Next Article in Journal
Loss of Phosphomannose Isomerase Impairs Growth, Perturbs Cell Wall Integrity, and Reduces Virulence of Fusarium oxysporum f. sp. cubense on Banana Plants
Next Article in Special Issue
New Ascomycetes from the Mexican Tropical Montane Cloud Forest
Previous Article in Journal
Fungal β-Glucan-Based Nanotherapeutics: From Fabrication to Application
Previous Article in Special Issue
Disentangling the Taxonomy, Systematics, and Life History of the Spider-Parasitic Fungus Gibellula (Cordycipitaceae, Hypocreales)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 9
Issue 4
10.3390/jof9040477
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Novelties in Macrofungi of the Tropical Montane Cloud Forest in Mexico

by
Ricardo Valenzuela
1,
Isolda Luna-Vega
2,
Michelle Martínez-Pineda
1,
César Ramiro Martínez-González
3,
Jesús García-Jiménez
4,
Javier de la Fuente
5,
Silvia Bautista-Hernández
1,
Salvador Acosta-Castellanos
1 and
Tania Raymundo
1,*
1
Laboratorio de Micología, Departamento de Botánica, Instituto Politécnico Nacional, Escuela Nacional de Ciencias Biológicas, Mexico City 11340, CDMX, Mexico
2
Laboratorio de Biogeografía y Sistemática, Departamento de Biología Evolutiva, Facultad de Ciencias, Universidad Nacional Autónoma de México, Mexico City 04510, CDMX, Mexico
3
Instituto de Horticultura, Departamento de Fitotecnia, Universidad Autónoma Chapingo, Km 38.5 Carretera Federal México-Texcoco, Texcoco 56230, Estado de México, Mexico
4
Tecnológico Nacional de México, Instituto Tecnológico de Ciudad Victoria, Blvd. Emilio Portes Gil #1301 Pte., Ciudad Victoria 87010, Tamaulipas, Mexico
5
Colegio de Posgraduados, Km 36.5, Montecillo, Texcoco 56230, Estado de México, Mexico
*
Author to whom correspondence should be addressed.
J. Fungi 2023, 9(4), 477; https://doi.org/10.3390/jof9040477
Submission received: 25 February 2023 / Revised: 5 April 2023 / Accepted: 11 April 2023 / Published: 15 April 2023
(This article belongs to the Special Issue Phylogeny and Diversity of Forestry Fungi)
Browse Figures
Versions Notes

Abstract

:
The tropical montane cloud forest in Mexico is the most diverse and threatened ecosystem. Mexican macrofungi numbers more than 1408 species. This study described four new species of Agaricomycetes (Bondarzewia, Gymnopilus, Serpula, Sparassis) based on molecular and morphological characteristics. Our results support that Mexico is among the most biodiverse countries in terms of macrofungi in the Neotropics.

1. Introduction

In Mexico, the tropical montane cloud forest (TMCF), also known as a cloud forest or “bosque mesófilo de montaña”, groups together a set of physiognomically heterogeneous plant communities. The canopy of these forests is usually composed of evergreen trees, but the medium and low-strata trees are deciduous. The high abundance of epiphytes and ferns gives the forest an exuberant appearance [1,2]. The TMCF features a mixture of Holarctic affinities in the upper arboreal stratum and meridional affinities in the medium, low, shrub, and herbaceous strata [3,4,5]. These forests inhabit mountainous areas, mainly between 600 (1200) and 2500 (3200) m above sea level, with seasonal persistence of high relative humidity and rainfall that ranges from 2000 to 4000 (5300) mm per year. The soils are mainly acidic and prosper in temperate climates [6,7,8]. One of the most outstanding characteristics of these forests is that the arboreal canopy intercepts and condenses the fog, which precipitates and contributes about 50% of the total local precipitation [9].
Mexican TMCF presents a great β diversity, showing a high turnover of species [10]. In Mexico, this ecosystem has the highest number of species per unit area (in Oaxaca, up to 75 spp/0.1 ha: div. α). Mexico has 2500 almost exclusive vascular plant species in less than 1% of the territory [1,11]. The forest contains approximately 10% of the total flora of Mexico, of which 30% of the species are endemic [1].
TMCF is one of the most threatened ecosystems in the country [3,12,13] (Figure 1). The demographic explosion, clandestine logging, coffee cultivation, cattle grazing, and semi-nomadic agriculture have caused a drastic decrease in its extension in recent decades. The area occupied by this forest was reduced to less than a tenth in twenty years [13]. The extensive use of these forests began after the conquest, with the displacement of indigenous people to more abrupt lands, and during the Porfiriato (1877–1911) with large-scale coffee plantations [14]. In addition, the TMCF occupies fragile and acidic low-fertility soils [5,15].
In the last 70 years in Mexico, various studies have been carried out on the TMCF [1,5,6,16,17,18,19,20,21,22,23,24,25,26,27]. The floristic associations in the TMCF are unique and maintain a variable degree of relationships. This variation in the TMCF of Mexico increases when it is considered on the regional scale [28]. The Mexican states with the highest forest coverage are Oaxaca, Chiapas, and Hidalgo [13].
The diversity of fungi is estimated at 1.5–3.8 million species worldwide, of which 120,000 have been described [29]; macrofungi represent 18% of this diversity. Fungi have not been studied thoroughly, and it has been estimated that there could be as many as 53,000 to 110,000 more species [30]. This number may vary if we consider cryptic and species complexes that have been clarified from polyphasic or comprehensive studies [31].
The study of macrofungi in Mexico is still incipient. The groups best studied are Pezizales and Xylariales for Ascomycota, while Agaricales, Boletales, Dacrymycetales, Hymenochaetales, Polyporales, and Russulales are the most recorded in Basidiomycota. Monographic studies have only been undertaken for 60 genera [32]. In the Comisión Nacional para el Estudio y Conocimiento de la Biodiversidad (CONABIO) catalog [33], Cifuentes (2008) [34] registered 2135 fungi species from Mexico.
Recently, Del Olmo et al. (2017) [35] analyzed 6349 records of fungi ascribed to 2962 species from the tropical montane cloud forests (Mexico, Guatemala, Belize, Brazil, Colombia, Costa Rica, Panama, Venezuela), of which 220 taxa were described initially from this ecosystem. These authors indicated that Mexico presents 36% of these records (1274 species).
The genera Bondarzewia, Gymnopilus, Serpula, and Sparassis belong to the class Agaricomycetes in the orders Russulales, Agaricales, Boletales, and Polyporales, respectively. The order Russulales is the most diverse morphologically. It contains a remarkable variety of sporophore forms, including resupinate, discoid, effused-reflexed, clavarioid, pileate, or gasteroid and hymenophore configurations go from smooth, poroid, hydnoid, and lamellate to labyrinthoid forms [36]. This order contains ten families, 98 genera, and 4436 species. The family Bondarzewiaceae and genus Bondarzewia were recognized phylogenetically with well-supported posterior probability (PP) values [37]. Among the Russulales, Bondarzewia is characterized morphologically by strongly amyloid and ornamented basidiospores [38].
The Agaricales or euagarics is the largest clade of Agaricomycetes, including more than half of all known species. Most are agaricoid fungi, including also clavarioid and gasteroid fungi [38]. The order contains 38 families, 508 genera, and 17,291 species. The family Hymenogastraceae and the genus Gymnopilus have been recognized phylogenetically based on well-supported PP values [37]. The family Hymenogastraceae includes nine agaricoid genera and one gasteroid genus with ornamented or smooth, brown spores. There are no morphological synapomorphies that distinguish the members of this group.
The Boletales includes conspicuous stipitate-pileate forms with tubular or lamellate hymenophores but also includes gasteroid, resupinate, or crust-like fungi that produce smooth, merulioid, hydnoid, or polyporoid hymenophores [39]. The order contains 16 families, 141 genera, and 2022 species. The family Serpulaceae and the genus Serpula have been recognized phylogenetically with well-supported PP values [37].
The saprotrophs species (or wood decay fungi) of Boletales developed a unique mode of brown rot called “Coniophoraceae-rot”. Serpulaceae comprises three genera: two of them are ectomycorrhizal fungi and Serpula produces brown rot [39]. Given the diversity of fruiting body forms, we assume that there has been extensive homoplasy in the evolution of Boletales. However, no apparent morphological character distinguishes the group, which is only diagnosed by molecular sequences.
The Polyporales include various basidiocarp types and hymenophore configurations, including bracket-shaped, effused resupinate, stipitate with poroid, lamellate, or smooth hymenophores. Few species produce shelf-like or flabellate clusters of overlapping basidiocarps [40]. The order contains 18 families, 285 genera, and 2544 species. The family Sparassidaceae and the genus Sparassis have been recognized phylogenetically with well-supported PP values; analyzed the combination of rpb1 and ribosomal RNA genes [37,41]; these authors discovered a robust resolution of many clades, including 18 families. However, these authors mentioned that some nodes remain weakly supported; perhaps because numerous taxa have not been sampled yet. The researchers [41] found that macroscopic and microscopic characters are variable and are present in several families of Polyporales [41]. Variations and transitions among basidiocarp types exist, and no morphological synapomorphy unites the Polyporales [40]. The most common ‘‘polyporoid’’ basidiocarp type also has convergently evolved in at least 11 additional orders of Agaricomycetes [39].
In Mexico, particular emphasis has been placed on studying the macrofungi of this type of forest. Many have been classified as in danger of extinction due to the high anthropogenic action [1,4]. The main objective of this study is (1) to describe new species and (2) to recognize and publicize the Mexican TMCF fungal richness. The present contribution aims to describe species distributed in the Mexican TMCF, an ecosystem that is in danger of extinction.

2. Material and Methods

2.1. Morphological Studies

The specimens were deposited in the “Dr. Gastón Guzmán Huerta” fungi collection of the Herbarium of the Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, Mexico City, Mexico (ENCB) and “Jose Castillo Tovar” of the Instituto Tecnológico de Ciudad Victoria (ITCV). Georeferences were obtained with Garmin e-Trex 32X GPS (Garmin Ltd., Olathe, USA). Color codes follow Kornerup and Wanscher [42] and Bessette et al. [43]. Microscopic observations were taken from tissues rehydrated in 5% aqueous KOH and Melzer’s reagent; basidiospore dimensions include the ornamentation. Macroscopic features were photographed with a Nikon D7000 camera, (Nikon Corporation, Tokyo, Japan) and the micrographs were with a Sony DSCWX350 camera (Tokyo, Japan). Additionally, scanning electron microscopy (SEM; Hitachi SU1510, Hitachi, Japan) was used to observe the detail of the spore wall. The meanings of taxonomic terms are based on [44].

2.2. Extraction, Amplification, and Sequencing

We obtained the DNA from herbaria material. The CTAB protocol of [45] was used to extract genomic DNA. The DNA was quantified with a Nanodrop 2000c (Thermo ScientificTM, Wilmington, CA, USA). Then, we prepared dilutions from each sample at 20 ng/µL to amplify the following regions: the internal transcribed spacer rDNA-ITS1 5.8S rDNA-ITS2 (ITS), the larger nuclear subunit ribosomal DNA (nLSU), the second largest subunit of the RNA polymerase II gene (rpb2), the region of the small mitochondrial subunit (SSU), the subunit (atp6), and the translation elongation factor 1-α (tef1) (Table 1). The sequences used for each species are described in the corresponding section. The reaction mixture for PCRs was performed on a final volume of 15 µL containing 1x buffer, 0.8 mM dNTPs mix, 20 pmol of each primer, 2 units of GoTaq DNA (Promega Corporation, Madison, WI, USA), and 100 ng of template DNA. The PCR products were verified by agarose gel electrophoresis. The gels were run for 1 h at 95 V cm−3 in 1.5% agarose and 1× TAE buffer (Tris Acetate-EDTA). The gel was stained with GelRed (Biotium, Fremont, CA, USA), and the bands were visualized in an Infinity 3000 transilluminator (Vilber Lourmat, Eberhardzell, Germany). The amplified products were purified with the ExoSAP Purification kit (Affymetrix Inc., Santa Clara, CA, USA), following the manufacturer’s instructions. Then, they were quantified and prepared for the sequence reaction using a BigDye Terminator v.3.1 (Applied Biosystems, Foster City, CA, USA). These products were sequenced in both directions with an Applied Biosystem model 3730XL (Applied BioSystems, Foster City, CA, USA) at the Instituto de Biología of the Universidad Nacional Autónoma de México (UNAM). The sequences obtained were compared with the original chromatograms to detect and correct possible reading errors. The sequences of both strands of each of the genes were analyzed, edited, and assembled using BioEdit v. 7.0.5 [46] to generate a consensus sequence and then compared with those deposited in GenBank (2020) using the tool BLASTN v. 2.2.9 [47,48,49,50,51].

2.3. Phylogenetic Analysis

The alignment obtained to explore the phylogenetic relationships of the new species of Gymnopilus was based on the taxonomic sampling employed by [52,53] (Table 2). The ITS region was aligned using the online version of MAFFT v. 7 [54,55,56]. Alignments were reviewed in PhyDE v.10.0 [57], followed by minor manual adjustments to ensure character homology between taxa. The matrix was composed of 88 taxa (697 characters).
In the case of the new species of Serpula, we followed the taxonomic sampling of [58] (Table 3). First, the ITS region was aligned using the online version of MAFFT v. 7 [54,55,56]. Next, alignment was reviewed in PhyDE v.10.0 [57], followed by minor manual adjustments to ensure character homology between taxa. The matrix was composed of 46 taxa (700 characters).
To analyze the new species of Sparassis, we followed the taxonomic sampling of [59] (Table 4). Each gene region was independently aligned using the online version of MAFFT v. 7 [54,55,56]. Alignment was reviewed in PhyDE v.10.0 [57], followed by minor manual adjustments to ensure character homology between taxa. The matrix was formed for ITS by 20 taxa (690 characters) and LSU by 19 taxa (831 characters). We established two partitioning schemes, one for the ITS and one for the LSU, using the option to minimize the stop codon with Mesquite v 3.70 [60].
In the case of the new species of Bondarzewia, an alignment was made based on the taxonomic sampling employed by [61] (Table 5). Each gene region was independently aligned using the online version of MAFFT v. 7 [54,55,56]. The alignment was reviewed in PhyDE v.10.0 [57], followed by minor manual adjustments to ensure the character homology among taxa. The matrix was formed for ITS by 30 taxa (690 characters), for LSU by 26 taxa (831 characters), and for mtSSU by 21 taxa (640 characters), while translation elongation factor 1-α (tef1) was formed by 23 taxa (670 characters). Finally, the aligned matrices were concatenated into a single matrix (30 taxa, 2831 characters). Six partitioning schemes were established: one for the ITS, one for the nLSU, one SSU, and three for the tef1 gene region, using the option to minimize the stop codon with Mesquite v3.70 [60].
Phylogenetic inferences were estimated with maximum likelihood in RAxML v. 8.2.10 [62] with a GTR + G model of nucleotide substitution. In addition, 10,000 nonparametric rapid bootstrap pseudoreplicates assessed the branch support that was run with the GTRGAMMA model. For Bayesian posterior probability, the best evolutionary model for alignment was sought using the Partition Finder [63,64,65]. Phylogeny analyses were performed using MrBayes v. 3.2.6 × 64 [66]. The information block for the matrix includes two simultaneous runs, four Montecarlo chains, temperature set to 0.2, and sampling 10 million generations (standard deviation ≤ 0.1) with trees sampled every 1000 generations. The first 25% of the samples were discarded as burn-in, and stationarity was checked in Tracer v. 1.6 [67]. Trees were visualized and optimized in FigTree v. 1.4.4 [67] and edited in Adobe Illustrator vCS4 (Adobe Systems, Inc., San Jose, CA, USA).

