injected into right eye (1 μL/eye). In control group, 1 μL negative control siRNA (Con-siRNA) or/and Ranibizumab (Lucentis, Genentech, Inc., South San Francisco, CA, USA) was intravitreally injected into left eye.

2.3. Fundus Fluorescein Angiography and Optical Coherence Tomography

Procedures were described in previous report [26]. Fundus fluorescein angiography (FFA) was used to determine leakage by the retinal imaging microscope (Micron IV) 7 days after laser photocoagulation. In brief, mice were anesthetized, pupils dilated, and then intraperitoneally injected with sodium fluorescein (Sigma-Aldrich, Vienna, Austria). Fluorescent fundus images were captured using the retinal imaging microscope 5 min after fluorescein injection. Spectral domain optical coherence tomography (SD-OCT) was performed with the guidance of bright-field live fundus image using the image-guided OCT system (Micron IV). The process was performed following FFA detection and utilizing the Vendor’s image acquisition software (Discover 2.4.11) to capture bright-field images.

2.4. Assessment of CNV and Subretinal Fibrosis

Procedures were described in our previous study [11]. Seven days after laser photocoagulation, the eyes were removed and fixed in 4% paraformaldehyde. The anterior segment and the retina were removed from the eyeball, and then RPE/choroid complex was fluorescently labeled with markers for endothelial cells (Isolectin B4-Alexa 488, 1:100, Thermo Fisher Scientific, Tewksbury, MA, USA) and fibroblasts (rabbit anti-collagen type I antibody, 1:100, Abcam, Cambridge, MA, USA) to detect CNV and subretinal fibrosis, respectively. The images were obtained by fluorescence microscope (Leica, Wetzlar, Germany), and size of CNV and subretinal fibrosis were calculated by measuring the fluorescent areas using ImageJ Version 1.54 [National Institutes of Health (NIH), Bethesda, MD, USA].

2.5. Validation of Results

Selected genes were further validated seven days after laser injury through Quantitative real-time PCR (qRT-PCR). Following the manufacturers’ instructions, total RNA was isolated using TRIzol Reagent. Reverse transcription was then performed for cDNA using PrimeScript RT Master Mix (Takara, Beijing, China). Real-time qPCR was carried out using the SYBR Premix Ex Taq (Takara) with the ABI Fast 7500 RT-PCR system (Life Technologies, Grand Island, NY, USA). Gene expression levels were calculated using the 2-ddCT method, and gene levels were normalized using Gapdh as the internal control. Table 1 lists all primers.

2.6. Western Blot Analyses

Procedures were described in our previous study [25]. Protein extracts were obtained from two homogenized eyecups from each group seven days after laser treatment. Each sample was assessed for protein concentrations using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Electrophoresis of proteins was performed using 12% SDS-polyacrylamide gels, with 20 μg of protein loaded on each lane. After the protein was electrotransferred to a 0.22 μm PVDF membrane (Millipore, Burlington, MA, USA), the membrane was blocked in Tris-buffered saline containing 5% skim milk and 0.1% Tween-20 and probed overnight at 4 °C with mouse anti-Galectin-3 antibody (Abcam, Fremont, CA, USA). Horseradish peroxidase-conjugated anti-mouse IgG (Thermo Fisher Scientific) was used as secondary antibodies for 1 h at room temperature. Immunoreactivity was visualized using enhanced chemiluminescence (ECL, Millipore) reagent. Protein levels were quantitated by densitometry and normalized to the β-actin levels.

2.7. Cell Culture

The human RPE cell line ARPE-19 was obtained from American Type Culture Collection (Manassas, VA, USA) and cultured in DMEM/F-12 medium from Gibco (Thermo Fisher Scientific, MA, USA), supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific). The following experiments were performed at 37 °C and 5% CO2, with either normoxia (20% O2) or hypoxia (1% O2 balanced with N2) in a humidified atmosphere. ARPE-19 cells were pretreated with 10nM LW6 (MedChemExpress, Monmouth Junction, NJ, USA) and placed in a hypoxic incubator for 24 h. DMSO was used as a negative control.

2.8. RNA-Seq Analysis

RNA of each sample was extracted from the RPE/choroidal complex using TRlzol Reagent (Life Technologies), as described in our previous study [27]. The purity and concentration of the total RNA samples were measured using NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific). RNA integrity was assessed using the RNA Nano 6000 Assay Kit on the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA).
High-quality RNA samples were then sent to Biomarker Technologies Corporation (Hangzhou Cosmos Wisdom Biotechnology, Hangzhou, China) for the construction of cDNA libraries and sequencing. Following the manufacturer’s instructions, the RNA-seq libraries were prepared using the NEBNext UltraTM RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA). Differential expression analysis of the two groups was conducted using DESeq2.

2.9. Statistical Analysis

All results were expressed as the mean ± standard error of the mean from at least three biological replicates. Statistical analyses were made by Student’s t-test or one-way ANOVA analysis. A value of p < 0.05 was considered statistically significant.

3. Results

3.1. Laser Irradiation Successfully Induced CNV and Subretinal Fibrosis

The laser-induced CNV mouse model demonstrates choroidal angiogenesis and subretinal fibrosis under burn-induced inflammation, mimicking some aspects of nAMD [27]. To confirm the feasibility of the laser-induced CNV model, the mouse fundus was viewed using an imaging camera, and laser photocoagulation burned Bruch’s membrane with an image-guided laser system (Schematic illustration of Laser-induced CNV mouse model) (Figure 1A). We first performed the FFA and OCT to show the vascular leakage and newly formed subretinal CNV at 7 days after laser injury (Figure 1B–D). Consistent with these findings, the Isolectin B4 and Type I collagen staining represented neovascular and fibrous tissue, respectively, which were identified to be surrounding laser spots in mice (Figure 1E–G).

3.2. Increase in Galectin-3 from RPE Cells in Laser-Induced CNV Mice

To determine the involvement of Lgals3/galectin-3 in CNV formation, real-time PCR and immunoblot were performed to determine the expression patterns of Lgals3/galectin-3 in the RPE/choroid complex of mice with laser-induced CNV. As shown in Figure 2, the gene and protein expression level of Lgals3/galectin-3 was significantly upregulated (gene, 1.42-fold change; protein, 2.47-fold change) at postlaser day 7 (Figure 2A,B). Taken together, our data suggested that Lgals3/galectin-3 might be involved in CNV and subretinal fibrosis formation in nAMD.

3.3. Attenuation of CNV and Subretinal Fibrosis Formation by Silencing of Galectin-3

To investigate the impact of Lgals3/galectin-3 in the development of CNV and subretinal fibrosis, we first examined the gene silencing efficiency of Lgals3-siRNA in ARPE-19 cells (Supplementary Figure S1). We then measured the size of CNV and subretinal fibrosis, with or without an Lgals3-siRNA intravitreal injection after laser injury. Isolectin-B4 and Type I collagen staining of choroidal flat mounts showed that the CNV and subretinal fibrosis areas of Lgals3-siRNA injection were decreased by approximately 37% and 33%, respectively, compared with that of Con-siRNA injection at 7 days after laser photocoagulation (Figure 3A–H). Meanwhile, pathological leakage resembling CNV formation occurred in most of the Con-siRNA injection mice, but rarely in the Lgals3-siRNA group (Figure 3I–L).
The laser-induced CNV model is similar to a wound-healing reaction, accompanied with high levels of acute reaction inflammation [28]. To explore whether the inhibition of Lgals3 suppresses angiogenesis and fibrosis via an inflammatory pathway, we measured the changes in Mcp-1/Ccl-2 in CNV mice with or without Lgals3-siRNA injection. As shown in Figure 3M, the silencing of Lgals3 exhibited a significant reduction in Mcp-1/Ccl-2 in the RPE/choroidal complex at postlaser day 7. These data suggested that Lgals3/galectin-3 promotes CNV and subretinal fibrosis development, at least partially via the inflammatory signaling pathway.

3.4. Comparing the Inhibitory Effects of Lgals3/Galectin-3 and Lucentis on CNV and the Formation of Subretinal Fibrosis

Since Lgals3/galectin-3 was shown as a possible molecular target for nAMD, we then compared the efficiency of Lgals3/galectin-3 inhibition with that of Ranibizumab, one of the first-line drugs used to treat nAMD targeting VEGF [29]. In CNV mice, an intravitreal injection of PBS, Ranibizumab, Lgals3-siRNA and a combination of Ranibizumab and Lgals3-siRNA were used to quantify the size of CNV and subretinal fibrosis. As shown in Figure 4A–N, Ranibizumab treatment substantially reduced the size of CNV and subretinal fibrosis in mice, despite the reduction in subretinal fibrosis being without statistical significance. Moreover, a more remarkable inhibition was exhibited when the mice were treated with a mixture of Lgals3-siRNA and Ranibizumab compared to each drug being used separately.

3.5. Hypoxia Upregulates Galectin-3 Expression in RPE Cells via Hif-1a

To elucidate the molecular mechanism underlying Lgals3/galectin-3 upregulation in CNV, we conducted in vitro experiments utilizing human RPE cells subjected to hypoxic conditions, which are used to mimic an in vivo study of nAMD, to examine the changes in Lgals3 gene expression under hypoxic conditions. As shown in Figure 5A, the mRNA expression level of Lgals3 significantly increased to 2.1 times (p < 0.01) with hypoxic stimulation.
HIF is the master regulator factor mediated by molecular oxygen [30]. Since the oxygen level is low, HIF-1α regulates the expression of various critical downstream genes that are necessary for cells to survive. To understand whether Hif-1a plays a role in controlling Lgals3 expression under hypoxic conditions, we analyzed the mRNA expression levels of Lgals3 while using a Hif-1a inhibitor. As demonstrated in Figure 5B, LW6, a suppressor of Hif-1a accumulation, significantly suppressed the mRNA expression levels of Hif-1a under hypoxic conditions. Likewise, the gene expression levels of Lgals3 were greatly reduced by LW6 (Figure 5C). These results indicate that hypoxia influences the transcriptional activity of Lgals3, showing its dependence on the regulation by Hif-1a.

3.6. Bioinformatics Analysis of Differentially Expressed Genes and Pathways in RPE Cells by CNV Induction

RNA-seq is the technique that uses the capabilities of high-throughput sequencing to reveal the presence and quantity of RNA molecules in a biological sample and look at alternative genes in different groups or treatments [31]. We finally performed RNA-seq analysis to investigate changes in the gene expression profiles of the choroidal CNV sample. In total, 2871 significant differentially expressed genes (DEGs) were identified in the RPE/choroidal complex between laser-induced CNV and control mice, which consisted of 2043 upregulated and 828 downregulated genes (Figure 6A) (details in Supplementary Excel S1). We observed that Hif-1 and Lgals3/Galectin-3 were increased in laser-induced CNV mice (fold change with CNV: Hif-1 = 1.50, Lgals3/Galectin-3 = 1.78). Moreover, the upregulated genes, such as Muc4, Septin4, Alox15, Dsg3, and Ska2, encoded pro-inflammatory and apoptotic mediators, and cytoskeleton components were confirmed through this experimental validation. Then, the GO and KEGG enrichment analysis were obtained based on DEGs and indicated that the Neuroactive ligand-receptor interaction pathway, Calcium signaling pathway, and cAMP signaling pathways were the primary pathways that were likely responsible for laser-induced CNV mice (Figure 6B,C).

4. Discussion

The current study reveals, for the first time, several important findings concerning the involvement of Lgals3/galectin-3 in the pathogenesis of CNV and subretinal fibrosis. Our initial process included establishing a stable laser-induced CNV mouse model (Figure 1). Our recent study provided evidence that Lgals1/galectin-1 could modify the VEGFA and TGF-beta1 receptor signaling pathways, thus altering nAMD [11]. This prompted us to investigate if other galectin family members are involved in nAMD. As members of the galectin family, galectin-1 and galectin-3 are ubiquitously expressed with various biological roles [32]. The difference with galectin-1 is that galectin-3 contains one CRD with an atypical N-terminal domain, which suggests functional differences between these two subtypes. Galectin-3 contains one CRD with an atypical N-terminal domain, which suggests functional differences between these two subtypes. Recently, Lgals3/galectin-3 has been reported to significantly interact with endothelial cells [33], RPE [34], microglial [22], and macrophages [35] in the retina. In this study, we indicated that Lgals3/galectin-3 resulted in an increase in mRNA and protein levels in the laser-induced CNV model (Figure 2), suggesting that Lgals3/galectin-3 might play a role in nAMD.
Neovascularization and subretinal fibrosis have been revealed as key pathological events associated with poor visual acuity in nAMD [2]. The previous study has shown that Lgals3/galectin-3 triggers FAK signaling pathways by binding to cell adhesion receptor αvβ3 integrin, thus promoting endothelial cell migration in the angiogenic cascade [36]. Additionally, Lgals3/galectin-3 has been seen to hinder the internalization of VEGFR in human umbilical vein endothelial cells when bound to VEGFR2, thereby stimulating pathological angiogenesis in the cornea [37]. In agreement with these findings, a recent study has shown that the silencing of Lgals3/galectin-3 could suppress corneal neovascularization and fibrosis through α-smooth muscle actin (α-SMA) signaling in a silver nitrate cautery and alkaline burn mouse model [38]. Importantly, Lgals3/galectin-3 has been discovered extensively in RPE cells from AMD donors compared to age-matched healthy donors, suggesting that Lgals3/galectin-3 plays a role in the pathogenesis of nAMD [24,39].
Inflammation plays a critical role in CNV and subretinal fibrosis, as observed in the laser injury mouse model [40,41]. The process involves the activation of macrophages, leading to an increase in cytokine and chemokine levels. Our prior research showed that macrophage influx into the RPE/choroidal complex and the expression level of MCP-1/CCL2 significantly increased in mice with CNV [25]. It is known that persistent pro-inflammatory cytokines released from RPE cells and macrophages promote the differentiation and activation of myofibroblasts (e.g., EndMT and EMT) [2,11]. The progression culminates in subretinal scarring, causing irreversible destruction of photoreceptors, RPE cells, and choroidal blood vessels. Recently, Lgals3/galectin-3 has been shown to regulate the balance between pro-inflammatory and anti-inflammatory effects of microglia in neurodegenerative diseases [42]. Our current study aligns with previous findings, highlighting the effects of blocking Lgals3/galectin-3 on the progression of CNV and subretinal fibrosis, along with the downregulation of Mcp-1/Ccl-2 (Figure 3). The current study suggested that Lgals3/galectin-3 could be a potential target gene to intensify inflammation-induced angiogenesis and subretinal fibrosis in the retina, which is driven in part by MCP-1/CCL-2 signaling pathway. Moreover, the combination therapy with anti-VEGF and Lgals3-siRNA was shown to be more effective than each drug being used separately (Figure 4).
Finally, we explored the molecular mechanism behind the upregulation of Lgals3/galectin-3 in CNV. Research has indicated that the RPE, a central cellular actor in the development of nAMD, plays significant roles in angiogenesis and the formation of subretinal fibrotic scars [43]. It is known that hypoxia plays a central role in causing CNV formation as it triggers the activation of the HIF family, which subsequently stimulates a broad range of genes [44]. Recent work indicated that hypoxia promotes Lgals3 activity depending on HIF-1α in renal carcinoma cells [45]. The promoter region of the human Lgals3 gene contains several regulatory elements, such as AP-1, cAMP-dependent response element (CRE) motifs, and a consensus basic helix–loop–helix (bHLH) core sequence [46]. In our study, we identified that the promoter sequence of the LGALS3 gene contained three hypoxia response elements (HREs) (Supplementary Data Figure S2), which might be involved in the regulation of Lgals3/galectin-3 by HIF-1α. Our in vitro study confirmed that LW6, a selective inhibitor of Hif-1a, significantly reduced the production of Lgals3. This suggests that an increase in Lgals3/galectin-3 could be stimulated by Hif-1a in RPE cells under hypoxic conditions (Figure 5). Furthermore, we performed an RNA-seq analysis on RPE/choroidal complex cells at postlaser day 7 and identified 2043 upregulated and 828 downregulated genes. These genes also regulate a number of biological pathways in the progression of CNV and subretinal fibrosis, such as the Neuroactive ligand-receptor interaction pathway, Calcium signaling pathway, and cAMP signaling pathways (Figure 6). These pathways need to be further studied.
In summary, in this study, we propose that HIF-1α binds HREs at the promoter region of Lgals3/galectin-3 to induce its expression under hypoxia in human RPE cells. Moreover, we highlight the role of Lgals3/galectin-3 mediated angiogenesis and subretinal fibrosis through inflammatory response in a laser-induced mouse model (Figure 7).
There are also some limitations to consider in this study. So far, several animal models have been demonstrated to mimic the pathological features commonly seen in AMD, including mouse models with oxidative damage and genetic mouse models. However, no one model recapitulates all of the features observed in AMD patients. All discoveries of Lgals3/galectin-3 were proved in the CNV mouse model, but not in other animal models. Additionally, Lgals3-siRNA has shown promising results for suppressing CNV and subretinal fibrosis; however, it would be difficult to deliver to the inner layer of the retina. Therefore, developing an effective drug delivery probably needs to be performed in future studies.

5. Conclusions

The development of angiogenesis and subretinal fibrosis in nAMD has become increasingly important since it significantly impacts the success of nAMD therapy. However, the molecular pathogenesis remains unclear. Our findings provide novel insights into the involvement of Lgals3/galectin-3 in nAMD. These findings indicated that Lgals3/galectin-3 plays an important role in the progression of nAMD, and it might be a promising therapeutic target of nAMD.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biomedicines12112649/s1, Figure S1: Efficiency of Lgals3-siRNA in ARPE-19 cells; Figure S2: Analyzation of HRE sites in GALECTIN-3/LGALS3 promoter. Excel S1: COV-vs-CON_DE_results.

Author Contributions

Conceptualization, D.W. and Y.L. designed the research; D.W. and Y.L. performed the experiments; D.W. and X.L. analyzed the data; Y.L., D.W., Z.C., Q.F. and K.Y. wrote the manuscript; and all authors approved the final version. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Zhejiang Provincial Natural Science Foundation of China (LQ21H120003 to Ye Liu), the National Natural Science Foundation of China (82301207 to Di Wu), and the Central guidance for local scientific and technological development funding projects (2024ZY01057 to Qiuli Fu).

Institutional Review Board Statement

The study was conducted in accordance with the Association for Research in Vision and Ophthalmology’s Statement for the Use of Animal in Ophthalmic and Vision Research and approved by the Ethics Committee of The Second Affiliated Hospital of Zhejiang University School of Medicine (#2021-121; 6 October 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

The first authors (D.W. and Y.L.) thank all members of the Department of Ophthalmology of Hokkaido University for teaching during their PhD’s study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Wong, W.L.; Su, X.; Li, X.; Cheung, C.M.; Klein, R.; Cheng, C.Y.; Wong, T.Y. Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: A systematic review and meta-analysis. Lancet Glob. Health 2014, 2, e106–e116. [Google Scholar] [CrossRef] [PubMed]
  2. Tenbrock, L.; Wolf, J.; Boneva, S.; Schlecht, A.; Agostini, H.; Wieghofer, P.; Schlunck, G.; Lange, C. Subretinal fibrosis in neovascular age-related macular degeneration: Current concepts, therapeutic avenues, and future perspectives. Cell Tissue Res. 2022, 387, 361–375. [Google Scholar] [CrossRef] [PubMed]
  3. Oncel, D.; Oncel, D.; Mishra, K.; Oncel, M.; Arevalo, J.F. Current Management of Subretinal Hemorrhage in Neovascular Age-Related Macular Degeneration. Ophthalmologica 2023, 246, 295–305. [Google Scholar] [CrossRef] [PubMed]
  4. Mettu, P.S.; Allingham, M.J.; Cousins, S.W. Incomplete response to Anti-VEGF therapy in neovascular AMD: Exploring disease mechanisms and therapeutic opportunities. Prog. Retin. Eye Res. 2021, 82, 100906. [Google Scholar] [CrossRef]
  5. Sheridan, C.M.; Pate, S.; Hiscott, P.; Wong, D.; Pattwell, D.M.; Kent, D. Expression of hypoxia-inducible factor-1alpha and -2alpha in human choroidal neovascular membranes. Graefes Arch. Clin. Exp. Ophthalmol. 2009, 247, 1361–1367. [Google Scholar] [CrossRef]
  6. Mammadzada, P.; Corredoira, P.M.; Andre, H. The role of hypoxia-inducible factors in neovascular age-related macular degeneration: A gene therapy perspective. Cell Mol. Life Sci. 2020, 77, 819–833. [Google Scholar] [CrossRef]
  7. Khanani, A.M.; Russell, M.W.; Aziz, A.A.; Danzig, C.J.; Weng, C.Y.; Eichenbaum, D.A.; Singh, R.P. Angiopoietins as Potential Targets in Management of Retinal Disease. Clin. Ophthalmol. 2021, 15, 3747–3755. [Google Scholar] [CrossRef]
  8. Biasella, F.; Strunz, T.; Kiel, C.; On Behalf Of The International Amd Genomics Consortium, I.; Weber, B.H.F.; Friedrich, U. Vitronectin and Its Interaction with PAI-1 Suggests a Functional Link to Vascular Changes in AMD Pathobiology. Cells 2022, 11, 1766. [Google Scholar] [CrossRef]
  9. Yamada, K.; Sakurai, E.; Itaya, M.; Yamasaki, S.; Ogura, Y. Inhibition of laser-induced choroidal neovascularization by atorvastatin by downregulation of monocyte chemotactic protein-1 synthesis in mice. Investig. Ophthalmol. Vis. Sci. 2007, 48, 1839–1843. [Google Scholar] [CrossRef]
  10. Ambati, J.; Anand, A.; Fernandez, S.; Sakurai, E.; Lynn, B.C.; Kuziel, W.A.; Rollins, B.J.; Ambati, B.K. An animal model of age-related macular degeneration in senescent Ccl-2- or Ccr-2-deficient mice. Nat. Med. 2003, 9, 1390–1397. [Google Scholar] [CrossRef]
  11. Wu, D.; Kanda, A.; Liu, Y.; Kase, S.; Noda, K.; Ishida, S. Galectin-1 promotes choroidal neovascularization and subretinal fibrosis mediated via epithelial-mesenchymal transition. FASEB J. 2019, 33, 2498–2513. [Google Scholar] [CrossRef]
  12. Verkerke, H.; Dias-Baruffi, M.; Cummings, R.D.; Arthur, C.M.; Stowell, S.R. Galectins: An Ancient Family of Carbohydrate Binding Proteins with Modern Functions. Methods Mol. Biol. 2022, 2442, 1–40. [Google Scholar] [PubMed]
  13. Johannes, L.; Jacob, R.; Leffler, H. Galectins at a glance. J. Cell Sci. 2018, 131, jcs208884. [Google Scholar] [CrossRef] [PubMed]
  14. Li, S.; Pritchard, D.M.; Yu, L.G. Galectin-3 promotes secretion of proteases that decrease epithelium integrity in human colon cancer cells. Cell Death Dis. 2023, 14, 268. [Google Scholar] [CrossRef]
  15. Gao, Z.; Liu, Z.; Wang, R.; Zheng, Y.; Li, H.; Yang, L. Galectin-3 Is a Potential Mediator for Atherosclerosis. J. Immunol. Res. 2020, 2020, 5284728. [Google Scholar] [CrossRef] [PubMed]
  16. Blanda, V.; Bracale, U.M.; Di Taranto, M.D.; Fortunato, G. Galectin-3 in Cardiovascular Diseases. Int. J. Mol. Sci. 2020, 21, 9232. [Google Scholar] [CrossRef] [PubMed]
  17. Perez-Moreno, E.; Oyanadel, C.; de la Pena, A.; Hernandez, R.; Perez-Molina, F.; Metz, C.; Gonzalez, A.; Soza, A. Galectins in epithelial-mesenchymal transition: Roles and mechanisms contributing to tissue repair, fibrosis and cancer metastasis. Biol. Res. 2024, 57, 14. [Google Scholar] [CrossRef]
  18. Saravanan, C.; Liu, F.T.; Gipson, I.K.; Panjwani, N. Galectin-3 promotes lamellipodia formation in epithelial cells by interacting with complex N-glycans on alpha3beta1 integrin. J. Cell Sci. 2009, 122, 3684–3693. [Google Scholar] [CrossRef]
  19. Andrade, F.E.C.; Correa, M.P.; Gimenes, A.D.; Dos Santos, M.S.; Campos, M.; Chammas, R.; Gomes, J.A.P.; Gil, C.D. Galectin-3: Role in ocular allergy and potential as a predictive biomarker. Br. J. Ophthalmol. 2018, 102, 1003–1010. [Google Scholar] [CrossRef]
  20. Esposito, N.J.; Mazzoni, F.; Vargas, J.A.; Finnemann, S.C. Diurnal Photoreceptor Outer Segment Renewal in Mice Is Independent of Galectin-3. Investig. Ophthalmol. Vis. Sci. 2021, 62, 7. [Google Scholar] [CrossRef]
  21. Pitts, K.M.; Neeson, C.E.; Hall, N.E.; Lin, J.B.; Falah, H.K.; Wang, S.L.; Lo, K.T.; Song, C.E.; Margeta, M.A.; Sola-Del Valle, D.A. Neurodegeneration Markers Galectin-3 and Apolipoprotein E Are Elevated in the Aqueous Humor of Eyes With Glaucoma. Transl. Vis. Sci. Technol. 2022, 11, 1. [Google Scholar] [CrossRef] [PubMed]
  22. Liu, Y.; Zhao, C.; Meng, J.; Li, N.; Xu, Z.; Liu, X.; Hou, S. Galectin-3 regulates microglial activation and promotes inflammation through TLR4/MyD88/NF-kB in experimental autoimmune uveitis. Clin. Immunol. 2022, 236, 108939. [Google Scholar] [CrossRef] [PubMed]
  23. Canning, P.; Glenn, J.V.; Hsu, D.K.; Liu, F.T.; Gardiner, T.A.; Stitt, A.W. Inhibition of advanced glycation and absence of galectin-3 prevent blood-retinal barrier dysfunction during short-term diabetes. Exp. Diabetes Res. 2007, 2007, 51837. [Google Scholar] [CrossRef] [PubMed]
  24. An, E.; Lu, X.; Flippin, J.; Devaney, J.M.; Halligan, B.; Hoffman, E.P.; Strunnikova, N.; Csaky, K.; Hathout, Y. Secreted proteome profiling in human RPE cell cultures derived from donors with age related macular degeneration and age matched healthy donors. J. Proteome Res. 2006, 5, 2599–2610. [Google Scholar] [CrossRef] [PubMed]
  25. Liu, Y.; Kanda, A.; Wu, D.; Ishizuka, E.T.; Kase, S.; Noda, K.; Ichihara, A.; Ishida, S. Suppression of Choroidal Neovascularization and Fibrosis by a Novel RNAi Therapeutic Agent against (Pro)renin Receptor. Mol. Ther. Nucleic Acids 2019, 17, 113–125. [Google Scholar] [CrossRef]
  26. Chang, Y.H.; Hsing, C.H.; Chiu, C.J.; Wu, Y.R.; Hsu, S.M.; Hsu, Y.H. Protective role of IL-17-producing gammadelta T cells in a laser-induced choroidal neovascularization mouse model. J. Neuroinflamm. 2023, 20, 279. [Google Scholar] [CrossRef]
  27. Liu, Y.; Wu, D.; Fu, Q.; Hao, S.; Gu, Y.; Zhao, W.; Chen, S.; Sheng, F.; Xu, Y.; Chen, Z.; et al. CHAC1 as a Novel Contributor of Ferroptosis in Retinal Pigment Epithelial Cells with Oxidative Damage. Int. J. Mol. Sci. 2023, 24, 1582. [Google Scholar] [CrossRef]
  28. Suzuki, M.; Tsujikawa, M.; Itabe, H.; Du, Z.J.; Xie, P.; Matsumura, N.; Fu, X.; Zhang, R.; Sonoda, K.H.; Egashira, K.; et al. Chronic photo-oxidative stress and subsequent MCP-1 activation as causative factors for age-related macular degeneration. J. Cell Sci. 2012, 125 Pt 10, 2407–2415. [Google Scholar] [CrossRef]
  29. Rosenfeld, P.J.; Brown, D.M.; Heier, J.S.; Boyer, D.S.; Kaiser, P.K.; Chung, C.Y.; Kim, R.Y.; Group, M.S. Ranibizumab for neovascular age-related macular degeneration. N. Engl. J. Med. 2006, 355, 1419–1431. [Google Scholar] [CrossRef]
  30. Corrado, C.; Fontana, S. Hypoxia and HIF Signaling: One Axis with Divergent Effects. Int. J. Mol. Sci. 2020, 21, 5611. [Google Scholar] [CrossRef]
  31. Kukurba, K.R.; Montgomery, S.B. RNA Sequencing and Analysis. Cold Spring Harb. Protoc. 2015, 2015, 951–969. [Google Scholar] [CrossRef] [PubMed]
  32. Bonsack, F.; Sukumari-Ramesh, S. Differential Cellular Expression of Galectin-1 and Galectin-3 After Intracerebral Hemorrhage. Front. Cell Neurosci. 2019, 13, 157. [Google Scholar] [CrossRef] [PubMed]
  33. Zhou, Z.Y.; Chang, T.F.; Lin, Z.B.; Jing, Y.T.; Wen, L.S.; Niu, Y.L.; Bai, Q.; Guo, C.M.; Sun, J.X.; Wang, Y.S.; et al. Microglial Galectin3 enhances endothelial metabolism and promotes pathological angiogenesis via Notch inhibition by competitively binding to Jag1. Cell Death Dis. 2023, 14, 380. [Google Scholar] [CrossRef]
  34. Andrade, F.E.C.; Correia-Silva, R.D.; Covre, J.L.; Lice, I.; Gomes, J.A.P.; Gil, C.D. Effects of galectin-3 protein on UVA-induced damage in retinal pigment epithelial cells. Photochem. Photobiol. Sci. 2023, 22, 21–32. [Google Scholar] [CrossRef]
  35. Abreu, C.A.; De Lima, S.V.; Mendonca, H.R.; Goulart, C.O.; Martinez, A.M. Absence of galectin-3 promotes neuroprotection in retinal ganglion cells after optic nerve injury. Histol. Histopathol. 2017, 32, 253–262. [Google Scholar]
  36. Sedlar, A.; Travnickova, M.; Bojarova, P.; Vlachova, M.; Slamova, K.; Kren, V.; Bacakova, L. Interaction between Galectin-3 and Integrins Mediates Cell-Matrix Adhesion in Endothelial Cells and Mesenchymal Stem Cells. Int. J. Mol. Sci. 2021, 22, 5144. [Google Scholar] [CrossRef]
  37. Markowska, A.I.; Jefferies, K.C.; Panjwani, N. Galectin-3 protein modulates cell surface expression and activation of vascular endothelial growth factor receptor 2 in human endothelial cells. J. Biol. Chem. 2011, 286, 29913–29921. [Google Scholar] [CrossRef]
  38. Chen, W.S.; Cao, Z.; Leffler, H.; Nilsson, U.J.; Panjwani, N. Galectin-3 Inhibition by a Small-Molecule Inhibitor Reduces Both Pathological Corneal Neovascularization and Fibrosis. Investig. Ophthalmol. Vis. Sci. 2017, 58, 9–20. [Google Scholar] [CrossRef] [PubMed]
  39. Yuan, X.; Gu, X.; Crabb, J.S.; Yue, X.; Shadrach, K.; Hollyfield, J.G.; Crabb, J.W. Quantitative proteomics: Comparison of the macular Bruch membrane/choroid complex from age-related macular degeneration and normal eyes. Mol. Cell Proteom. 2010, 9, 1031–1046. [Google Scholar] [CrossRef]
  40. Xie, P.; Kamei, M.; Suzuki, M.; Matsumura, N.; Nishida, K.; Sakimoto, S.; Sakaguchi, H.; Nishida, K. Suppression and regression of choroidal neovascularization in mice by a novel CCR2 antagonist, INCB3344. PLoS ONE 2011, 6, e28933. [Google Scholar] [CrossRef]
  41. Tan, W.; Zou, J.; Yoshida, S.; Jiang, B.; Zhou, Y. The Role of Inflammation in Age-Related Macular Degeneration. Int. J. Biol. Sci. 2020, 16, 2989–3001. [Google Scholar] [CrossRef] [PubMed]
  42. Garcia-Revilla, J.; Boza-Serrano, A.; Espinosa-Oliva, A.M.; Soto, M.S.; Deierborg, T.; Ruiz, R.; de Pablos, R.M.; Burguillos, M.A.; Venero, J.L. Galectin-3, a rising star in modulating microglia activation under conditions of neurodegeneration. Cell Death Dis. 2022, 13, 628. [Google Scholar] [CrossRef] [PubMed]
  43. Kauppinen, A.; Paterno, J.J.; Blasiak, J.; Salminen, A.; Kaarniranta, K. Inflammation and its role in age-related macular degeneration. Cell Mol. Life Sci. 2016, 73, 1765–1786. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, L.; Cui, X.; Han, Y.; Park, K.S.; Gao, X.; Zhang, X.; Yuan, Z.; Hu, Y.; Hsu, C.W.; Li, X.; et al. Hypoxic drive caused type 3 neovascularization in a preclinical model of exudative age-related macular degeneration. Hum. Mol. Genet. 2019, 28, 3475–3485. [Google Scholar] [CrossRef]
  45. Gu, X.; Meng, H.; Wang, J.; Wang, R.; Cao, M.; Liu, S.; Chen, H.; Xu, Y. Hypoxia contributes to galectin-3 expression in renal carcinoma cells. Eur. J. Pharmacol. 2021, 890, 173637. [Google Scholar] [CrossRef]
  46. Dumic, J.; Dabelic, S.; Flogel, M. Galectin-3: An open-ended story. Biochim. Biophys. Acta 2006, 1760, 616–635. [Google Scholar] [CrossRef]
Biomedicines 12 02649 g001
Figure 1. RNA-seq analysis of RPE/choroidal complex in laser injury mouse model at postlaser day 7. (A) A schema illustrating laser-induced CNV model in mice. (B) Fluorescein angiography of CNV model. (C) Fundus images of CNV model with cross-section OCT scans trace (red arrow). (D) Cross-sectional OCT scans of the lesion showing the disruption of BM at day 7. (E) CNV (Isolectin B4, green) image in laser-induced mouse model. (F) Subretinal fibrosis (Type I collagen, red) image in laser-induced mouse model. (G) Merge image of CNV and subretinal fibrosis lesions in laser-induced mouse model. Scale bar, 100 μm.
Figure 1. RNA-seq analysis of RPE/choroidal complex in laser injury mouse model at postlaser day 7. (A) A schema illustrating laser-induced CNV model in mice. (B) Fluorescein angiography of CNV model. (C) Fundus images of CNV model with cross-section OCT scans trace (red arrow). (D) Cross-sectional OCT scans of the lesion showing the disruption of BM at day 7. (E) CNV (Isolectin B4, green) image in laser-induced mouse model. (F) Subretinal fibrosis (Type I collagen, red) image in laser-induced mouse model. (G) Merge image of CNV and subretinal fibrosis lesions in laser-induced mouse model. Scale bar, 100 μm.
Biomedicines 12 02649 g001
Biomedicines 12 02649 g002
Figure 2. Upregulation of Lgals3/galectin-3 in RPE/choroidal complex of CNV model. (A) Lgals3 mRNA expression in RPE/choroidal complex of CNV and non-treated mice. (B) Western blot analysis of Galectin-3 in the RPE/choroidal complex of mice with CNV at postlaser day 7. n = 3 in each group. ** p < 0.01, * p < 0.05.
Figure 2. Upregulation of Lgals3/galectin-3 in RPE/choroidal complex of CNV model. (A) Lgals3 mRNA expression in RPE/choroidal complex of CNV and non-treated mice. (B) Western blot analysis of Galectin-3 in the RPE/choroidal complex of mice with CNV at postlaser day 7. n = 3 in each group. ** p < 0.01, * p < 0.05.
Biomedicines 12 02649 g002
Biomedicines 12 02649 g003
Figure 3. Silencing of Lgals3 suppressed the area of CNV and subretinal fibrosis, together with Mcp-1 and Icam-1 levels decline. (A–F) Representative images of CNV (Isolectin B4, green) and subretinal fibrosis (Type I collagen, red) in RPE/choroidal complex of CNV mice with or without Lgals3-siRNA intravitreal injection. Scale bar, 100 μm. (G,H) Quantitative analyses for the area of CNV [CON-siRNA = 12,671 ± 3392, Lgals3-siRNA = 17,110 ± 7979] and subretinal fibrosis [CON-siRNA = 17,110 ± 7979, Lgals3-siRNA = 11,481 ± 3053]. (I–L) Fundus images and fluorescein angiography of CNV model with Con-siRNA or Lgals3-siRNA. (M) The mRNA expression levels of Mcp-1 in RPE/choroidal complex of CNV mice with or without Lgals3-siRNA intravitreal injection. n = 5 in each group. * p < 0.05, ** p < 0.01.
Figure 3. Silencing of Lgals3 suppressed the area of CNV and subretinal fibrosis, together with Mcp-1 and Icam-1 levels decline. (A–F) Representative images of CNV (Isolectin B4, green) and subretinal fibrosis (Type I collagen, red) in RPE/choroidal complex of CNV mice with or without Lgals3-siRNA intravitreal injection. Scale bar, 100 μm. (G,H) Quantitative analyses for the area of CNV [CON-siRNA = 12,671 ± 3392, Lgals3-siRNA = 17,110 ± 7979] and subretinal fibrosis [CON-siRNA = 17,110 ± 7979, Lgals3-siRNA = 11,481 ± 3053]. (I–L) Fundus images and fluorescein angiography of CNV model with Con-siRNA or Lgals3-siRNA. (M) The mRNA expression levels of Mcp-1 in RPE/choroidal complex of CNV mice with or without Lgals3-siRNA intravitreal injection. n = 5 in each group. * p < 0.05, ** p < 0.01.
Biomedicines 12 02649 g003
Biomedicines 12 02649 g004
Figure 4. Comparison of Lgals3-siRNA and Ranibizumab for suppression of CNV and subretinal fibrosis development. (A–L) Representative micrographs of CNV (Isolectin B4, green) and subretinal fibrosis (Type I collagen, red) in the RPE/choroidal complex of CNV mice treated with intravitreal injection of PBS (A–C), Ranibizumab (D–F), Lgals3-siRNA (G–I), and mixture of Ranibizumab + Lgals3-siRNA (J–L), respectively. Scale bar, 100 μm. n = 6. (M,N) Quantification analysis of the sizes of CNV [PBS =12,671 ± 3992, Ranibizumab = 7697 ± 1785, Lgals3-siRNA = 7959 ± 2308, Lgals3-siRNA + Ranibizumab = 6616 ± 1903] and subretinal fibrosis [PBS =17,110 ± 7979, Ranibizumab = 14,583 ± 3983, Lgals3-siRNA =11,422 ± 3333, Lgals3-siRNA + Ranibizumab = 8797 ± 3142]. * p < 0.05, ** p < 0.01. n = 6. n.s., not significant.
Figure 4. Comparison of Lgals3-siRNA and Ranibizumab for suppression of CNV and subretinal fibrosis development. (A–L) Representative micrographs of CNV (Isolectin B4, green) and subretinal fibrosis (Type I collagen, red) in the RPE/choroidal complex of CNV mice treated with intravitreal injection of PBS (A–C), Ranibizumab (D–F), Lgals3-siRNA (G–I), and mixture of Ranibizumab + Lgals3-siRNA (J–L), respectively. Scale bar, 100 μm. n = 6. (M,N) Quantification analysis of the sizes of CNV [PBS =12,671 ± 3992, Ranibizumab = 7697 ± 1785, Lgals3-siRNA = 7959 ± 2308, Lgals3-siRNA + Ranibizumab = 6616 ± 1903] and subretinal fibrosis [PBS =17,110 ± 7979, Ranibizumab = 14,583 ± 3983, Lgals3-siRNA =11,422 ± 3333, Lgals3-siRNA + Ranibizumab = 8797 ± 3142]. * p < 0.05, ** p < 0.01. n = 6. n.s., not significant.
Biomedicines 12 02649 g004
Biomedicines 12 02649 g005
Figure 5. Expression of Lgals3/galectin-3 in ARPE-19 cells with silencing of Hif-1a under hypoxic conditions. (A) Lgals3 mRNA expression at 24 h after hypoxic stimulation. (B) Hif-1a mRNA expression with Hif-1a inhibitor under hypoxic conditions. (C) Lgals3 mRNA expression with or without Hif-1a inhibitor under hypoxic conditions. n = 5 in each group. * p < 0.05, ** p < 0.01.
Figure 5. Expression of Lgals3/galectin-3 in ARPE-19 cells with silencing of Hif-1a under hypoxic conditions. (A) Lgals3 mRNA expression at 24 h after hypoxic stimulation. (B) Hif-1a mRNA expression with Hif-1a inhibitor under hypoxic conditions. (C) Lgals3 mRNA expression with or without Hif-1a inhibitor under hypoxic conditions. n = 5 in each group. * p < 0.05, ** p < 0.01.
Biomedicines 12 02649 g005
Biomedicines 12 02649 g006
Figure 6. Identification of DEGs and pathways in RPE cells by CNV induction. (A) The volcano plot of differentially expressed genes in RPE/choroidal complex of CNV mode. (B) The GO enrichment analysis bar diagram. (C) The KEGG enrichment analysis scatter plot.
Figure 6. Identification of DEGs and pathways in RPE cells by CNV induction. (A) The volcano plot of differentially expressed genes in RPE/choroidal complex of CNV mode. (B) The GO enrichment analysis bar diagram. (C) The KEGG enrichment analysis scatter plot.
Biomedicines 12 02649 g006
Biomedicines 12 02649 g007
Figure 7. Galectin-3 involvement in the molecular pathogenesis of CNV.
Figure 7. Galectin-3 involvement in the molecular pathogenesis of CNV.
Biomedicines 12 02649 g007
Table 1. Primers used for real-time PCR amplification.
Table 1. Primers used for real-time PCR amplification.
Primer, 5′-3′
GeneForwardReverse
Lgals3AACACGAAGCAGGACAATAACTGGGCAGTAGGTGAGCATCGTTGAC
Hif-1aTGCTCATCAGTTGCCACTTCTGGGCCATTTCTGTGTGTAA
Ccl2TTGGCTCAGCCAGATGCACCTACTCATTGGGATCATCTTGC
GapdhAGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wu, D.; Liu, Y.; Luo, X.; Chen, Z.; Fu, Q.; Yao, K. Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation. Biomedicines 2024, 12, 2649. https://doi.org/10.3390/biomedicines12112649

AMA Style

Wu D, Liu Y, Luo X, Chen Z, Fu Q, Yao K. Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation. Biomedicines. 2024; 12(11):2649. https://doi.org/10.3390/biomedicines12112649

Chicago/Turabian Style

Wu, Di, Ye Liu, Xiaogang Luo, Zhiqing Chen, Qiuli Fu, and Ke Yao. 2024. "Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation" Biomedicines 12, no. 11: 2649. https://doi.org/10.3390/biomedicines12112649

APA Style

Wu, D., Liu, Y., Luo, X., Chen, Z., Fu, Q., & Yao, K. (2024). Involvement of Lgals3/Galectin-3 in Choroidal Neovascularization and Subretinal Fibrosis Formation. Biomedicines, 12(11), 2649. https://doi.org/10.3390/biomedicines12112649

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop