Improved Glutamic Acid Production Capacity of Corynebacterium glutamicum by the ARTP Mutagenesis Method

Abstract

Glutamic acid is an important amino acid that is used widely in the fields of food, medicine, and agriculture. One of the methods of glutamic acid production is direct microbial fermentation, so the genetic stability and glutamic-acid-producing capacity of the producing strain are the keys to improving glutamic acid concentration. Experiments were carried out using Corynebacterium glutamicum GL−6 as the parental strain, with two iterations of mutagenesis by atmospheric and room temperature plasma (ARTP) and screening with agar plates tolerant to high sugar and malonic acid, and the best strains with stable phenotypes were verified by fermentation in 20 L tanks. The results show that the optimal mutagenesis time of ARTP was 140 s, with lethality and positive mutation rates of 93.0% and 15.6%, respectively. The concentrations of the high-sugar and malonic acid agar plates were 240 g/L and 35 g/L, respectively. A mutant strain, P−45, with improved glutamic acid production capacity and genetic stability, was obtained through two rounds of iterative mutagenesis screening. The concentration of this strain in the Erlenmeyer flasks was 17.7 g/L, which was 18.8% higher than that of the parental strain, GL−6, and could be inherited stably for 10 generations. In the glutamic acid synthesis pathway, the upregulation of the gene encoding citrate synthase (cs), gene encoding isocitrate dehydrogenase (icdh), and gene encoding glutamate dehydrogenase (gdh), and the downregulation of the gene encoding oxoglutarate dehydrogenase complex (odhc) increased the carbon flows of the TCA cycle and its branch metabolic flow to glutamic acid synthesis. P−45 showed a glutamic acid concentration of 147.0 g/L under fed-batch fermentation conditions in 20 L tanks, which was 81.5% higher than the starting strain, GL−6. This study provides a new technical solution for improving microbial metabolites and genetic stability.

1. Introduction

Glutamic acid is one of the most important amino acids that is extensively utilized in the food industry as a flavor enhancer. In addition, it has a high application value in medicine, cosmetics, industry, and agriculture [1]. The current glutamic acid production has been steadily increasing with the development of gene editing and microbial breeding technology. However, the genetic stability and production efficiency of production strains are still intrinsic to the industrialization of microbial glutamic acid production. Therefore, it is important to improve the genetic stability and increase the glutamic acid yield of production strains through mutagenic selection for the clean production of glutamic acid and increase the profit of enterprises [2].

Microbial breeding methods have been intended for the fermentation industry, and traditional mutagenesis methods include UV mutagenesis and chemical mutagenesis for individual or repeated mutagenesis treatments, etc. [3,4,5]. Nevertheless, traditional breeding techniques have problems such as a lack of directionality, large screening workloads, and unsafe operations, and some chemical mutagens are especially toxic and harmful to humans [6]. In addition, the common genetic engineering breeding techniques are difficult to industrialize due to their disadvantages of an easy loss of recombinant plasmids, poor stability, and low yields of gene expression products. In recent years, a new mutagenesis technology, atmospheric and room temperature plasma (ARTP), has been adopted much more for mutagenesis breeding of more than 100 kinds of microorganisms, including bacteria [7,8,9,10], fungi, and algae, because of its advantages of an easy operation, safety and efficiency, mild conditions, and a friendly environment [11,12,13,14,15,16,17]. For instance, Yu et al. [18] obtained a mutant with a high cysticercin yield by ARTP mutagenesis using Streptomyces hygroscopicus ATCC 14,891 as the parental strain. The yield was significantly improved compared to the original strain; production had a 32.5% increase, and the mutants were stable. Zhang et al. [19] also treated Candida tropicalis SK36.001 by ARTP mutagenesis and screened the highest xylitol yield of mutant T31 from 200 mutants, which had a xylitol yield of 0.61 g/g, 22.0% higher than the parental strain, and the expressions of related genes and the xylitol reductase activity were higher than those of the parental strain.

Mutagenesis breeding for high glutamic acid production is mainly based on metabolic regulation, where glutamic acid synthesis is mainly influenced by carbon metabolic flows and feedback inhibition by succinate itself. Therefore, it is a high-sugar and respiratory chain-inhibitor malonic acid that could screen dual-tolerant strains which would accumulate more glutamic acid. These strains might be capable of increasing carbon flow and deregulating the strain’s feedback [20,21]. In traditional strain selection, the metabolite yield can be improved by screening mutant strains for tolerance or resistance, but the genetic stability of single mutagenesis screening is poor, which is not conducive to the industrial application of strains. To address the occurrence of such problems, most researchers have mainly used multiple rounds of repeated iterative mutagenesis. For example, Wang et al. [22] screened a genetically stable and high-yielding ε-poly-l-lysine mutant strain, AS3-14, after three iterations of ARTP breeding, and the yield was increased by 66.3% compared to the parental strain. Gu et al. [23] obtained the high-enzyme-producing mutant strain A2-13 after multiple rounds of repeated mutagenesis by ARTP combined with ethyl methanesulfonate (EMS), which had stable genetic traits and a 61.1% higher yield than the parental strain. Thus, multiple rounds of iterative mutagenesis are an effective way to improve the genetic stability of mutant strains.

In this experiment, a two-round iterative screening method of ARTP mutagenesis combined with high-sugar-tolerant and malonic-acid-resistant plates was established using C. glutamicum GL−6 as the parental strain, and a mutant strain with genetic stability and glutamic acid production capacity was screened and validated by glutamic acid fermentation in a 20 L fermentation tank (Figure 1).

2. Materials and Methods

2.1. Microbiological Cultivation

The parental strain of this study was Corynebacterium glutamicum GL−6, which was obtained from the Key Laboratory of Fermentation Engineering, Ministry of Education, Hubei University of Technology.

The seeding medium (SM): glucose—25.0 g/L, K₂HPO₄·3H₂O—1.5 g/L, MgSO₄·7H₂O—0.6 g/L, corn steep liquor—30.0 g/L, urea—3.0 g/L, MnSO₄·H₂O—4.0 mg/L, FeSO₄·7H₂O—4.0 mg/L. The fermentation medium (FM): glucose—22.0 g/L, yeast powder—30.0 g/L, succinic acid—1.0 g/L, urea—10.0 g/L, MgSO₄·7H₂O—0.4 g/L, methionine—0.5 g/L, K₂HPO₄·3H₂O—2.4 g/L, biotin—0.3 mg/L, vitamin B1—0.2 mg/L, MnSO₄·H₂O—10.0 mg/L [24]. The basic medium (BM): glucose—20.0 g/L, (NH₄)₂SO₄—1.5 g/L, KH₂PO₄—4.5 g/L, K₂HPO₄·3H₂O—1.5 g/L, MgSO₄·7H₂O—0.1 g/L, MnSO₄·H₂O—0.02 g/L, FeSO₄·7H₂O—0.02 g/L, biotin—50 μg/L, thiamine—0.1 mg/L, agar—20.0 g/L. The high glucose medium: high concentrations of (180 g/L, 200 g/L, 220 g/L, and 240 g/L) glucose were added to the basic medium. The malonic-acid-resistant medium: sodium malonate at concentrations of 20 g/L, 25 g/L, 30 g/L, and 35 g/L was added to the basic medium. The pH of the above medium was adjusted to 7.1 ± 0.1 before the sterilization at 115 °C for 20 min.

The strain was incubated overnight (200 rpm, 32 °C, OD_{600 nm} = 20) in a Cillin flask containing 5 mL of the SM to obtain the seed solution. Then, 500 μL of the seed solution was inoculated in an Erlenmeyer flask containing 50 mL of FM for 36 h (32 °C, 200 rpm). Finally, the glutamic acid concentration, OD_{600 nm}, and glucose concentration were measured.

2.2. ARTP Mutagenesis

The ARTP mutagenesis system (Wuxi Yuanqing Tianmu Biotechnology Co., Ltd., China) was used with reference to the previous research methods and with slight modifications [9]. After centrifugation, the supernatant was removed, and the bacterium was collected from the logarithmic growth period (12~14 h), washed 2~3 times with 0.9% saline, and diluted to make a bacterial suspension. The bacteria suspension was diluted, evenly applied to the surface of the slide, and then transferred to the center of the UV-sterilized ARTP chamber. The instrument parameters were set, and the sample was processed by clicking “Start” (

Table 1. ARTP mutagenesis selection conditions.

Parameters	Operating Conditions
Radio frequency power input/W	120
Illumination distance/mm	2
aeration rate L/min	10
Mutagenesis treatment time/s	20, 40, 60, 80, 100, 120, 140, 160, 180, 200
Sample size	10 μL (OD600 nm 0.6~0.8)

). After the mutagenesis was completed, the carriers were placed into EP tubes with 1 mL of sterile saline to elute into a new bacterial suspension and set aside.

The bacterial suspensions before and after mutagenesis were diluted in a 10-fold gradient, and 100 μL of diluted samples at 10⁻², 10⁻³, and 10⁻⁴ concentrations were applied to the BM plates. The number of single colonies was counted after 24~48 h of inversion incubation at a constant temperature in a 32 °C incubator to calculate the lethality (%), which was calculated as follows: $\mathrm{L}\mathrm{e}\mathrm{t}\mathrm{h}\mathrm{a}\mathrm{l}\mathrm{i}\mathrm{t}\mathrm{y}\mathrm{r}\mathrm{a}\mathrm{t}\mathrm{e}\left(\mathrm{\%}\right)=(1-\frac{\mathrm{N}\mathrm{u}\mathrm{n}\mathrm{b}\mathrm{e}\mathrm{r}\mathrm{o}\mathrm{f}\mathrm{c}\mathrm{o}\mathrm{l}\mathrm{o}\mathrm{n}\mathrm{i}\mathrm{e}\mathrm{s}\mathrm{a}\mathrm{f}\mathrm{t}\mathrm{e}\mathrm{r}\mathrm{m}\mathrm{u}\mathrm{t}\mathrm{a}\mathrm{g}\mathrm{e}\mathrm{n}\mathrm{e}\mathrm{s}\mathrm{i}\mathrm{s}}{\mathrm{N}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r}\mathrm{o}\mathrm{f}\mathrm{b}\mathrm{e}\mathrm{f}\mathrm{o}\mathrm{r}\mathrm{e}\mathrm{m}\mathrm{u}\mathrm{t}\mathrm{a}\mathrm{g}\mathrm{e}\mathrm{n}\mathrm{e}\mathrm{s}\mathrm{i}\mathrm{s}})\times 100\mathrm{\%}$.

Under the same treatment conditions, single colonies treated with a different time mutagenesis were picked out, activated, and fermented for 36 h in a Cillin flask containing 5 mL of FM, and their glutamic acid concentration was measured. The glutamic acid concentration of the control strain (mutagenesis treatment: 0 s) was used as the benchmark for comparison, and a positive mutation was considered when the glutamic acid concentration of the mutant bacterium was greater than that of the control strain, which was calculated as follows: $\mathrm{P}\mathrm{o}\mathrm{s}\mathrm{i}\mathrm{t}\mathrm{i}\mathrm{v}\mathrm{e}\mathrm{m}\mathrm{u}\mathrm{t}\mathrm{a}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n}\mathrm{r}\mathrm{a}\mathrm{t}\mathrm{e}\left(\mathrm{\%}\right)=\frac{\mathrm{N}\mathrm{n}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r}\mathrm{o}\mathrm{f}\mathrm{p}\mathrm{a}\mathrm{s}\mathrm{i}\mathrm{t}\mathrm{i}\mathrm{v}\mathrm{e}\mathrm{m}\mathrm{u}\mathrm{t}\mathrm{a}\mathrm{n}\mathrm{t}\mathrm{c}\mathrm{o}\mathrm{l}\mathrm{o}\mathrm{i}\mathrm{e}\mathrm{s}}{\mathrm{T}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l}\mathrm{n}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r}\mathrm{o}\mathrm{f}\mathrm{c}\mathrm{o}\mathrm{l}\mathrm{o}\mathrm{n}\mathrm{i}\mathrm{e}\mathrm{s}}\times 100\mathrm{\%}$, where the total number of colonies in the calculation formula refers to all colonies growing on the screening plate.

Cross-iterative mutagenesis: Using the same ARTP mutagenesis method, the high-yielding mutant strain obtained in the first round of mutagenesis was used as the parental strain for the second round of repeated mutagenesis. The high-sugar-resistant second-round mutant strain was diluted and coated in malonic acid agar plates in a crossover manner, and then the malonic-acid-resistant second-round mutant strain was diluted and coated in a high-sugar medium to screen for mutant strains with both high sugar resistance and malonic acid resistance.

2.3. Mutant Strain Screening

Determining the best screening plate: C. glutamicum GL−6 strains were diluted at certain concentrations, coated in high-sugar and malonic acid plates with different concentration gradients, incubated at 32 ℃ for 4~6 d at a constant temperature, and inverted. The best growth condition of the strains in the plates was observed to determine the best medium for glucose and malonic acid concentrations.

Primary screening and re-screening of mutant strains: Using a biosensor as a method to detect glutamic acid concentrations, single colonies of mutant strains with vigorous growth in the screening plate were firstly picked out and fermented in a Cillin bottle with 5 mL of FM, and their glutamic acid concentration was compared to obtain the Cillin bottle primary screening mutant strains.

Verification of genetic stability: The high-yielding mutant strains obtained from the combination of the primary screening and re-screening methods were passed through the FM every 36 h for a total of 10 generations, and then the glutamic acid concentration and OD_{600 nm} of each generation were measured to verify the genetic stability of the mutant strains.

2.4. qRT-PCR Assay

GL-6 and the final mutant strain were taken as samples when they grew at log phase and were in a high-sugar and malonic acid screening medium. The RNA was extracted using the Cell Total RNA Isolation Kit (Foregene, Chengdu, China) and reverse-transcribed using the PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TaKaRa, Beijing, China). The cDNA was obtained by reverse transcription with the PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TaKaRa, Beijing, China), and quantitative PCR reactions were performed using the ChamQ SYBR qPCR Master Mix (Nanjing Novozymes Biological Co., Ltd., China) to detect the gene transcript levels. The primers used for qPCR were synthesized by (Shanghai Bioengineering Co., Ltd., Shanghai, China), as shown in

Table 2. Primers used in this study.

Primers	Sequences (5′–3′)	Uses
CS-F	TGATTTCCCTCATCCACTCC	Citrate synthetase
CS-R	CAGGTTGTGTCCAATGCTTC
ICDH-F	GTCTTTTTCCTCGTCGGTGG	Isocitrate dehydrogenase
ICDH-R	ACATCTCCGCTTCTGTTCCA
GDH-F	TCCTTGATTTCGCGGAGCTT	Glutamate dehydrogenase
GDH-R	CGCGATTGAAAAGGCTCAGG
ODHC-F	CTTCTTAGCAACGGGAGCCA	Ketoglutarate dehydrogenasecomplex
ODHC-R	CGGCCTTGAGACCAACATCT
16sRNA-F	GTAGGGTGCGAGCGTTGTCC	reference genes
16sRNA-R	CGCCATTGGTGTTCCTCCTG

, using the 16S rRNA gene as an internal reference. The CT method (2^-ΔΔCT) was used to calculate the relative expression of different genes [25].

2.5. 20 L Fermenter with Fed-Batch Fermentation

The strain was activated for logarithmic growth (OD_{600 nm} = 20) in a 500 mL Erlenmeyer flask containing 100 mL of SM, and then inoculated at 10% (v/v) in a 20 L fermenter (Shanghai Baoxing Biochemical Equipment Co., Ltd., Shanghai, China) containing 12 L of the fermentation medium for 56 h of fed-batch fermentation. The batch replenishment parameters were controlled as follows: the tank pressure was maintained at 0.030~0.035 MPa; the initial air flow was 1.0 L/min and adjusted to 1.3 L/min after 24 h of fermentation; the initial pH was 6.5~7.0, and pH 7.2~7.5 was maintained by the flow addition of ammonia during replenishment; stirring was controlled at 100~500 r/min; dissolved oxygen was set at 20% and coupled with stirring; and the final concentration of sugar during fermentation was maintained at 1.0~3.0 g/L by the flow addition of 500 g/L glucose (100 mL/h) after 8 h of fermentation. The temperature was maintained at 32 °C during the first period, and the temperature was increased to 37 °C to induce glutamic acid secretion when the OD_{600 nm} reached 70~80 at the later stage of fermentation (44 h). The replenishment was stopped 2~3 h before the end of fermentation, and the fermentation was finished when the residual sugar was depleted. During the fermentation period, samples were taken every 4 h to determine the glutamic acid concentration, the OD_{600 nm}, and the residual sugar concentration.

2.6. Analysis Method

The glutamic acid and glucose concentrations were determined using the S−10 biosensor analyzer (Shenzhen Sillman Biotechnology Co., Ltd., Shenzhen, China). The OD_{600 nm} was determined by the visible spectrophotometer method (Shanghai Meisei Instruments Co., Ltd., Shanghai, China), and the absorbance was measured at 600 nm [26,27].

2.7. Data Analysis

All experiments were repeated in parallel three times. GraphPad Prism 8.0.1 and Origin 2019b software were used to analyze the data and plot the experimental graphs.

3. Results and Discussion

3.1. Determining the Optimal Time for Mutagenesis

To effectively screen the high-yield strains, the lethality and positive mutation curves were plotted after mutagenesis of the parental strain GL−6 using the ARTP technique, respectively. The lethality rates of the strain were 54.0%, 83.0%, and 96.0% after exposure to the ARTP system for 120 s, 140 s, and 160 s, respectively (Figure 2). When the radiation time was extended to 200 s, there was no cell survival. Meanwhile, different treatment times also affected the positive mutation rates, which were 14.5%, 15.6%, and 13.8% at 120 s, 140 s, and 160 s of the mutagenesis treatment, respectively (Figure 2). Therefore, the positive mutation rate and lethality rate were highest when the ARTP mutagenesis treatment was 140 s, with 15.6% and 93.0%, respectively, and this experimental result is consistent with the results of previous studies [28]. Single colonies obtained under the lethality rate of 90.0%~95.0% are considered mutants with altered physiological characteristics. According to the results, 140 s was selected as the appropriate time for mutagenesis in this study, according to the literature.

3.2. Mutant Strain Screening

3.2.1. Mutant Strain Primary Screening

In order to obtain a mutant strain with high sugar tolerance, the parental strain, GL−6, was first screened on a high-sugar plate. The growth of the GL−6 parental strain was inhibited in the high-sugar medium of 240 g/L, and its colony number decreased by 19.6% compared to that in the BM (Figure 3a). Therefore, the sugar concentration of 240 g/L was chosen as the high-sugar-tolerant medium to screen the mutant strain. Then, 155 mutant strains were randomly selected in 240 g/L high-sugar plates according to the size, roundness, and abundance of the single-colony growth (

Table A1. Initial screening results of the first round of mutagenic high-sugar-resistant mutant strains.

Number	Glutamic Acid Concentration (g/L)	Positive and Negative Mutations	Number	Glutamic Acid Concentration (g/L)	Positive and Negative Mutations
GL−6	12.7 ± 0.7	CK	P78	12.5 ± 0.7	−
P1	15.2 ± 0.6	+	P79	14.1 ± 0.6	+
P2	10.8 ± 1.4	−	P80	11.7 ± 0.3	−
P3	11.8 ± 0.3	−	P81	12.2 ± 1.1	−
P4	11.5 ± 1.0	−	P82	12.0 ± 2.3	−
P5	10.1 ± 0.1	−	P83	10.7 ± 0.7	−
P6	15.3 ± 1.0	+	P84	12.9 ± 0.4	+
P7	14.7 ± 0.4	+	P85	14.2 ± 0.0	+
P8	14.9 ± 0.4	+	P86	14.0 ± 0.0	+
P9	15.0 ± 0.4	+	P87	10.0 ± 0.3	−
P10	10.1 ± 0.7	−	P88	14.1 ± 0.4	+
P11	12.0 ± 2.3	−	P89	10.5 ± 1.0	−
P12	10.9 ± 1.8	−	P90	13.3 ± 0.1	+
P13	14.7 ± 0.7	+	P91	13.2 ± 1.1	+
P14	10.0 ± 1.4	−	P92	13.0 ± 0.3	−
P15	13.0 ± 0.3	+	P93	13.7 ± 0.6	+
P16	10.3 ± 0.4	−	P94	12.2 ± 0.3	−
P17	12.3 ± 0.7	+	P95	13.4 ± 0.9	+
P18	13.9 ± 0.5	+	P96	12.6 ± 0.1	−
P19	14.2 ± 0.9	+	P97	11.2 ± 0.9	−
P20	14.9 ± 0.5	+	P98	12.1 ± 0.1	−
P21	12.0 ± 0.3	−	P99	10.6 ± 0.6	−
P22	13.0 ± 0.3	+	P100	11.9 ± 0.7	−
P23	10.1 ± 1.3	−	P101	10.9 ± 1.8	−
P24	11.2 ± 0.3	−	P102	12.0 ± 0.6	−
P25	11.4 ± 0.6	−	P103	11.6 ± 0.9	−
P26	12.7 ± 1.0	/	P104	10.3 ± 0.6	−
P27	15.2 ± 0.0	+	P105	12.2 ± 0.6	−
P28	15.6 ± 0.4	+	P106	12.4 ± 0.3	−
P29	14.4 ± 0.1	+	P107	12.0 ± 0.9	−
P30	14.2 ± 1.1	+	P108	12.0 ± 0.3	−
P31	14.8 ± 0.9	+	P109	11.9 ± 2.1	−
P32	12.4 ± 1.1	−	P110	12.0 ± 0.9	−
P33	11.7 ± 1.0	−	P111	13.4 ± 0.3	+
P34	13.6 ± 0.9	+	P112	11.6 ± 0.9	−
P35	11.5 ± 0.7	−	P113	10.5 ± 0.7	−
P36	11.2 ± 0.0	−	P114	12.0 ± 0.9	−
P37	12.5 ± 0.7	−	P115	11.6 ± 0.3	−
P38	12.4 ± 0.3	−	P116	12.5 ± 0.4	−
P39	12.3 ± 0.1	−	P117	10.3 ± 1.0	−
P40	13.1 ± 0.1	+	P118	11.4 ± 0.0	−
P41	13.6 ± 0.0	−	P119	11.5 ± 0.1	−
P42	13.0 ± 0.6	−	P120	12.7 ± 1.0	/
P43	14.1 ± 0.7	+	P121	12.5 ± 0.1	−
P44	10.7 ± 0.4	−	P122	11.1 ± 0.4	−
P45	10.0 ± 1.1	−	P123	10.7 ± 1.0	−
P46	12.4 ± 0.9	−	P124	14.3 ± 0.7	+
P47	11.2 ± 0.3	−	P125	12.9 ± 1.1	+
P48	13.1 ± 1.3	+	P126	13.2 ± 0.3	+
P49	10.6 ± 0.9	−	P127	11.1 ± 0.8	−
P50	11.1 ± 1.6	−	P128	12.3 ± 0.1	−
P51	11.8 ± 0.3	−	P129	12.7 ± 0.4	/
P52	13.3 ± 0.1	+	P130	11.5 ± 1.6	−
P53	12.5 ± 0.4	−	P131	11.8 ± 1.4	−
P54	10.8 ± 0.9	−	P132	12.8 ± 0.0	+
P55	13.9 ± 1.8	+	P133	12.6 ± 0.6	−
P56	12.9 ± 0.4	−	P134	12.6 ± 0.6	−
P57	11.1 ± 1.3	−	P135	13.6 ± 0.6	+
P58	11.4 ± 0.6	−	P136	11.9 ± 0.1	−
P59	12.6 ± 0.9	−	P137	13.9 ± 0.1	+
P60	13.5 ± 0.7	+	P138	10.7 ± 0.4	−
P61	13.1 ± 1.0	−	P139	11.4 ± 0.9	−
P62	12.9 ± 0.4	−	P140	10.8 ± 0.3	−
P63	12.9 ± 1.3	−	P141	12.8 ± 0.3	−
P64	12.4 ± 0.0	−	P142	13.8 ± 0.3	+
P65	14.5 ± 0.4	+	P143	14.7 ± 0.4	+
P66	14.7 ± 0.4	+	P144	10.7 ± 0.4	−
P67	13.9 ± 0.1	+	P145	13.1 ± 0.2	+
P68	11.8 ± 1.1	−	P146	11.7 ± 1.0	−
P69	14.3 ± 0.4	+	P147	13.0 ± 1.1	+
P70	12.5 ± 0.4	−	P148	13.5 ± 0.7	+
P71	12.1 ± 1.3	−	P149	11.0 ± 1.2	−
P72	12.6 ± 0.0	−	P150	11.7 ± 0.4	−
P73	13.8 ± 0.3	+	P151	12.5 ± 0.6	−
P74	13.7 ± 1.3	+	P152	11.9 ± 0.2	−
P75	12.0 ± 0.0	−	P153	11.2 ± 1.3	−
P76	13.7 ± 0.7	+	P154	12.8 ± 0.9	+
P77	11.5 ± 0.0	−	P155	13.5 ± 0.6	+

Note: “+” indicates positive mutation, “−” indicates negative mutation, and “/” indicates no change.

) in 40 mL Cillin bottles for primary screening. The results indicate that the majority of the mutant strains had a glutamic acid production capacity comparable to that of the GL−6 parental strain. Among the 55 positive mutant strains, only 16 mutants showed about 10% and higher increases in the glutamic acid concentration compared to the GL−6 parental strain, including one high-sugar-tolerant mutant strain P17 with 15.5 g/L of glutamic acid production, which was an increase of 17.4% compared to the GL−6 parental strain (Figure 3b). After re-screening these 16 positive mutant strains using 250 mL Erlenmeyer flasks, the mutant strain P17 remained the most glutamic-acid-producing mutant strain with 16.7 g/L of glutamic acid production, which was 12.8% higher than that of the GL−6 parental strain (Figure 3c).

For the purpose of obtaining malonic-acid-resistant mutant strains, the GL−6 parental strain was first screened on malonic acid agar plates. The GL−6 parental strain grew weakly in the malonic acid plates with 30 g/L and did not grow on plates with 35 g/L (Figure 4a). Therefore, the plates with a critical concentration of 35 g/L of malonic acid were selected for the screening of mutant strains. Then, 72 single colonies were randomly picked from the 35 g/L malonic acid agar plates (

Table A2. Primary screening results of malonic-acid-resistant mutant strains.

Number	Glutamic Acid Concentration (g/L)	Positive and Negative Mutations	Number	Glutamic Acid Concentration (g/L)	Positive and Negative Mutations
GL−6	13.3 ± 0.7	CK	B36	13.7 ± 3.2	+
B1	13.8 ± 0.3	+	B37	12.6 ± 0.5	−
B2	14.7 ± 0.4	+	B38	10.4 ± 0.8	−
B3	13.1 ± 0.4	−	B39	12.9 ± 1.0	−
B4	13.9 ± 0.4	+	B40	13.5 ± 1.8	+
B5	14.7 ± 0.6	+	B41	11.1 ± 2.7	−
B6	12.7 ± 1.0	−	B42	12.6 ± 0.5	−
B7	11.6 ± 0.5	−	B43	12.5 ± 2.1	−
B8	13.1 ± 1.5	−	B44	10.7 ± 0.4	−
B9	12.8 ± 0.3	−	B45	13.2 ± 1.1	−
B10	13.2 ± 1.1	−	B46	13.5 ± 2.1	+
B11	12.2 ± 0.6	−	B47	10.5 ± 0.7	−
B12	14.6 ± 0.6	+	B48	12.2 ± 1.1	−
B13	13.0 ± 0.5	−	B49	13.8 ± 2.2	+
B14	12.6 ± 0.3	−	B50	12.7 ± 0.1	−
B15	12.6 ± 0.6	−	B51	12.1 ± 1.3	−
B16	10.8 ± 0.3	−	B52	13.6 ± 1.1	+
B17	13.8 ± 0.5	+	B53	14.0 ± 0.57	+
B18	13.1 ± 0.6	−	B54	13.0 ± 0.6	−
B19	12.0 ± 1.1	−	B55	14.4 ± 0.4	+
B20	12.6 ± 0.6	−	B56	14.2 ± 0.1	+
B21	12.8 ± 0.2	−	B57	14.8 ± 0.2	+
B22	13.0 ± 0.6	−	B58	15.4 ± 0.6	+
B23	15.0 ± 0.1	+	B59	14.8 ± 0.2	+
B24	11.9 ± 0.1	−	B60	11.5 ± 0.7	−
B25	14.4 ± 0.6	+	B61	14.0 ± 0.8	+
B26	13.4 ± 0.8	+	B62	12.8 ± 0.2	−
B27	14.4 ± 0.8	+	B63	12.5 ± 0.7	−
B28	11.9 ± 1.3	−	B64	13.8 ± 1.1	+
B29	12.8 ± 0.2	−	B65	13.8 ± 0.3	+
B30	11.1 ± 2.4	−	B66	12.7 ± 0.4	−
B31	12.8 ± 1.1	−	B68	12.8 ± 0.3	−
B32	14.1 ± 0.4	+	B69	14.6 ± 0.6	+
B33	13.5 ± 1.3	+	B70	14.7 ± 0.7	+
B34	14.2 ± 2.2	+	B71	15.2 ± 0.6	+
B35	13.4 ± 2.0	/	B72	15.1 ± 1.0	+

Note: “+” indicates positive mutation, “−” indicates negative mutation, and “/” indicates no change.

). The results of the initial sieving in the Cillin bottles showed that 10 of the 32 positive mutant strains had a 10% and higher improvement in the glutamic acid production capacity compared to that of the GL−6 parental strain (Figure 4b), including one mutant strain B58 with 15.4 g/L of glutamic acid production, which was 15.8% higher than that of the GL−6 parental strain. After re-screening these 10 positive mutant strains using 250 mL Erlenmeyer flasks, B58 was still the most glutamic-acid-producing mutant strain, with 16.4 g/L of glutamic acid production, which was 13.1% higher than that of the GL−6 parental strain (Figure 4c).

To verify the genetic stability of the mutant strains, the P17 mutant strain and the B58 mutant strain with malonic acid resistance were cultured for 10 generations. The results show that the glutamic acid yield was basically maintained at 16.0 g/L, and the OD_{600 nm} was basically kept at 18.0 for the P17 mutant strain in the first eight generations of culture, but the glutamic acid yield and OD_{600 nm} of the P17 mutant strain showed a gradual decrease after the eighth generation (Figure 5a). Although single mutagenesis can improve the glutamic acid yield, it is prone to the genetic instability of the trait. Similar to the P17 mutant strain, mutant strain B58 had the highest initial glutamic acid concentration, but it decreased significantly during the subsequent passaging cultures. The reason for this is the frequent reversion of mutant genes during the mutagenic selection of the strains (Figure 5b).

3.2.2. Cross-Iterative Mutagenic Strain Re-Screening

To solve the problems of the genetic instability and low glutamic acid production capacity of the mutant strains, we used cross-iterative mutagenesis. The high-sugar-resistant mutant strain P17 was mutagenized in two rounds and then coated on agar plates with a malonic acid concentration of 35 g/L. A total of 61 single colonies were picked out (

Table A3. Re-screening results of cross-iterative mutagenesis of high-sugar-resistant mutant strains.

Number	Glutamic Acid Concentration (g/L)	Positive and Negative Mutations	Number	Glutamic Acid Concentration (g/L)	Positive and Negative Mutations
GL−6	13.8 ± 0.6	parental	P−31	11.6 ± 3.7	−
B58	15.2 ± 0.2	CK	P−32	14.1 ± 0.7	−
P−1	14.3 ± 0.1	−	P−33	13.2 ± 0.3	−
P−2	14.4 ± 0.3	−	P−34	13.6 ± 1.4	−
P−3	16.9 ± 0.1	+	P−35	14.8 ± 0.3	−
P−4	13.6 ± 0.6	−	P−36	11.8 ± 0.5	−
P−5	16.2 ± 0.6	+	P−37	13.8 ± 0.6	−
P−6	16.1 ± 0.4	+	P−38	13.5 ± 0.1	−
P−7	14.8 ± 0.3	−	P−39	13.5 ± 2.1	−
P−8	16.1 ± 0.7	+	P−40	12.9 ± 0.4	−
P−9	15.4 ± 0.3	+	P−41	12.6 ± 0.5	−
P−0	15.1 ± 0.2	−	P−42	11.1 ± 0.6	−
P−11	13.2 ± 0.3	−	P−43	10.4 ± 4.8	−
P−12	14.7 ± 0.1	−	P−44	12.1 ± 0.7	−
P−13	15.9 ± 0.1	+	P−45	15.3 ± 0.5	+
P−14	15.5 ± 0.1	+	P−46	15.6 ± 0.2	+
P−15	14.2 ± 1.1	−	P−47	14.3 ± 0.4	−
P−16	14.4 ± 0.6	−	P−48	14.0 ± 0.0	−
P−17	15.5 ± 0.1	+	P−49	14.8 ± 1.1	−
P−18	14.8 ± 0.0	−	P−50	14.1 ± 0.7	−
P−19	16.0 ± 0.0	+	P−51	13.7 ± 0.7	−
P−20	15.0 ± 0.9	−	P−52	13.6 ± 1.1	−
P−21	14.8 ± 0.6	−	P−53	13.8 ± 0.3	−
P−22	15.4 ± 0.6	+	P−54	12.6 ± 0.9	−
P−23	13.9 ± 0.7	−	P−55	11.2 ± 3.4	−
P−24	15.1 ± 0.7	−	P−56	11.3 ± 4.1	−
P−25	12.8 ± 0.3	−	P−57	12.8 ± 0.3	−
P−26	12.2 ± 1.1	−	P−58	13.9 ± 0.6	−
P−27	10.2 ± 2.0	−	P−59	13.4 ± 0.9	−
P−28	14.1 ± 1.0	−	P−60	14.0 ± 0.9	−
P−29	13.4 ± 0.9	−	P−61	15.2 ± 0.2	+
P−30	12.8 ± 0.3	−

Note: “+” indicates positive mutation, “−” indicates negative mutation, and “/” indicates no change.

), and the highest glutamic-acid-producing mutant strain P−3 was obtained with a glutamic acid yield of 16.9 g/L, which was 11.2% and 22.5% higher than those of the B58 control strain and the GL−6 parental strain, respectively (Figure 6a). Among them, there were 12 positive mutant strains, and after activation and re-screening using Erlenmeyer flasks, P−45, a mutant strain, with a glutamic acid production of 17.7 g/L, was obtained, which was 14.9% and 18.8% higher than those of the B58 control strain and the GL−6 parental strain, respectively (Figure 6b).

Then, the B58 mutant strain with malonic acid resistance was repeatedly mutagenized and coated on high-sugar plates at a concentration of 240 g/L. A total of 22 single colonies were selected (

Table A4. Re-screening results of crossed iterative mutagenesis of malonic-acid-resistant mutant strains.

Number	Glutamic Acid Concentration (g/L)	Positive and Negative Mutations	Number	Glutamic Acid Concentration (g/L)	Positive and Negative Mutations
GL−6	13.7 ± 0.4	parental	B−11	14.1 ± 1.0	+
P17	14.2 ± 1.1	CK	B−12	15.1 ± 0.3	+
B−1	14.2 ± 0.5	/	B−13	15.2 ± 0.4	+
B−2	13.6 ± 1.3	−	B−14	15.2 ± 0.6	+
B−3	15.1 ± 0.7	+	B−15	14.2 ± 1.2	/
B−4	14.2 ± 0.5	/	B−16	13.5 ± 1.3	−
B−5	14.0 ± 0.7	+	B−17	12.6 ± 0.5	−
B−6	13.5 ± 0.3	−	B−18	12.6 ± 0.4	−
B−7	13.5 ± 1.9	−	B−19	13.6 ± 0.5	−
B−8	15.7 ± 0.8	+	B−20	12.9 ± 2.4	−
B−9	13.6 ± 0.9	−	B−21	12.1 ± 1.0	−
B−10	13.9 ± 0.5	+	B−22	13.0 ± 1.0	−

Note: “+” indicates positive mutation, “−” indicates negative mutation, and “/” indicates no change.

), and the highest glutamic-acid-producing mutant strain B−8 was obtained with a glutamic acid yield of 15.7 g/L, which was 10.6% and 15.4% higher compared to those of the P17 control strain and the GL−6 parental strain, respectively (Figure 7a). There were five positive mutant strains, and a mutant strain, B−13, with a glutamic acid production of 17.0 g/L, was obtained after activation and re-screening by shaking the Erlenmeyer flasks, with increases of 2.4% and 14.1% compared to the P17 control strain and the GL−6 parental strain, respectively (Figure 7b).

The mutant strains P−45 and B−13 were cultured for 10 consecutive generations to verify their genetic stability. The results show that the P−45 mutant strain was stable in terms of genetic stability traits for 10 consecutive generations of culture. The glutamic acid concentration was held at 17.3 g/L and the OD_{600 nm} was maintained at around 18.5 (Figure 8a). The genetic traits of mutant strain B−13 were also more stable than those of B58 under the same conditions (Figure 8b). It is further shown that multiple rounds of repeated cross-iterative mutagenesis were effective at enhancing high-sugar-tolerant and malonic-acid-resistant mutants while stabilizing their genetic traits. The results also show that P−45 had slightly better genetic stability and glutamic acid production than B−13, so mutant strain P−45 should be selected for experiments in subsequent studies.

3.3. qRT-PCR Analysis

To further investigate the reason for the increased glutamic acid concentration in the P−45 mutant strain, we first analyzed the key genes in the glutamic acid synthesis pathway (cs, icdh, gdh, and odhc) by qRT-PCR assay (Figure 9A). We detected a significant upregulation of the expression level of the cs gene (encoding citrate synthase (CS)) mutant strain, which was increased 1.3−fold compared to the GL−6 parental strain (Figure 9B). It also had a 16% upregulation of the expression level of the icdh gene (encoding isocitrate dehydrogenase (ICDH)), which catalyzes the synthesis of glutamic acid precursors (Figure 9B). The enzymes encoded by these two genes are key rate-limiting enzymes in the tricarboxylic acid cycle (TCA), and it is possible that the high-glucose-tolerant mutant strain obtained from the screening increased the efficiency of glucose utilization to maximize the carbon flow of this strain in glycolysis (EMP) and the tricarboxylic acid cycle (TCA) to enhance glutamic acid synthesis. Varela et al. [29] found that 90% of the carbon flow in C. glutamicum was directed to the pentose phosphate pathway (PPP) under hyperosmotic stress, resulting in a 3.5-fold increase in glycolytic (EMP) flow. This result may be one of the main reasons for the upregulation of the gene and the increase in the glutamic acid concentration in this study.

In addition, the expression level of the odhc gene (encoding the oxoglutarate dehydrogenase complex (ODHC)) of the mutant strain was significantly downregulated by 1.6-fold compared to that of the GL−6 parental strain (Figure 9B). ODHC is the enzyme that catalyzes the formation of succinyl-CoA from glutamic acid synthesis precursors (α-ketoglutarate). A reduced quantity of ODHC could alter the metabolic distribution, allowing for more α-ketoglutarate to be used for glutamic acid synthesis. It was shown that the α-ketoglutarate dehydrogenase complex-encoding gene odhc has a low level of enzymatic activity for high glutamic-acid-producing strains in another study [30]. In this study, odhc gene expression levels were significantly downregulated due to the screening of the mutant strains with malonic acid resistance. Malonic acid is a structural analog of succinic acid, and mutant bacteria with structural analog resistance can release succinic acid’s own feedback inhibition and feedback blockage, which can concentrate intracellular carbon sources in the glutamic acid synthesis pathway. The expression level of the gdh gene (encoding glutamate dehydrogenase (GDH)) in the mutant strain was increased 4-fold compared to the GL−6 parental strain (Figure 9B). In short, the high-sugar and malonic-acid-tolerant mutant strains with better producing capacity of the glutamic acid could increase the glutamic acid anabolic flow, resulting in a significant increase in glutamic acid concentration.

3.4. Comparison of Erlenmeyer Flasks Fermentation Processes

To verify the fermentation performance of the P−45 mutant strain and the GL−6 parental strain, the two strains were subjected to Erlenmeyer flask fermentation experiments. The trends of the sugar consumption and OD_{600 nm} of the two strains during the Erlenmeyer flask fermentation were basically the same (Figure 10). In terms of sugar consumption, the glucose concentration of both strains was depleted to below 3.0 g/L after 24 h of fermentation and remained stable, but the sugar consumption rate of mutant strain P−45 was slightly higher than that of the GL−6 parental strain during this fermentation. In addition, the OD_{600 nm} of mutant strain P−45 increased from 1.5 to a maximum of about 21.8, and the OD_{600 nm} of mutant strain P−45 was always higher than that of parental strain GL−6 at the same fermentation time, indicating that the growth and glutamic-acid-producing capacity of mutant strain P−45 was stronger than that of parental strain GL−6. Comparing the changes in the glutamic acid concentration of the two strains, it is found that the glutamic acid concentration of mutant strain P−45 was also consistently higher than that of parental strain GL−6, and the glutamic acid concentration of mutant strain P−45 reached a maximum of 17.1 g/L at the growth arrest stage of the strain, which was 2.4 g/L higher than that of GL−6 (14.7 g/L), an increase of 16.3%. From the results of the Erlenmeyer flask experiments, it could be inferred that ARTP ‘high sugar-malonic acid’ cross-iterative mutagenesis might be related to improving glutamic acid synthesis, resulting in a higher glutamic acid yield.

3.5. 20 L Fermenter with Fed-Batch Fermentation

Although the glutamic acid concentration of the mutant strain was significantly higher than that of the parental strain in the Erlenmeyer flask fermentation, it is unclear whether this high productivity can be sustained in large-scale fermentations to meet industrial demands. Therefore, the production performances of the GL−6 parental strain and the P−45 mutant strain were compared in a 20 L bioreactor in a fed-batch fermentation. The P−45 mutant strain and the GL−6 parental strain had similar growth curves, but the cell growth performance of P−45 was better than that of the GL−6 parental strain, and the OD_{600 nm} was always maintained at a higher level. The P−45 mutant strain reached the highest OD_{600 nm} at 48 h of fermentation and increased by 14.7% compared to the GL−6 parental strain, after it gradually decreased until the end of fermentation (Figure 11). The glucose consumption rate of the P−45 mutant strain also converged with that of the parental strain, with the residual sugar decreasing from 20.7 g/L to 2.1 g/L at 8 h of fermentation.

For longer strain growth and glutamic acid production, we used batch replenishment in the fermenter [31]. After 8 h of fermentation, the nutrient concentration in the fermentation environment was maintained by uniformly flowing 500 g/L of glucose at 1.0~2.0 g/L, and the pH was controlled by flowing ammonia in the range of 7.2~7.5 as a way to promote strain growth and glutamic acid accumulation. After fed-batch fermentation, the fermentation time of mutant strain P−45 was extended from 32 to 48 h. The highest glutamic acid concentration was 147 g/L, which was 81.5% higher than that of the GL−6 parental strain (81 g/L), and the glutamic acid synthesis capacity was significantly enhanced compared to the Erlenmeyer flask fermentation (17.1 g/L). The reason is that the batch replenishment method could meet the nutritional requirements of the strain for the growth and accumulation of metabolites. The above results indicate that glucose utilization was improved by performing ARTP iterative mutagenesis combined with dual-resistance selection. Under the conditions of a sufficient carbon source (batch replenishment), the conversion of α-ketoglutarate to glutamic acid catalyzed by glutamic acid dehydrogenase was enhanced, resulting in a large accumulation of glutamic acid by the P−45 mutant strain.

4. Conclusions

Well-performing strains are a prerequisite for industrial production. To improve the performance of glutamic-acid-producing strains, most researchers have used traditional methods, such as UV mutagenesis or chemical mutagens, to produce mutant loci in the genome of the strains, but such methods are associated with safety risks and unstable genetic traits of the strains.

In this study, two high glutamic-acid-producing strains, P17 and B58, were obtained by ARTP mutagenesis screening on the basis of 240 g/L of high-sugar and 35 g/L of malonic acid agar plates, with increases of 13.0% and 13.3%, respectively, compared to the starting strain, GL−6. However, the single mutagenized strain showed unstable genetic traits, so we used cross-iterative mutagenesis and successfully screened a high glutamic-acid-yielding strain, P−45, with an Erlenmeyer flask concentration of 17.7 g/L, which was 18.8% higher than that of the GL−6 parental strain and could be inherited stably for 10 generations. These results demonstrate that crossover iterative mutagenesis could make up for the shortcomings of a single mutagenesis and obtain mutant strains with more stable genetic traits. In addition, it was found that the upregulation of the cs, icdh, and gdh gene expression levels of P−45 by 1.3-fold, 0.2-fold, and 4-fold, respectively, and the downregulation of the odhc gene expression levels by 1.6-fold could lead to a greater flow of carbon metabolism towards glutamic acid synthesis. To meet future industrial production needs, the glutamic acid concentration was further increased to 147.0 g/L by batch replenishment, which is 81.5% higher than that of the GL−6 parental strain. In a similar study, Zheng et al. [32], using Corynebacteria glutamicum as the starting strain, conducted three rounds of genomic modification followed by UV irradiation and diethyl sulfate mutagenesis, which resulted in a high glutamic-acid-yielding mutant strain, F343, which showed a 1.8-fold increase in L-glutamate production (65.8 g/L) compared to the starting strain (35.6 g/L) at a controlled temperature of 38 °C in a 5 L fermenter. In addition, Li et al. [33] obtained a mutant strain, GTS 190, with high L-glutamic acid production by mutagenesis using protoplasts, UV irradiation, and diethyl sulfate, using Brevibacterium flavum as the starting strain, which achieved a glutamic acid yield of 195 g/L after fermentation in batch replenishment. The above studies have shown that traditional mutagenesis breeding, whose damage to cells is greater, although studied for many years, might lead to aggregated lesions. Compared to traditional mutagenesis, ARTP mutagenesis is safer and more efficient in the strain’s selection. It is simple to perform as well.

The selection strategy based on ARTP mutagenesis in this study was able to enhance the genetic stability of the strain while improving the glutamic acid production capacity of the wild-type strain, and fermentation with batch replenishment for glutamic acid production could further increase the glutamic acid concentration. The establishment of this research method can provide a reference for steadying the genetic traits and improving the metabolites of microorganisms’ production.