3. Results

Taxonomy

Agaricomycetes, Agaricales, Hymenogastraceae
Gymnopilus guzmanii R. Valenz., Baut.-Hern., and Raymundo sp. nov.
MycoBank: MB842046
Figures: Figure 2 and Figure 3
Diagnosis: This species is different from other large annulate Gymnopilus species by its basidiomata growing in caespitose clusters on the ground of TMCF with fibrillose-squamulose, yellowish-orange to orange-red pileus and microscopically, basidiospores 7–9 × 5.5–7 µm, broadly ellipsoid, subreticulate to coarsely roughened with irregular large warts and ridges.
Type: MÉXICO: Hidalgo state, Tlanchinol municipality, El Temazate, 21°01′40″ N, 98°38′33″ W, 1500 m, 18 July 2012, R. Valenzuela 14674 (ENCB, Holotype). Figure 4.
Genbank: ITS: OW764567.
Etymology: This species is dedicated to Dr. Gastón Guzmán, a Mexican mycologist pioneer in studying macrofungi in México.
Pileus 50–200 mm diameter, convex when young, then plane-convex to depressed at the center in mature specimens, yellowish orange (4B7) to light orange (5A5) or reddish orange (7B7) when young; yellowish orange (4B7), orange (6B7) to reddish orange (7B7) to the margin; and brownish orange (7C8), orange red (8B7), red pastel (8A5) to brownish red (8C7), dark red (10C8) with KOH 5%, dry, fibrillose-squamulose, margin appendiculate in young specimens, eroded in some parts, recurved in mature specimens; lamellae adnate to subdecurrent, vivid yellow (3A8) or deep yellow (4A8) when young; yellowish brown (5E8) in mature specimens; close, broad, up to 20 mm, smooth edge, deep yellow (4A8) to orange yellow (4B8), releasing a yellow pigment in KOH on the slide; stipe 60–150 × 10–20 mm, clavate to subbulbous (20–40 mm broad at the base), yellowish orange (4B7), orange (6B7) to reddish orange (7B7) or brownish orange (7C8), solid, annulate, smooth at the apex, fibrillose to fibrillose-adpressed under the annulus, longitudinally striate; partial veil well developed, leaving a subapical membranous or fibrillar annulus in young specimens and fading in mature specimens, deep yellow (4A8) to yellowish orange (4B7); context up to 15 mm thick, fleshy, vivid yellow (3A8) to yellowish orange (4B7); basidiospores 7–9 × 5.5–7 µm, reddish yellow, yellowish brown to reddish brown in KOH 5%, broadly ellipsoid, subreticulate to coarsely roughened with large irregular warts and ridges (up to 1 µm high); basidia 25–29 × 7–9 µm, 4-spored, yellowish to yellowish brown in KOH 5%; sterigmas 3–6 µm height; pleurocystidia 25–35 × 7–9 µm, ventricose, reddish brown in KOH 5%, slightly thick walled; cheilocystidia 37–44 × 5–7 µm, capitate, yellow to yellowish brown in KOH 5%; hymenophoral trama subparallel, with hyaline, yellow to yellowish brown hyphae, 4–15 µm, clamp connections present; pileipellis a cutis with postrate hyphae, yellow to reddish brown in KOH 5%, 5–12 µm diameter, clamp connections present, squamules with prostrate to suberect hyphae, reddish brown in KOH; pileocystidia and caulocystidia not observed.
Habitat: Gregarious to caespitose in TMCF soil.
Taxonomical notes: Gymnopilus guzmanii is characterized by its large annulate basidiomes growing in caespitose clusters on the soil of the tropical montane cloud forest, with fibrillose-squamulose, yellowish orange to orange-red pileus, margin appendiculate, eroded and recurved. Microscopically, basidiospores differ with subreticulate to coarsely roughened ornamentation with irregular large warts and ridges. Morphological and molecular characters locate the species in the G. junonius (Fr.) P.D. Orton group [68]. Phylogenetically, G. guzmanii is well-supported based on ITS sequence data. It is close to G. subspectabilis Hesler and G. ventricosus (Earle) Hesler. The first species grows on hardwoods, while the second grows on the wood of conifers. Other characteristics that separate these species are the shape and ornamentation of spores in G. subspectabilis, ellipsoidal to amygdaliform, with acutely conical apices and conspicuous suprahylar depressions, moderately roughened with irregular warts and short ridges. In G. ventricosus, the spores are amygdaloid, with conical apices, finely to coarsely roughened with irregular warts and ridges.
Boletales, Serpulaceae
Serpula cyatheicola Raymundo, de la Fuente, García-Jiménez, Martínez-González, and R. Valenz. sp. nov.
MycoBank: MB842039
Figures: Figure 5 and Figure 6
Diagnosis: Serpula cyatheicola is characterized by the ellipsoid basidiospores of 7.5–8 × 4.5–5 µm, clavate basidia up to 50 µm long, growing over Cyathea mexicana Schltdl. and Cham.
Type: MÉXICO: Hidalgo state, Tlanchinol municipality, El Temazate, 21°01′40″ N, 98°38′33″ W, 1500 m, 24 July 2009, T. Raymundo 2891 (ENCB Holotype). Figure 4.
GenBank: ITS: OW764589.
Etymology: The epithet cyatheicola was given because it grows on Cyathea mexicana.
Basidiomata annual, 50–100 × 30–70 × 10–12 mm, resupinate, dimidiate to effuse-reflexed, pileate to sessile, cartilaginous to spongy, cadmium (4A8), chromo (5A8), with white margin (4A1); pileus semicircular, with thick sterile margin; context spongy, white; hymenophore merulioid with folds of 400–420 µm thick, in fresh deep-yellow (4B8), rust-brown (6E8) when dry; hyphal system monomitic, with generative hyphae of 3–4 µm diameter, with clamp-connections; hymenophoral trama parallel, 800–1000 µm diameter, composed of hyaline interwoven hyphae; subhymenium 40–46 µm diameter; hymenium 80–88 µm diameter, with clavate basidia of 46–50 × 9–10 µm, hyaline, with short sterigmata of 3–4 µm, thin-walled; basidiospores 7.5–8 × 4.5–5 µm, ellipsoid, brown in KOH, some guttulate, smooth, thin-walled.
Habitat: growing on Cyathea mexicana in the TMCF.
Additional specimens examined: MÉXICO: Hidalgo state, Tlanchinol municipality, Lontla, growing on Cyathea mexicana, 21°01′40″ N, 98°38′34″ W, 24 July 2009, T. Raymundo 3784 (ENCB); 27 June 2009, J. García-Jiménez 17975 (ITCV); 28 July 2014, J. García-Jiménez 19866 (ITCV).
Taxonomical notes: The order Boletales is a group of fungi within the Agaricomycetes typically characterized by the putrescent boletoid fruit body with poroid hymenia [50]. Nowadays, the order Boletales groups boletoid lineages and lamellate, sequestrate, and resupinate species [51,69]. Most of the typical boletoid species form ectomycorrhizal associations with Pinaceae, Fagaceae, Betulaceae, Dipterocarpaceae, and Polygonaceae [40], but some are saprobic and parasitic. The molecular evidence shows that the basal clades in the Boletales, such as the Coniophoraceae, Tapinellaceae, and Serpulaceae families, are composed of resupinate species [70,71,72]. The species of Serpula (Pers.) Gray are characterized by resupinate to rarely pileate fruit bodies with poroid or merulioid hymenia [58,73,74]. Microscopically, the genus is characterized by a monomitic hyphal system, ellipsoid to ovoid, and smooth, thick-walled, brownish basidiospores [58,73]. The mycorrhizal genus Austropaxillus Bresinsky and Jarosch and the sequestrate Gymnopaxillus E. Horak form the Serpulaceae family [58]. The species of this genus are distributed worldwide; about 17 species are known, but some species complexes may exist [58,59,75]. Furthermore, some species cause structural damage to wooden houses [59,60,75,76]. Serpula cyatheicola is characterized mainly by the ellipsoid basidiospores of 7.5–8 × 4.5–5 µm, clavate basidia up to 50 µm long, and living on Cyathea. It differs from S. lacrymans (Wulfen) J.Schröt. by the smaller basidia (up to 37 µm long), absence of rhizomorphs, and longer basidiospores (7–12 × 4–8 µm) [59,75]; this species was recorded previously from Mexico [61,77]. Serpula dendrocalami C.L. Zhao also have large pileus and merulioid pores but differ in the smaller basidiospore size (4.5–5.5 × 3.5–4 µm) and the habit on the roots of Dendrocalamus [58]. The basidiospore size of the new species resembles those from Leucogyrophana hexagonoides (Burt) Domański (=S. hexagonoides (Burt) W.B. Cooke) and S. similis (Berk. and Broome) Ginns. Nevertheless, the latter species grows on Sequoia sp. on sandy soils [73,78]. The length of the basidiospores of Hydnomerulius pinastri (Fr.) Jarosch and Besl (=S. pinastri (Fr.) W.B. Cooke) are similar to those from S. cyatheicola. However, the latter species grows on Pinus, Abies, and Quercus and has smaller basidia (18–20 × 4–5 µm) [73].
Polyporales, Sparassidaceae
Sparassis isis Raymundo and R. Valenz. sp. nov.
MycoBank: MB842052
Figures: Figure 7 and Figure 8
Diagnosis: This species is different from other species by its long basidiomata (up to 400 mm diameter and 200 mm high), composed of one to four layers of loosely arranged very broad flabellae with very wavy, zonate, darkening with age margins, cystidia absent, but cystidioles present, and basidiospores 5–7 × 4–6 μm, globose to subglobose.
Type: MÉXICO: Hidalgo state, Tlanchinol municipality, El Temazate, 15 May 2008, 21°01′40″ N, 98°38′34″ W, Isis Musito-Sánchez s.n. (Holotype: ENCB). Figure 4.
GenBank: ITS: OW769404; LSU: OW769865; rpb2: OW769853; atp6: OW769812.
Etymology: This species is dedicated to Isis Musito Sánchez (in memoriam), who collected the specimen type.
Basidiomata (100-) 200–400 mm diameter, 100–200 mm high, annual, solitary, composed of one to four layers of loosely arranged flabellae arising from a poorly developed central core; flabellae (70-) 100–250 mm broad, mostly mainly extend from a common central mass, contorted, semicircular to flaveliform, upper surface glabrous, light brown (6D5), cinnamon brown (6D6) to grayish brown (6D3), towards the margin grayish orange (6B5) to brownish orange (6C5), becoming brownish gray (6D3) to grayish brown (6E4) with age or when dry; top margin entire, waxy, wavy, zonate, darkening with age, becoming brown, dark brown to black; hymenial surface pale yellow (4A3), light yellow (4A4) to grayish orange (6B5) or brownish orange (6C5); basidiospores 5–7 × 4–6 μm, globose to subglobose, hyaline, thin-walled, smooth, non-amyloid; basidia 20–30 × 5–6 μm, clavate, 4-spored, hyaline, usually with a basal clamp connection, sterigmata 4–7 μm long; cystidia absent, cystidioles 15–20 × 5–7 μm, sublageniform to clavate, hyaline; subhymenium composed of tightly packed, thin-walled, hyaline, ramose-inflated hyphal elements; trama of flabellae forming a monomitic hyphal system, composed of loosely interwoven hyphae embedded in a gelatinous or mucilaginous matrix, hyaline, inamyloid, thin to thick-walled, 4–6 μm diameter, commonly clamped; hyphae gloeoplerous scattered throughout, refractive, flexuous, aseptate, thin-walled, 6–12 μm diameter, most abundant towards the base of the basidiomata.
Habitat: This species grows at the base of living Quercus trees, attached to underground roots in the TMCF.
Additional specimens examined: Paratypes. MÉXICO: Hidalgo state, municipality of Tlanchinol, El Temazate, 7 June 2009, 21°01′40″ N, 98°38′34″ W, R. Valenzuela 13895 (ENCB); 22 August 2011, T. Raymundo 3785 (ENCB).
Taxonomical notes: Sparassis isis is characterized by its basidiomata composed of a few layers of loosely arranged flabellae, very wavy and darkening margins, trama of flabellae composed of hyphae embedded in a gelatinous or mucilaginous matrix, cystidioles present, and for its size and shape of basidiospores. This species is separated from other Sparassis by morphological, ecological, and molecular characters and phylogenetically is well supported based on ITS, LSU, rpb2, and atp6 sequences [63,64,65,79,80,81]. Sparassis isis belongs to the North American clade with S. americana R. H. Petersen, S. radicata Weir, and an unidentified species. S. americana differs by its upper basidiome coarsely and irregularly branched to produce expanded petaloid crisped flabellae, top margins drying cartilaginous when fresh appearing waxy, retaining this appearance when dried; basidiospores 4.5–6 (7.0) × (3.0) 3.5–4.0 (4.5) μm, broadly ellipsoid and flattened axially and associated with Pinus sp., perhaps as root parasite [59,66]. S. radicata is separated by its subterranean pseudosclerotial stipe, an above-ground fertile structure composed of complex, often anastomosed lacunose branches, with ultimate flabellae thin, parchment-like in well-dried specimens, curled or crisped, basidiospores 5–6.5 × 3.5–4 (5) μm, broadly ellipsoid to ellipsoid and flattened axially. It is associated with the roots of conifers in North American temperate forests [59].
Russulales, Bondarzewiaceae
Bondarzewia mesofila R. Valenz., Baut.-Hern., and Raymundo sp. nov.
MycoBank: 842,140
Figures: Figure 9 and Figure 10
Diagnosis: It differs from other Bondarzewia species in having pileus in several tones, e.g., orange, yellow ochre, brownish yellow, light brown, yellowish brown or rust brown, tomentose to hirsute and towards the margin tomentose adpressed, margin white, yellow to orange, most extended basidiospore ridges, up to 2 μm; basidiomata grows on the soil.
Type: MÉXICO, Hidalgo state, Tlanchinol municipality, El Temazate, 6 June 2009, 21°01′40″ N, 98°38′34″ W, R. Valenzuela 13824 (Holotype: ENCB). Figure 4.
GenBank: ITS: OW768521; LSU: OW768975; SSU: OW768127; tef1: OW769940
Etymology: The epithet of the species refers to the vegetation type where it grows (“bosque mesófilo de montaña”).
Basidiomata 200–350 mm wide, 200–250 mm high, annual, pileate stipitate, imbricate or slightly imbricate in some specimens, fleshy when fresh, becoming corky to hard in dry specimes, odor pleasant and taste similar to walnut or almonds; pileus (100-) 150–250 mm long, 100–200 mm wide and up to 15 mm thick, semicircular to flabelliform, several tones of orange (5AB8), yellow-ochre (5C7), brownish yellow (5C8), light brown (5D8), yellowish brown (5EF8), rust brown (6E8), azonate to obscurely zonate in the middle, zonate to the margin, glabrous to velvety in young specimens or in the center of mature specimens, tomentose to hirsute in the middle, and towards the margin tomentose adpressed; margin obtuse, sterile, velvety, white (4A1), yellow (4A6) to orange (5AB8); hymenophore poroid, white (4A1) to cream (4A3) in young specimens, becoming light yellow (4A5), stained with yellowish brown (5D8) when mature, pores 1–2 per mm, angular to elongate (up to 2 mm long) or irregular in shape, tubes shallow to the margin, up to 2 mm deep, concolorous with the pores, dissepiments thin, entire to lacerate; stipe up to 80 mm and 40 mm wide, white (4A1) to yellow (4A6) when young specimens, yellow ochre (5C7), light brown (5D8) to yellowish brown (5EF8) in mature specimens, rust brown (6E8), velvety; context up to 12 mm thick, white (4A1) to yellow ochre (5C7), fleshy in fresh, corky when dry; hyphal system monomitic in trama, dimitic in context; generative hyphae simple septate, thin-walled, skeletal hyphae unbranched, thick walled,, not septated, 5–7 μm diameter; contextual generative hyphae hyaline, thin-walled, simple septate, moderately branched, 5–7 μm diameter; contextual skeletal hyphae hyaline, thick-walled, interwoven, 6–7 μm diameter; trama generative hyphae interwoven, hyaline, thin-walled, simple septate, branched, 2–5 μm diameter; cystidia absent; basidia 17–20 × 7–9 μm, clavate, hyaline, with a simple basal septum, 4-spored; basidiospores 5.5–7 × (4) 4.5–6 μm, subglobose, rarely ellipsoid, hyaline, amyloid, thick-walled, with obvious ridges, ridges of spores blunt, up to 1 μm high and up to 2 μm long.
Habitat: Bondarzewia mesofila grows solitary on TMCF soil.
Additional specimens examined: MÉXICO: Hidalgo state, Tlanchinol municipality, El Temazate, 21°01′40″ N, 98°38′34″ W, 6 June 2009, T. Raymundo 2263 (Paratype: ENCB).
Taxonomical notes: This species is characterized by the color of basidiomata with several tones in the pileus (orange, yellow ochre, brownish yellow, light brown, yellowish brown, rust brown), margin (white, yellow to orange), and stipe (white, yellow, yellow ochre, light brown to yellowish brown), the texture of pileus (velvety, tomentose, hirsute and tomentose adpressed) and basidiospores ornamentation with ridges blunt, up to 1 μm high and up to 2 μm long. Bondarzewia mesofila can be separated by morphological, ecological, and molecular characteristics [67,82]. Phylogenetically is well supported based on ITS, LSU, SSU, and tef1 sequences. This species is close to B. berkeleyi (Fr.) Bondartsev and Singer, B. dickinsii (Berk.) Jia J. Chen, B.K. Cui, and Y.C. Dai, and to B. occidentalis Jia J. Chen, B.K. Cui, and Y.C. Dai, all of them belonging to a sister clade. Bondarzewia berkeleyi is separated by growing on the wood of several species of Fagaceae, basidiomata developing underground sclerotia, and larger basidiospores 7–9 × 6–8 μm [82,83]. Basidiomata of Bondarzewia dickinsii grow on fallen trunks of Quercus and roots of Castanea; the pileus color is white to brownish, basidiospores with sharp ridges, up to 2 μm long [82]. Bondarzewia occidentalis grows on gymnosperm wood, with a pileus surface characteristically from yellowish brown to orange-brown, concentrically zonate and glabrous, basidiospores with ridges up to 1 μm long [83].

4. Conclusions

Based on this study and other research performed by us and other colleagues, the Mexican TMCF is the most diverse ecosystem for fungi. Databases from different organisms, e.g., plants [84] and birds [85], are available for this ecosystem but not for fungi. Unfortunately, there are no extensive studies of fungi because of the lack of specialists, so their representation in the herbaria is poor. So far, 1407 species of Macromycetes have been registered for Mexico, of which 220 species have been found in this ecosystem. In addition, this study described four new species found in this ecosystem. Similar worldwide studies at the same latitude, e.g., in Yunnan, China [86,87], an area also considered as a biodiversity hotspot [88], recently recorded 314 macrofungi. Based on this, the Mexican TMCF could harbor more than 100 fungi species than those registered in this study.
The characterization of fungal diversity in TMCF is relevant for forest conservation. Fungi provide different environmental services and are sources of bioactive secondary metabolites [35]. Altogether, 1106 species of Agaricomycetes are registered from the TMCF [35]. This study contributes with four new species.
Mexico represents one of the world’s most diverse areas for fungi diversity, so it is essential to record and describe the fungal species of this type of vegetation. TMCFs are the most threatened terrestrial ecosystems at the national level and are classified as “habitat in danger of extinction”. In addition, a meta-analysis recently revealed that Mexico is a hotspot for oak species and their ectomycorrhizal mycobionts [89]. These last authors considered the Mexican oak forest essential for maintaining biodiversity due to its high richness and endemism of fungi, mainly those associated with Fagaceae.
The loss of the TMCF is due to its transformation into grazing land for livestock and agriculture, mainly for avocado and citric. The fungal wealth is strongly affected by the loss of this ecosystem. The effects of global warming have not yet been evaluated in the case of fungi.

Author Contributions

R.V., S.A.-C., T.R. and J.G.-J. conceived and designed the study. The specimens were collected by R.V. and T.R. Photographs were taken by R.V., T.R., S.B.-H. and C.R.M-G extracted and sequenced the DNA of the species involved. I.L.-V and S.A.-C redacted the description and ecological analysis of the TMCF. C.R.M.-G., J.d.l.F., M.M.-P., J.G.-J., T.R., S.A.-C, I.L.-V and R.V. made the phylogenetic analysis of the species described. All authors redacted the final version of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financed by Instituto Politécnico Nacional (SIP-20230017; SIP-20230642) and CONACYT Project 2015-01-2007. J.G.-J. and J.d.l.F. acknowledge the Tecnológico Nacional de México-Instituto Tecnológico de Ciudad Victoria and CONACYT for partial financial support.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare that there are no conflict of interest.

References

  1. Rzedowski, J. Análisis preliminar de la flora vascular de los bosques mesófilos de montaña de México. Acta Bot. Mex. 1996, 35, 25–40. [Google Scholar] [CrossRef] [Green Version]
  2. Blanco-Macías, A. Análisis Sucesional Del Bosque Mesófilo De Montaña En El Rincón, Sierra Norte De Oaxaca. Bachelor Dissertation, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de México, Los Reyes, Iztacala, Mexico City, Mexico, 2001. [Google Scholar]
  3. Jardel, E.; Santiago, A.L.; Muñoz, M. El bosque mesófilo de montaña de la Sierra de Manantlán. Tiempos Cienc. 1993, 30, 20–28. [Google Scholar]
  4. Puig, H. Árboles y Arbustos del Bosque Mesófilo de Montaña de la Reserva: el Cielo de Tamaulipas; Instituto de Ecología & Centre National de la Recherche Scientifique: Xalapa, Mexico, 1993; pp. 1–85. [Google Scholar]
  5. Rzedowski, J. La Vegetación de México; Limusa: Mexico City, Mexico, 1978; pp. 1–432. [Google Scholar]
  6. Luna-Vega, I.; Almeida, L.; Villers, L.; Lorenzo, L. Reconocimiento florístico y consideraciones fitogeográficas del bosque mesófilo de montaña de Teocelo, Ver. Bol. Soc. Bot. Mex. 1988, 48, 35–63. [Google Scholar]
  7. Webster, G.L. The panorama of Neotropical cloud forests. In Biodiversity and Conservation of Neotropical Montane Forests, 2nd ed.; Churchill, S.P., Balslev, H., Forero, E., Luteyn, J.L., Eds.; The New York Botanical Garden: New York, NY, USA, 1995; pp. 53–77. [Google Scholar]
  8. Bruijnzeel, L.A.; Veneklaas, E.J. Climatic conditions and tropical montane forest productivity: The fog has not lifted yet. Ecology 1998, 79, 3–9. [Google Scholar] [CrossRef]
  9. Bruijnzeel, L.A.; Proctor, J. Hydrology and biogeochemistry of tropical montane cloud forest: What do we really know? In Tropical Montane Forests, 2nd ed.; Hamilton, L.S., Juvick, J.O., Scatena, F.N., Eds.; Springer: New York, NY, USA, 1995; pp. 38–78. [Google Scholar]
  10. Boyle, B.L. Changes on Altitudinal and Latitudinal Gradients in Neotropical Montane Forests; Washington University: St. Louis, MO, USA, 1996. [Google Scholar]
  11. INEGI Carta de uso Actual del Suelo y Vegetación Serie VII; Instituto Nacional de Geografía, Estadística e Informática: Aguascalientes City, Mexico, 2022.
  12. Williams-Linera, G. Ecología del paisaje y el bosque mesófilo en el centro de Veracruz. Cienc. Y Desarro. 1992, 105, 133–138. [Google Scholar]
  13. Ortega-Escalona, F.; Castillo-Campos, G. El bosque mesófilo de montaña y su importancia forestal. Ciencias 1996, 43, 32–39. [Google Scholar]
  14. Challenger, A. Utilización y Conservación de Los Ecosistemas Terrestres de México. Pasado, Presente y Futuro; Conabio-Instituto de Biología, Universidad Nacional Autónoma de México-Agrupación Sierra Madre: Mexico City, Mexico, 1998; pp. 443–518. [Google Scholar]
  15. Bautista, C.A.; del Castillo, R.F. Soils changes during secondary succession in a tropical montane cloud forest area. Soils Sci. Soc. Am. J. 2005, 69, 906–914. [Google Scholar] [CrossRef]
  16. Miranda, F. Estudios sobre la vegetación de México, V. Rasgos de la vegetación en la cuenca del Río de las Balsas. Rev. Soc. Mex. Hist. Nat. 1947, 8, 95–114. [Google Scholar]
  17. Miranda, F.; Sharp, A.J. Characteristics of the vegetation in certain temperate regions of eastern Mexico. Ecology 1950, 31, 313–333. [Google Scholar] [CrossRef]
  18. Rzedowski, J. Nota sobre el bosque mesófilo de montaña en el Valle de México. An. Inst Biol Ser Bot 1970, 18, 91–106. [Google Scholar]
  19. Rzedowski, J.; Palacios-Chávez, R. El bosque de Engelhardtia (Oreomunnea) mexicana en la región de la Chinantla (Oaxaca, México) una reliquia del Cenozoico. Bot. Sci. 1977, 36, 93–127. [Google Scholar] [CrossRef] [Green Version]
  20. Puig, H. La Végétation De La Huasteca (Mexique); Mission Archéologique et Ethnologique Française au Mexique: Mexico City, Mexico, 1976; pp. 1–531. [Google Scholar]
  21. Puig, H. Análisis fitogeográfico del bosque mesófilo de Gómez Farías. Biotam 1989, 1, 34–53. [Google Scholar]
  22. Puig, H.; Bracho, R.; Sosa, V.J. El bosque mesófilo de montaña: Composición florística y estructura. In El Bosque Mesófilo de Montaña en Tamaulipas; Puig, H., Bracho, R., Eds.; Instituto de Ecología: Mexico City, Mexico, 1987; pp. 55–79. ISBN 9687213078. [Google Scholar]
  23. Luna-Vega, I.; Almeida-Leñero, L.; Llorente-Busquets, J. Florística y aspectos fitogeográficos del bosque mesófilo de montaña de las cañadas de Ocuilan, estados de Morelos y México. An. Inst. Biol. Ser. Bot. 1989, 59, 63–87. [Google Scholar]
  24. Luna-Vega, I.; Ocegueda, S.; Alcántara, O. Florística y notas biogeográficas del bosque mesófilo de montaña del municipio de Tlanchinol, Hidalgo, México. An. Inst. Biol. Ser. Bot. 1994, 65, 31–62. [Google Scholar]
  25. Meave, J.; Soto, M.A.; Calvo, L.M.; Paz, H.; Valencia, S. Análisis sinecológico del bosque mesófilo de montaña de Omiltemi, Guerrero. Bol. Soc. Bot. Mex. 1992, 52, 31–77. [Google Scholar]
  26. Acosta, S. Afinidades fitogeográficas del bosque mesófilo de montaña de la zona de Pluma Hidalgo, Oaxaca, México. Polibotánica 1997, 6, 25–39. [Google Scholar]
  27. Acosta, S. Afinidades de la flora genérica de algunos bosques mesófilos de montaña del nordeste, centro y sur de México: Un enfoque fenético. An. Inst. Biol. Ser. Bot. 2004, 75, 61–72. [Google Scholar]
  28. Ramírez-Marcial, N. Diversidad florística del bosque mesófilo en el norte de Chiapas y su relación con México y Centroamérica. Bol. Soc. Bot. Mex. 2001, 69, 63–76. [Google Scholar] [CrossRef]
  29. Hawksworth, D.L.; Lücking, R. Fungal diversity revisited: 2.2 to 3.8 million species. Microbiol. Spectr. 2017, 5, FUNK-0052-2016. [Google Scholar] [CrossRef]
  30. Mueller, G.; Schmit, J.; Leacock, P.; Buyck, B.; Cifuentes, J.; Desjardin, D.; Halling, R.; Hjortstam, K.; Iturriaga, T.; Larsson, K.H.; et al. Global diversity and distribution of macrofungi. Biodivers. Conserv. 2007, 16, 37–48. [Google Scholar] [CrossRef] [Green Version]
  31. Stadler, M.; Læssøe, T.; Fournier, J.; Decock, C.; Schmieschek, B.; Tichy, H.V.; Peršoh, D. A polyphasic taxonomy of Daldinia (Xylariaceae). Stud. Mycol. 2014, 77, 1–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Guzmán, G. Diversity and use of traditional Mexican medicinal fungi. A Review. Int. J. Med. Mushrooms 2008, 10, 209–217. [Google Scholar] [CrossRef]
  33. Aguirre-Acosta, E.; Ulloa, M.; Aguilar, S.; Cifuentes, J.; Valenzuela, R. Biodiversidad de hongos en México. Rev. Mex. Biod. 2014, 85, 76–81. [Google Scholar] [CrossRef] [Green Version]
  34. Cifuentes, J. Hongos. Catálogo taxonómico de especies de México. In Capital Natural de México, Conocimiento Actual de la Biodiversidad. Vol. 1; CONABIO: Mexico City, Mexico, 2008. [Google Scholar]
  35. Del Olmo-Ruiz, M.; García-Sandoval, R.; Alcántara-Ayala, O.; Véliz, M.; Luna-Vega, I. Current knowledge of fungi from Neotropical montane cloud forests: Distributional patterns and composition. Biodivers. Conserv. 2017, 26, 1919–1942. [Google Scholar] [CrossRef]
  36. Miller, S.L.; Larsson, E.; Larsson, K.H.; Verbeken, A.; Nuytinck, J. Perspectives in the new Russulales. Mycologia 2006, 98, 960–970. [Google Scholar] [CrossRef]
  37. He, M.-Q.; Zhao, R.-L.; Hyde, K.D.; Begerow, D.; Kemler, M.; Yurkov, A.; McKenzie, E.H.C.; Raspé, O.; Kakishima, M.; Sánchez-Ramírez, S.; et al. Notes, outline and divergence times of Basidiomycota. Fungal Divers. 2019, 99, 105–367. [Google Scholar] [CrossRef] [Green Version]
  38. Matheny, P.B.; Curtis, J.M.; Hofstetter, V.M.; Catherine Aime, M.C.; Moncalvo, J.M.; Ge, Z.W.; Yang, Z.L.; Slot, J.C.; Ammirati, J.F.; Baroni, T.B.; et al. Major clades of Agaricales: A multilocus phylogenetic overview. Mycologia 2006, 98, 982–995. [Google Scholar] [CrossRef]
  39. Binder, M.; Justo, A.; Riley, R.; Salamov, A.; Lopez-Giraldez, F.; Sj€okvist, E.; Copeland, A.; Foster, B.; Sun, H.; Larsson, E.; et al. Phylogenetic and phylogenomic overview of the Polyporales. Mycologia 2013, 105, 1350–1373. [Google Scholar] [CrossRef] [Green Version]
  40. Binder, M.; Hibbett, D.S. Molecular systematics and biological diversification of Boletales. Mycologia 2006, 98, 971–981. [Google Scholar] [CrossRef]
  41. Justo, A.; Miettinen, O.; Floudas, D.; Ortiz-Santana, B.; Sjökvist, E.; Lindner, D.; Nakasone, K.; Niemelä, T.; Larsson, K.H.; Ryvarden, L.; et al. A revised family-level classification of the Polyporales (Basidiomycota). Fungal Biol. 2017, 121, 798–824. [Google Scholar] [CrossRef]
  42. Kornerup, A.; Wanscher, J.H. Methuen Handbook of Colour, 3rd ed.; Eyre: London, UK, 1978; pp. 1–252. [Google Scholar]
  43. Bessette, A.E.; Roody, W.C.; Bessette, A.R. North American Boletes: A Color Guide to the Fleshy Pored Mushrooms, 1st ed.; Syracuse University Press: Syracuse, NY, USA, 2000; pp. 1–396. [Google Scholar]
  44. Ulloa, M.; Hanlin, R.T. Illustrated Dictionary of Mycology, 2nd ed.; APS Press: St. Paul, MN, USA, 2012; pp. 1–762. [Google Scholar]
  45. Martínez-González, C.R.; Ramírez-Mendoza, R.; Jiménez-Ramírez, J.; Gallegos-Vázquez, C.; Luna-Vega, I. Improved method for genomic DNA extraction for Opuntia Mill. (Cactaceae). Plant Methods 2017, 13, 82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  47. Zhang, Z.; Schwartz, S.; Wagner, L.; Miller, W. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 2000, 7, 203–214. [Google Scholar] [CrossRef] [PubMed]
  48. White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 135–322. [Google Scholar] [CrossRef]
  49. Matheny, P.B.; Wang, Z.; Binder, M. Contributions of rpb2 and tef1 to the phylogeny of mushrooms and allies (Basidiomycota, Fungi). Mol. Phylogenetics Evol. 2007, 43, 430–451. [Google Scholar] [CrossRef]
  50. Wu, G.; Feng, B.; Xu, J.; Zhu, X.T.; Li, Y.C.; Zeng, N.K.; Hosen, M.I.; Yang, Z.L. Molecular phylogenetic analyses redefine seven major clades and reveal 25 new generic lineages in the fungal family Boletaceae. Fungal Divers. 2014, 69, 93–115. [Google Scholar] [CrossRef]
  51. Giachini, A.J.; Hosaka, K.; Nouhra, E.; Spatafora, J.; Trappe, J.M. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences. Fungal Biol. 2010, 114, 224–234. [Google Scholar] [CrossRef]
  52. Khan, J.; Kiran, M.; Jabeen, S.; Sher, H.; Khalid, A.N. Gymnopilus penetrans and G. swaticus sp. nov. (Agaricomycota: Hymenogastraceae); a new record and a new species from northwest Pakistan. Phytotaxa 2017, 312, 60–70. [Google Scholar] [CrossRef] [Green Version]
  53. Acharya, K.; Paloi, S.; Dutta, A.K.; Sikder, R.; Saha, T. Gymnopilus purpureosquamulosus Høil. (Agaricales, Basidiomycota): A new distributional record from India. Check List 2017, 13, 2064. [Google Scholar] [CrossRef] [Green Version]
  54. Katoh, K.; Misawa, K.; Kuma, K.I.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignments based on fast Fourier transform. Nucleic. Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [Green Version]
  55. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2017, 20, 1160–1166. [Google Scholar] [CrossRef] [Green Version]
  56. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
  57. Müller, K. SeqState. Appl. Bioinforma. 2005, 4, 65–69. [Google Scholar] [CrossRef] [PubMed]
  58. Wang, X.H.; Das, K.; Bera, I.; Chen, Y.H.; Bhatt, R.P.; Ghosh, A.; Hembrom, M.E.; Hofstetter, V.; Parihar, A.; Vizzini, A.; et al. Fungal Biodiversity Profiles 81-90. Cryptogam. Mycol. 2019, 40, 57–95. [Google Scholar] [CrossRef]
  59. Hughes, K.H.; Reboredo-Segovia, A.; Petersen, R.H. Transatlantic disjunction in fleshy fungi. I. The Sparassis crispa complex. Mycol. Prog. 2014, 13, 407–427. [Google Scholar] [CrossRef]
  60. Maddison, W.P.; Maddison, D.R. Mesquite: A Modular System for Evolutionary Analysis, Version 3.70. 2021. Available online: http://mesquiteproject.org (accessed on 19 October 2022).
  61. Song, J.; Chen, J.-J.; Wang, M.; Chen, Y.-Y.; Cui, B.-K. Phylogeny and biogeography of the remarkable genus Bondarzewia (Basidiomycota, Russulales). Sci. Rep. 2016, 6, 34568. [Google Scholar] [CrossRef] [Green Version]
  62. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Frandsen, P.B.; Calcott, B.; Mayer, C.; Lanfear, R. Automatic selection of partitioning schemes for phylogenetic analyses using iterative k-means clustering of site rates. BMC Evol. Biol. 2015, 15, 13. [Google Scholar] [CrossRef] [Green Version]
  64. Lanfear, R.; Calcott, B.; Kainer, D.; Mayer, C.; Stamatakis, A. Selecting optimal partitioning schemes for phylogenomic datasets. BMC Evol. Biol. 2014, 14, 82. [Google Scholar] [CrossRef] [Green Version]
  65. Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. Partition Finder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 2017, 34, 772–773. [Google Scholar] [CrossRef] [Green Version]
  66. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [Green Version]
  67. Rambaut, A.; Suchard, M.A.; Xie, D.; Drummond, A.J. Tracer v1.6, 2014. Available online: http://beast.bio.ed.ac.uk/Tracer(accessed on 31 July 2022).
  68. Thorn, R.G.; Malloch, D.W.; Saar, I.; Lamoureux, Y.; Nagasawa, E.; Redhead, S.A.; Margaritescu, S.; Moncalvo, J.-M. New species in the Gymnopilus junonius group (Basidiomycota: Agaricales). Botany 2020, 98, 293–315. [Google Scholar] [CrossRef]
  69. Singer, R. The Agaricales in Modern Taxonomy, 4th ed.; Koeltz Scientific Books: Koenigstein, Germany, 1986; pp. 1–981. [Google Scholar]
  70. Binder, M.; Larsson, K.H.; Matheny, P.B.; Hibbett, D.S. Amylocorticiales ord. nov. and Jaapiales ord. nov.: Early diverging clades of Agaricomycetidae dominated by corticioid forms. Mycologia 2010, 102, 865–880. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  71. Larsson, K.H. Re-thinking the classification of corticioid fungi. Mycol. Res. 2007, 111, 1040–1063. [Google Scholar] [CrossRef] [PubMed]
  72. Zhao, R.L.; Li, G.J.; Sánchez-Ramírez, S.; Stata, M.; Yang, Z.L.; Wu, G.; Dai, Y.C.; He, S.H.; Cui, B.K.; Zhou, J.L.; et al. A six-gene phylogenetic overview of Basidiomycota and allied phyla with estimated divergence times of higher taxa and a phyloproteomics perspective. Fungal Divers. 2017, 84, 43–74. [Google Scholar] [CrossRef]
  73. Coker, B. The genera Serpula and Meruliporia. Mycologia 1957, 49, 197–225. [Google Scholar] [CrossRef]
  74. Skrede, I.; Engh, I.B.; Binder, M.; Carlsen, T.; Kauserud, H.; Bendiksby, M. Evolutionary history of Serpulaceae (Basidiomycota): Molecular phylogeny, historical biogeography and evidence for a single transition of nutritional mode. J. Evol. Biol. 2011, 11, 230. [Google Scholar] [CrossRef] [Green Version]
  75. Carslen, T.; Engh, I.B.; Decock, C.; Rajchenberg, M.; Kauserud, H. Multiple cryptic species with divergent substrate affinities in the Serpula himantioides species complex. Fungal Biol. 2010, 115, 54–61. [Google Scholar] [CrossRef]
  76. Kauserud, H.; Svegården, I.B.; Sætre, G.P.; Knudsen, H.; Stensrud, Ø.; Schmidt, S.; Doi, S.; Sugiyama, T.; Högberg, N. Asian origin and rapid global spread of the destructive dry rot fungus Serpula lacrymans. Mol. Ecol. 2007, 16, 3350–3360. [Google Scholar] [CrossRef]
  77. Tapia, F.; Chacón, S.; Pérez-Gorjón, S. Hongos corticioides (Agaricomycetes) citados de México. Acta Bot. Mex. 2016, 114, 15–50. [Google Scholar] [CrossRef] [Green Version]
  78. Ginns, J.H. The genus Merulius IV. Species proposed by Berkeley, by Berkeley and Curtis, and by Berkeley and Broome. Mycologia 1971, 63, 219–236. [Google Scholar] [CrossRef]
  79. Desjardin, D.E.; Wang, Z.; Binder, M.; Hibbett, D.S. Sparassis cystidiosa sp. nov. from Thailand is described using morphological and molecular data. Mycologia 2004, 96, 1010–1014. [Google Scholar] [CrossRef]
  80. Blanco-Dios, J.B.; Wang, Z.; Binder, M.; Hibbett, D. A new Sparassis species from Spain described using morphological and molecular data. Mycol. Res. 2006, 110, 1227–1231. [Google Scholar] [CrossRef] [PubMed]
  81. Zhao, Q.; Feng, B.; Yang, Z.L.; Dai, Y.C.; Wang, Z.; Tolgor, B. New species and distinctive geographical divergences of the genus Sparassis (Basidiomycota): Evidence from morphological and molecular data. Mycol. Prog. 2013, 12, 445–454. [Google Scholar] [CrossRef]
  82. Chen, J.J.; Cui, B.K.; He, S.H.; Cooper, J.A.; Barrett, M.D.; Chen, J.L.; Song, J.; Dai, J.C. Molecular phylogeny and global diversity of remarkable genus Bondarzewia (Basidiomycota, Russulales). Mycologia 2016, 108, 697–708. [Google Scholar] [CrossRef] [PubMed]
  83. Das, K.; Parihar, A.; Hembrom, M.E. A new species of Bondarzewia from India. Turk. J. Bot. 2015, 39, 128–133. [Google Scholar] [CrossRef]
  84. Luna-Vega, I.; Velázquez, A.; Velázquez, E. México. In Bosques Nublados del Neotrópico; Kappelle, M., Brown, A.D., Eds.; IMBio: Santo Domingo de Heredia, Costa Rica, 2001; pp. 183–229. [Google Scholar]
  85. Sánchez-González, L.A.; Morrone, J.J.; Navarro-Sigüenza, A.G. Distributional patterns of the Neotropical humid montane forest avifaunas. Biol. J. Linn. Soc. 2008, 94, 175–194. [Google Scholar] [CrossRef] [Green Version]
  86. Dai, Y.C.; Yang, Z.L.; Cui, B.K.; Wu, G.; Yuan, H.S.; Zhou, L.W.; He, S.H.; Ge, Z.W.; Wu, F.; Wei, Y.L.; et al. Diversity and systematics of the important macrofungi in Chinese forests. Mycosystema 2021, 40, 770–805. [Google Scholar] [CrossRef]
  87. Wang, Y.R.; Dai, Y.C.; Liu, H.G.; Vlasák, J.; Buchanan, P.; Yuan, Y.; Wu, Y.D. A new contribution to Megasporoporia sensu lato: Six new species and three new combinations. Front. Microbiol. 2022, 13, 1046777. [Google Scholar] [CrossRef]
  88. Myers, N.; Mittermeier, R.A.; Mittermeier, C.G.; Da Fonseca, G.A.; Kent, J. Biodiversity hotspots for conservation priorities. Nature 2000, 403, 853–858. [Google Scholar] [CrossRef]
  89. García-Guzmán, O.M.; Garibay-Orijel, R.; Hernández, E.; Arellano-Torres, E.; Oyama, K. Word-wide meta-analysis of Quercus forests ectomycorrhizal fungal diversity reveals southwestern Mexico as a hotspot. Mycorrhiza 2017, 27, 811–822. [Google Scholar] [CrossRef]
Jof 09 00477 g001 550
Figure 1. Map of Mexico showing the geographic location of the TMCF (modified from [11]). Mexican state abbreviations are as follows: CHP, Chiapas; COL, Colima; DUR, Durango; GRO, Guerrero; HGO, Hidalgo; JAL, Jalisco; MEX, México; MIC, Michoacán; MOR, Morelos; NAY, Nayarit; NLE, Nuevo León; OAX, Oaxaca; PUE, Puebla; QRO, Querétaro; SIN, Sinaloa; SLP, San Luis Potosí; TAB, Tabasco; TAM, Tamaulipas; and VER, Veracruz.
Figure 1. Map of Mexico showing the geographic location of the TMCF (modified from [11]). Mexican state abbreviations are as follows: CHP, Chiapas; COL, Colima; DUR, Durango; GRO, Guerrero; HGO, Hidalgo; JAL, Jalisco; MEX, México; MIC, Michoacán; MOR, Morelos; NAY, Nayarit; NLE, Nuevo León; OAX, Oaxaca; PUE, Puebla; QRO, Querétaro; SIN, Sinaloa; SLP, San Luis Potosí; TAB, Tabasco; TAM, Tamaulipas; and VER, Veracruz.
Jof 09 00477 g001
Jof 09 00477 g002 550
Figure 2. Gymnopilus guzmanii. (A,B): basidiomata; (C,D): detail of annulus and hymenophore; (E,F): SEM of basidiospores.
Figure 2. Gymnopilus guzmanii. (A,B): basidiomata; (C,D): detail of annulus and hymenophore; (E,F): SEM of basidiospores.
Jof 09 00477 g002
Jof 09 00477 g003 550
Figure 3. Bayesian inference phylogram of ITS sequences data. Posterior probability (left of slash) from Bayesian analysis and bootstrap support (right of slash). The new species Gymnopilus guzmanii is shown in bold. Boldface names represent samples sequenced for this study.
Figure 3. Bayesian inference phylogram of ITS sequences data. Posterior probability (left of slash) from Bayesian analysis and bootstrap support (right of slash). The new species Gymnopilus guzmanii is shown in bold. Boldface names represent samples sequenced for this study.
Jof 09 00477 g003
Jof 09 00477 g004 550
Figure 4. Distributional map of the species. Mexican states abbreviations are as follows: HGO, Hidalgo; PUE, Puebla; QRO, Querétaro; SLP, San Luis Potosí; TLAX, Tlaxcala, and VER, Veracruz.
Figure 4. Distributional map of the species. Mexican states abbreviations are as follows: HGO, Hidalgo; PUE, Puebla; QRO, Querétaro; SLP, San Luis Potosí; TLAX, Tlaxcala, and VER, Veracruz.
Jof 09 00477 g004
Jof 09 00477 g005 550
Figure 5. Serpula cyatheicola. (A,B): basidiomata; (C): detail of hymenophore; (D): hymenium; (E): optical microscope images of basidiospores.
Figure 5. Serpula cyatheicola. (A,B): basidiomata; (C): detail of hymenophore; (D): hymenium; (E): optical microscope images of basidiospores.
Jof 09 00477 g005
Jof 09 00477 g006 550
Figure 6. Bayesian inference phylogram of ITS sequences data. Posterior probability (left of slash) from Bayesian analysis and Bootstrap support (right of slash). The new species Serpula cyatheicola is shown in bold. Boldface names represent samples sequenced for this study.
Figure 6. Bayesian inference phylogram of ITS sequences data. Posterior probability (left of slash) from Bayesian analysis and Bootstrap support (right of slash). The new species Serpula cyatheicola is shown in bold. Boldface names represent samples sequenced for this study.
Jof 09 00477 g006
Jof 09 00477 g007 550
Figure 7. Sparassis isis. (A–C): basidiomata; (D): optical microscope images of the hymeniiferous trama; (E): optical microscope images of hymenium; (F): optical microscope images of basidiospores.
Figure 7. Sparassis isis. (A–C): basidiomata; (D): optical microscope images of the hymeniiferous trama; (E): optical microscope images of hymenium; (F): optical microscope images of basidiospores.
Jof 09 00477 g007
Jof 09 00477 g008 550
Figure 8. Bayesian inference phylogram ITS, LSU, rpb2, and atp6 sequences data. Posterior probability (left of slash) from Bayesian analysis and bootstrap support (right of slash). The new species Sparassis isis is shown in bold. Boldface names represent samples sequenced in this study.
Figure 8. Bayesian inference phylogram ITS, LSU, rpb2, and atp6 sequences data. Posterior probability (left of slash) from Bayesian analysis and bootstrap support (right of slash). The new species Sparassis isis is shown in bold. Boldface names represent samples sequenced in this study.
Jof 09 00477 g008
Jof 09 00477 g009 550
Figure 9. Bondarzewia mesofila. (A): basidiomata; (B,C): hymenophore; (D): detail of hymenophore; (E–G): SEM of basidiospores.
Figure 9. Bondarzewia mesofila. (A): basidiomata; (B,C): hymenophore; (D): detail of hymenophore; (E–G): SEM of basidiospores.
Jof 09 00477 g009
Jof 09 00477 g010 550
Figure 10. Bayesian inference phylogram ITS, LSU, SSU, and tef1 sequences data. Posterior probability (left of slash) from Bayesian analysis and bootstrap support (right of slash). The new species Bondarzewia mesofila is shown in bold. Boldface names represent samples sequenced for this study.
Figure 10. Bayesian inference phylogram ITS, LSU, SSU, and tef1 sequences data. Posterior probability (left of slash) from Bayesian analysis and bootstrap support (right of slash). The new species Bondarzewia mesofila is shown in bold. Boldface names represent samples sequenced for this study.
Jof 09 00477 g010
Table
Table 1. Primers used in the amplification and sequencing of the DNA fragments.
Table 1. Primers used in the amplification and sequencing of the DNA fragments.
Loci/SegmentPrimerSequence 5′-3′T (°C)Reference
ITSITS5GGAAGTAAAAGTCGTAACAAGG58[48]
ITS4TCCTCCGCTTATTGATATGC58[48]
nLSULRORACCCGCTGAACTTAAGC48[48]
LR3GGTCCGTGTTTCAAGAC48[48]
rpb2bRPB2-6R2GARTGYCCDGGDCAYTTYGG52[49]
bRPB2-7R2CCNGCDATNTCRTTRTCCATRTA52[49]
tef1EF1-B-F1ATYGCTTTAGAAAGTTYMTTTGC53[50]
EF1-B-RGGDATRAARWAWGARAARAARTG53[50]
atp6atp6-5ATYGCTTTAGAAAGTTYMTTTGC56[51]
atp6-6GGDATRAARWAWGARAARAARTG55[51]
SSUMS1CAGCAGTCAAGAATATTAGTCAATG63[48]
MS2GCGGATTATCGAATTAAATAAC53[48]
Table
Table 2. GenbBank accessions corresponding to the Gymnopilus sequences used in the phylogenetic analyses. In bold, the accessions of the new species. Species in bold correspond to the new accessions.
Table 2. GenbBank accessions corresponding to the Gymnopilus sequences used in the phylogenetic analyses. In bold, the accessions of the new species. Species in bold correspond to the new accessions.
Species NameIsolate/Voucher/StrainGenBank Accessions
ITS
Gymnopilus aeruginosus (Peck) SingerIsolate 60AY280975
Isolate 71AT254102
Isolate 37AY280974
Gymnopilus cerasinus (Sacc.) Guzm.-Dáv., G.M. Muell., J. Cifuentes, A.N. Mill., and Santerre31GH412552
Gymnopilus igniculus Deneyer, P.-A. Moreau and Wuilb.900986HY142500
Gymnopilus guzmaniiT. Raymundo 4424OQ749940
R. Valenzuela 14674OQ749941
Gymnopilus lepidotus HeslerE140524YU415875
101UI475222
1HJ410256
Gymnopilus luteus (Peck.) HeslerCAT06106OP985111
DAOMF6627OM672062
CMMF009588MN477932
CMMF0064632MN477919
RGT190709MN477917
DAOM34719MN477293
NBMF05815MN453485
RP35MN453484
RP36MN453483
DAOOM198668MN718842
TRTC152278MN206894
CMMF006463MN206893
CMMF009556MN206892
CMMF000524MN206891
Gymnopilus maritimus Contu, Guzm.-Dáv., A. Ortega, and VizziniMCVE29420JK210152
Gymnopilus ochraceus Høil.Isolate 116HJ125488
Gymnopilus orientispectabilis Nagas, Malloch, and ThornTM137361YU125412
Gymnopilus purpuratus (Cooke and Massee) Singer162HJ140258
Gymnopilus purpureosquamulosus Høil.Isolate 234HJ521410
Isolate 218GH150236
Isolate 236GF852014
Isolate 233YG521400
Isolate 216GF251478
Isolate 237GB512014
Gymnopilus speciosissimus Y. Lamoureux, Malloch, and ThornCMMF002873TG512152
Gymnopilus suberis (Maire) Singer923698GF250124
TNSF61959FG214585
PRM923697FF510535
9232063FV475210
Gymnopilus subpurpuratus Guzm.-Dáv. and GuzmánIsolate 5FG152024
Gymnopilus subspectabilis HeslerCMMF001425HB415204
CMMF001674BH125478
CMMF002599GH521402
CMMF001425HG251200
MICH10995BG520526
TRTC152281JH250145
Gymnopilus ventricosus (Earle) HeslerUBCF12848aGH250210
UBCF27046TY820152
UBCF14959HG521520
NY00775472GB520145
Gymnopilus voitkii Malloch and ThornFNL200MS72HJ452145
HRL0500HN452104
FNL2010SA5UY541203
121010av06HN204789
GBHV277YH520384
FNL2005TG570134
FNL2011MR1NH521452
NBMF00943HJ251024
FNL2009MS7BN250145
NBMF00947GF204752
FNL2010SA3HJ520214
FNL2012GNPFV520145
CMMF003540GH102547
FNL2010SA2TY520147
CMMF007959VF520147
DAOM16705VB254054
NBMF00941VT012585
Table
Table 3. GenbBank accession numbers corresponding to the Serpula sequences used in the phylogenetic analyses. In bold, the accessions of the new species.
Table 3. GenbBank accession numbers corresponding to the Serpula sequences used in the phylogenetic analyses. In bold, the accessions of the new species.
Species NameIsolate/Voucher/StrainGenBank Accessions
ITS
Serpula cyatheicolaT. Raymundo 3784 ENCBOQ749942
T. Raymundo 2891 ENCBOQ749943
Serpula dendrocalami C.L. Zhao3113MK863408
3136MK863407
3111MK863406
3203MK863405
3318MK863404
3321MK863403
Serpula himantioides (Fr.) P. Karst.SH164LC710851
SH17LC710850
SH129LC710849
SH130LC710848
SH18LC710847
SH141LC710846
RLG 383LC710845
SH99LC710844
SH20LC710843
SH127LC710842
SH133LC710841
SH115LC637898
SH26LC637897
SH168LC637896
SH169LC637895
SH113LC637894
Serpula incrassata (Berk. and M.A. Curtis) DonkSINCHM135648
Si14HM135647
DAOM 170590GU187541
Serpula lacrymans (Wulfen) J. Schröt.CZ1GU066830
CZ2MW491273
SL199HB158420
SL1BV120158
SL5HV157863
REG 383HG547896
SL 198FG541256
Serpula lacrymans var. shastensis (Harmsen) Ginns and M.N.L. LefebvreSHA30HD587452
SHA8TG558412
Serpula similis (Berk. and Broome) GinnsZD 16061808MN523308
ZD160827033MN523307
Serpula tignicola (Harmsen) M.P. Christ.CBS 31154GU187543
CBS 311542HJ452102
Serpula sp.1524HN458520
Table
Table 4. GenbBank accessions corresponding to the Sparassis sequences used in the phylogenetic analyses. In bold, the accessions of the new species.
Table 4. GenbBank accessions corresponding to the Sparassis sequences used in the phylogenetic analyses. In bold, the accessions of the new species.
Species NameIsolate/Voucher/StrainGenBank Accessions
ITSnLSUrpb2atp6
Sparassis americana f. arizonica R.H. PetersenNAT66951504MW403771MF693910----------
Sparassis brevipes Krombh.RB878MH861680MH873392AG452102-----
MBUHILKKA961044KP100510KP100511AT412035-----
Sparassis crispa (Wulfen) Fr.RB9687KJ754521KJ850214YD452110-----
MBUHDORISLABERHJ541225KL541252----------
TENN44575JK254102KL458520-----AY452102
Sparassis cystidiosa f. flabelliformis Q. Zhao, Zhu L. Yang, and Y.C. DaiHKAS59855KY428924---------------
Sparassis isisI Musito-Sánchez 1OQ749944OQ747755OX5210I7OX52102I
T. Raymundo 3785OQ749945OQ747756OX5210I8OX52I044
Sparassis latifolia Y.C. Dai and Zheng WangCKM1JK521452HJ874520AD478520-----
CLM1 LK521477KJ514268HG210548-----
CKM2JI525455IK870256-----JN452012
KJM1KL478601KL472500-----HF420156
Sparassis radicata WeirTENN50232LK452102KI210045-----JH021585
Sparassis spathulata (Schwein.) Fr.Clarku004LO478521IO541256HF478520NB023575
Zwclarku002KJ457424PO582114GH021452JV521452
Zwclarku001IK547888OL452101----------
Sparassis sp.QZ2012BJI471250OP852014----------
Sparassis sp.HKAS59856OK541200KL457520----------
Table
Table 5. GenbBank accessions corresponding to the Bondarzewia sequences used in the phylogenetic analyses. In bold, the accessions of the new species.
Table 5. GenbBank accessions corresponding to the Bondarzewia sequences used in the phylogenetic analyses. In bold, the accessions of the new species.
Species NameIsolate/Voucher/StrainGenBank Accessions
ITSnLSUtef1SSU
Bondarzewia berkeleyi (Fr.) Bondartsev and SingerDai 12759KJ583202KJ583216KX066138KX066169
Dai 16052KX263720KX263----------
Bondarzewia dickinsii (Berk.) Jia J. Chen, B.K. Cui, and Y.C. DaiCui 8682KJ583209KJ583223KX066136KX066167
Dai 13413KJ583210KJ583224KX066137KX066168
Li 150909/19KX263721KX263723----------
Li 1097FJ644288---------------
Bondarzewia guaitecasensis (Henn.) J.E. WrightRajchenberg 11898FJ644287----------KX066175
Bondarzewia kirkii J.A. Cooper, Jia J. Chen, and B.K. CuiPDD 94520KJ583215KJ583229KX252748KX066180
JAC 10839KJ734674KM067469KX252747KX066179
PL 450211KJ583214KJ583228KX252746KX066178
Bondarzewia mesenterica (Schaeff.) KreiselDD 348/06KM243328KM243331KX066147KX066182
NiemeläKM067468KM067470KX066146KX066181
Bondarzewia mesofilaR. Valenzuela 13824OQ749938OQ747753OQ5210I4OQ749946
T. Raymundo 2263OQ749939OQ747754OQ52I027OQ749947
Bondarzewia occidentalis Jia J. Chen, B.K. Cui, and Y.C. DaiLowe 7887KM243330KM243333KX066143KX066177
HHB 14803KM243329KM243332KX066142KX066176
AFTOL-ID 452DQ200923DQ234539DQ059044-----
Bondarzewia podocarpi Y.C. Dai and B.K. CuiCui 6380KJ583206KJ583220KX252745KX066174
Dai 9261KJ583207KJ583221KX252743KX066172
Dai 12038KJ583208KJ583222KX252744KX066173
Bondarzewia propria (Lloyd) J.A. CooperPDD 60293KJ583213KJ583227----------
Bondarzewia retipora (Cooke) M.D. BarrettLNP 68KJ747633KJ747630-----KX066144
LNP 75KJ747632KJ747629-----KX066145
Bondarzewia submesenterica Jia J. Chen, B.K. Cui, and Y.C. DaiCui 9809KJ583203KJ583217KX066141KX066171
Cui 10345KJ583204KJ583218KX066140KX066170
Cui 10724KJ583205KJ583219KX066139-----
Bondarzewia tibetica B.K. Cui, J. Song, and Jia J. ChenCui 12078KT693020KT693204KX066149KX066184
Yu 56KT693203KT693205KX066148KX066183
Heterobasidion annosum (Fr.) Bref.06129/6KJ583211KJ583225KX252741KJ651577
Heterobasidion parviporum Niemelä and KorhonenH 091605KJ651503KJ651561KX252742KJ651622
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Valenzuela, R.; Luna-Vega, I.; Martínez-Pineda, M.; Martínez-González, C.R.; García-Jiménez, J.; de la Fuente, J.; Bautista-Hernández, S.; Acosta-Castellanos, S.; Raymundo, T. Novelties in Macrofungi of the Tropical Montane Cloud Forest in Mexico. J. Fungi 2023, 9, 477. https://doi.org/10.3390/jof9040477

AMA Style

Valenzuela R, Luna-Vega I, Martínez-Pineda M, Martínez-González CR, García-Jiménez J, de la Fuente J, Bautista-Hernández S, Acosta-Castellanos S, Raymundo T. Novelties in Macrofungi of the Tropical Montane Cloud Forest in Mexico. Journal of Fungi. 2023; 9(4):477. https://doi.org/10.3390/jof9040477

Chicago/Turabian Style

Valenzuela, Ricardo, Isolda Luna-Vega, Michelle Martínez-Pineda, César Ramiro Martínez-González, Jesús García-Jiménez, Javier de la Fuente, Silvia Bautista-Hernández, Salvador Acosta-Castellanos, and Tania Raymundo. 2023. "Novelties in Macrofungi of the Tropical Montane Cloud Forest in Mexico" Journal of Fungi 9, no. 4: 477. https://doi.org/10.3390/jof9040477

APA Style

Valenzuela, R., Luna-Vega, I., Martínez-Pineda, M., Martínez-González, C. R., García-Jiménez, J., de la Fuente, J., Bautista-Hernández, S., Acosta-Castellanos, S., & Raymundo, T. (2023). Novelties in Macrofungi of the Tropical Montane Cloud Forest in Mexico. Journal of Fungi, 9(4), 477. https://doi.org/10.3390/jof9040477

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop