Changes in Fatty Acid Profiles in Seeds of Camellia oleifera Treated by Mycorrhizal Fungi and Glomalin

Abstract

Camellia oleifera is an important oilseed forest tree, but it is unknown whether and how inoculation with arbuscular mycorrhizal fungi, as well as spraying easily extractable glomalin-related soil protein (EG), regulates the fatty acid profile in seeds of this species. This study explored how inoculation with Rhizophagus intraradices (800 g inoculum/tree) and spraying EG (2.5 L/tree, four times in total, once a week) modulated the fatty acid profile for potential nutritional qualities in the seeds of 20-year-old C. oleifera. Spraying exogenous EG significantly increased fruit transverse diameter, longitudinal diameter, fruit weight, number of seeds, and seed weight but had no significant effect on the root mycorrhizal colonization rate. Inoculation with R. intraradices had no significant effect on these fruit traits but significantly boosted the root mycorrhizal colonization rate. A total of 11 saturated fatty acids and 12 unsaturated fatty acids were detected from the seeds, with the unsaturated fatty acids consisting primarily of C18:1N-12, C18:1N-9C, and C18:2-N6. Spraying exogenous EG significantly increased the levels of major unsaturated fatty acid components such as C18:1N-12, C18:1N-9C, C18:1N-7, and C18:2N-6 by 140.6%, 59.7%, 97.6%, and 60.6%, respectively, while decreasing the level of C16:0. Inoculation with R. intraradices only decreased the levels of C16:0 and C18:0, while increased the level of C18:2N-6. Both treatments increased the percentage of unsaturated fatty acids in total fatty acids, resulting in an increase in the unsaturation index of fatty acids. In addition, inoculation with R. intraradices significantly up-regulated the expression of CoFAD2, spraying exogenous EG significantly increased the expression of CoSAD, CoFAD2, and CoFAD3, and both treatments also significantly suppressed the expression of CoFAE. These findings suggested that exogenous EG as a biostimulant, is more suitable to regulate the nutritional values of fatty acids in seeds of 20-year-old C. oleifera.

1. Introduction

Arbuscular mycorrhizal (AM) fungi have been associated with most land plants since their evolution in the Devonian period (398 million years ago), and the two establish a symbiotic relationship based on nutrient exchange [1]. AM fungi can improve the host plant’s physiological activity, thereby impacting crop quality and yield [2]. AM fungi also interact with other soil microorganisms that undertake essential ecosystem functions, such as organic nutrient mineralization and soil organic matter stability [3,4]. AM fungi colonize the roots of host plants and generate developed extraradical hyphae to enhance and increase host plant resilience to environmental stresses, such as heavy metals [5], salinity [6], low temperatures [7], and drought [8]. The inoculation of sunflowers with a mixture of Glomus species resulted in a significant increase in oleic acid (7.2%) and linoleic acid (19.8%) levels [9]. Under soil water deficit conditions, inoculation with Funneliformis mosseae distinctly regulated the composition of fatty acids in trifoliate orange, resulting in an increase in the unsaturation index of fatty acids, which provided low oxidative damage to inoculated plants [8]. These results illustrate that arbuscular mycorrhizae can alter the composition of host fatty acids, providing a pathway for the production of oilseed crops. However, there are no reports to reveal whether and how AM fungi regulate fatty acid levels in oilseed crops, despite the fact that AM fungi could improve the plant growth of Camellia oleifera [10].

Glomalin-related soil protein (GRSP) is a glycoprotein secreted into the soil by AM fungi and is thought to be a component of AM fungi that helps host plant function [11]. GRSP has received much attention due to its abundance of functional groups, recalcitrance, and long turnover time, which stimulates soil microbial activity, improves soil structure and fertility, sequesters soil heavy metals, improves soil moisture, and so on [11,12,13]. GRSP is divided into two components: easily extractable glomalin-related soil protein (EG), an active but unstable GRSP component; and difficultly extractable glomalin-associated soil protein (DG), an inactive but stable GRSP component [11]. It has been shown that the application of exogenous EG significantly enhanced plant growth behavior and improved fruit quality and soil properties in various citrus plants [14,15]. Exogenous EG caused a differential response in trifoliate orange growth by modulating the expression of auxin-associated genes [16]. As a consequence, EG is considered a biostimulant, while it is not known whether EG can influence the fatty acid composition of oilseed trees.

Camellia oleifera Abel. is a woody oilseed tree with a high oil content, which is a high-quality source of unsaturated fatty acids [17,18]. The seed oils of C. oleifera have been used in cooking oils, cosmetics, the washing industry, and the medicine industry. In industry, the fruit shell of C. oleifera can be used to produce high-quality activated carbon and electrodes [19]. C. oleifera is mainly planted in the mountainous areas of China and does not compete with other crops for land. The oil is extracted from C. oleifera’s seeds and is considered a product with high nutritional value due to its fatty acid composition and the presence of bioactive compounds [20]. Zhou et al. [21] analyzed how different fertilization formulas affected oil quality in seeds of C. oleifera. They found that the improved effect on unsaturated fatty acids (UFAs) was slow-release fertilizer > organic fertilizer > fertilization depth > compound fertilizer in decreasing order. It has been found that the AM fungal population in the rhizosphere of field C. oleifera was very rich [17], and inoculation with AM fungi promoted plant growth and P acquisition of C. oleifera [22]. There is no report that clarifies the ability of AM fungi and EG treatments to affect seed fatty acid profiles of C. oleifera in the field, which is crucial for their later application in C. oleifera. The objective of this study was to analyze the effects of field inoculation with AM fungi and foliar spraying of EG on fatty acids and fatty acid-associated gene expression in C. oleifera’s seeds.

2. Materials and Methods

2.1. Preparation of Exogenous EG and AM Fungal Agents

Soil samples were collected from the orchard of Yangtze University, air-dried, passed through a 4 mm nylon sieve, and extracted with 20 mmol/L citrate buffer (pH 7.0) at a ratio of 1:8 (m:v) for 30 min at 121 °C and 0.11 MPa, followed by centrifugation at 10,000× g/min for 5 min. The supernatant was collected as an exogenous EG solution, and the protein of the EG solution was determined by the Braford [23] assay, which was 26.25 mg protein/L. The collected EG solution was diluted 1-fold with an equal amount of 20 mmol/L citrate buffer (pH 7.0) before use, based on the results of Liu et al. [15].

The AM fungal agent used in the experiment was Rhizophagus intraradices (R.i.), which was shown to have a positive effect on C. oleifera [22]. The AM fungus was provided by the Institute of Root Biology, Yangtze University. This fungus was trapped by white clover (Trifolium repens L.) in potted conditions for 12 weeks, and then the aboveground part was removed and the belowground part and the growth substrate were mixed well, air-dried, and stored at 4 °C. Before use, it contained 11 spores/g.

2.2. Experimental Set-Up and Design

On 3 March 2021, eight twenty-year-old C. oleifera trees (Elin 151) were selected for inoculation with AM fungus (R.i.) in the Forestry Science and Technology Demonstration Park (114°15′39″ E, 30°18′40″ N), Jiangxia, Wuhan, Hubei, China. The walnut orchard has a row spacing of 2 m × 3 m. Two trenches were made in the east-west direction of the tree crown, with 800 g of R.i. agents evenly distributed between them.

On 15 April 2021, an additional eight C. oleifera trees were chosen at the same place, and their leaves and fruits were sprayed with exogenous EG (2.5 L/tree). The exogenous EG was applied at one-week intervals and sprayed four times.

The experiment consisted of three treatments: inoculation with AM fungus (R.i.), spraying with EG (EG), and a control without any additional treatment (Control). Each treatment was replicated four times, for a total of 24 trees (two trees/replicate). The fruits (including seeds) and roots were collected on 30 October 2021.

2.3. Determinations of Variables

The longitudinal and transverse diameters of collected fruits were measured with vernier calipers (Guilin Guanglu Measuring Instrument Co., Ltd., Guilin, China). Fruit and seed weights were weighed, and the quantity of seeds per fruit was manually counted.

The mycorrhizae of the root segments collected were stained using the method outlined by Phillips and Hayman [24]. The root segments were incubated in 10% KOH solutions at 95 °C for 3 d until transparent and then bleached in 10% H₂O₂ for 15 min, acidified in 0.2 mol/L HCl for 15 min, and stained in 0.05% of trypan blue solutions at room temperature for 5 min. The root AM colonization rate was the ratio of AM root lengths versus total root lengths.

The fatty acids of the seeds were determined by the method of Hoving et al. [25]. A total of 50 mg seed samples was combined with 1 mL of a chloroform–methanol (2:1) solution and 100 mg of glass beads. The mixture was shaken in a high-throughput tissue grinder at 60 Hz for 1 min, repeated twice, sonicated at room temperature for 30 min, and centrifuged at 12,000× g/min at 4 °C for 5 min. All of the supernatant was transferred to a 15 mL centrifuge tube, where 2 mL of 1% sulfuric acid–methanol solution (the ratio of sulfuric acid to methanol was 1:99 v/v; pure sulfuric acid was 95–98%, and chromatographic grade methanol was 99.9%) was added, mixed thoroughly, shaken for 1 min, and esterified in an 80 °C water bath for 30 min. After removal and cooling, the supernatant was extracted with 1 mL of n-hexane, washed with 5 mL of ddH₂O, and centrifuged at 3500× g/min at 4 °C for 10 min. To remove excess water, 700 μL of the supernatant was incubated with 100 mg of anhydrous sodium sulfate powder for 30 s before centrifugation at 12,000× g/min for 5 min. The supernatant was diluted 40-fold with n-hexane. Subsequently, 300 μL of diluted sample solution was combined with 15 μL of 500 mg/L methyl salicylate as an internal standard into a 2 mL centrifuge tube and shaken for 10 s for the assay. The several fatty acid levels were determined using a Gas Chromatograph-Mass Spectrometer (GC-MS) (Thermo Fisher Scientific Inc., Waltham, MA, USA) with a Thermo TG-FAME capillary column (50 m × 0.25 mm, 0.20 μm), an injection volume of 1 μL, and a split ratio of 8:1. The temperature of the injection port was 250 °C, the temperature of the ion source was 300 °C, and the temperature of the transmission line was 280 °C. The starting temperature was 80 °C for 1 min, and then increased to 160 °C at 20 °C/min and held for 1.5 min. This temperature was increased to 196 °C at 3 °C/min for 8.5 min and to 250 °C at 20 °C min for 3 min. The carrier gas was helium, with a flow rate of 0.63 mL/min. The conditions of mass spectrometry were as follows: an electron bombardment ionization (EI) source; SIM scanning mode with an electron energy of 70 eV; and an electron energy of 70%. A total of 51 kinds of esterified fatty acids solutions (Suzhou Panomike Biomedical Technology Co., Ltd., Suzhou, China) were prepared with n-hexane to 0.5−2000 μg/mL as the standard curve for the assay.

According to the conserved regions of the existing ∆9 stearoyl-ACP desaturase (SAD) and fatty acid desaturase 2 (FAD2) gene sequences (KJ995982.1; KJ995981.1) and the FAD3 and fatty acid prolongase (FAE) genes reported by Guo et al. [26], Primer Premier 5 was used to design their primer sequences, as shown in

Table 1. Specific primer sequences for selected genes for qRT-PCR.

Genes	Forward Sequence (5′→3′)	Reverse Sequence (5′→3′)
CoSAD	TCTCGCACGGGAACACAG	ATCAAGTGGGCTGGCATAGA
CoFAD2	ACACTCATCCTGCTCTGCCT	CTCTTGCCTCCCTCCACATC
CoFAD3	GCCAAAAAAATCGGGTC	ATCGCAAAGAATCACTCC
CoFAE	GACACTTCTGGTGTTCCTATCC	TGACGAGCATCTTCTGGTITAT
EF-1α	CAAAGAAGGGTGCCAAGTGA	ACCAAACAACCGACCTACGA

. The total RNA of seeds was extracted using a rapid extraction kit (Vazyme Biotech Co., Ltd., Nanjing, China). Following the verification of RNA quality and concentration, the RNA was reverse-transcribed into cDNA using the Vazyme kit (Vazyme Biotech Co., Ltd., Nanjing, China). The quantitative analysis was performed by real-time fluorescence quantification system (Bio-Rad Laboratories, Hercules, CA, USA). The amplification program was as follows: 95 °C, 30 s; 95 °C, 10 s, 60 °C, 30 s, 95 °C, 15 s; and 60 °C, 60 s, 95 °C, 15 s. A total of forty cycles were performed. All operations followed the user’s instructions, and quantitative data were calculated with reference to the 2^−∆∆Ct method of Livak and Schmittgen [27]. The EF-1α was considered as the internal reference with reference to Zhao et al. [28].

2.4. Statistical Analysis

The analysis of variance (ANOVA) process of SAS software (v8.1) was used to test the differences between the treatments. In order to carry out multiple comparative analyses, Duncan’s new complex range test was used (p < 0.05). Sigmaplot software (v10.0) was used to visualize the results. Correlation heatmaps were generated using Origin 2022.

3. Results

3.1. Changes in Root AM Fungal Colonization Rate

AM fungal colonization was clearly visible in the roots of C. oleifera (Figure 1a). The root mycorrhizal colonization rate of C. oleifera, without any treatment, was 8.65 ± 1.00% (Figure 1b). Nevertheless, exogenous EG treatment did not significantly increase the root mycorrhizal colonization rate compared with the Control treatment, and the R.i. inoculation significantly increased the root mycorrhizal colonization rate by 148.67%.

3.2. Changes in Fruit Traits

Both inoculation with AM fungi and spraying EG altered fruit-related traits to different degrees (Figure 2;

Table 2. Effects of inoculation with AM fungi and spraying with EG on fruit traits of Camellia oleifera.

Treatments	Fruit Transverse Diameter (mm)	Fruit Longitudinal Diameter (mm)	Single Fruit Weight (g)	Number of Seeds per Fruit	Seed Weight (g)
Control	38.8 ± 2.3 b	38.0 ± 2.2 b	32.9 ± 3.2 b	4.2 ± 0.4 b	14.3 ± 1.9 b
R.i.	36.1 ± 1.1 b	40.3 ± 2.3 ab	33.2 ± 3.1 b	4.3 ± 1.0 b	15.2 ± 2.2 ab
EG	41.9 ± 2.9 a	41.2 ± 1.8 a	38.8 ± 3.8 a	5.5 ± 1.0 a	18.1 ± 2.9 a

Note: Data in the same column followed by different letters indicate significant (p < 0.05) differences. Abbreviations: EG, easily extractable glomalin-related soil protein; R.i., Rhizophagus intraradices; Control, no treatment. The same below.

). Spraying EG treatment significantly increased fruit transverse diameter, longitudinal diameter, single fruit weight, number of seeds, and seed weight by 8.0%, 8.4%, 18.0%, 31.0%, and 26.6%, respectively, as compared to the Control, whereas inoculation with R.i. did not significantly affect these fruit trait variables.

3.3. Changes in Saturated Fatty Acid Levels of Seeds

To thoroughly detect fatty acid groups in seeds of C. oleifera by GC-MS, 17 saturated fatty acids (SFAs) and 34 unsaturated fatty acids (UFAs) were chromatographed (Supplementary Material Figure S1). The serial concentrations of fatty acid standards were analyzed by GC-MS, followed by the qualification of QC (Supplementary Material Figure S2). The linearity was examined with the concentration of the standards as the horizontal coordinate and the ratio of the peak areas of the standards to that of the internal standard as the vertical coordinate. The linear regression equations of each substance are shown in Supplementary Material Table S1, where the correlation coefficients are r > 0.99. However, only 23 fatty acids (11 SFAs and 12 UFAs) were detected in the seeds (

Table 3. Effects of inoculation with AM fungi and spraying with easily extractable glomalin-related soil protein (EG) on saturated fatty acid (SFA) levels in seeds of Camellia oleifera.

Abbreviations	SFAs	Treatments (μg/g FW)
		Control	R.i.	EG
C11:0	Undecanoic acid	2.00 ± 0.25 a	0.71 ± 0.25 b	1.07 ± 0.08 b
C13:0	Tridecanoic acid	0.21 ± 0.03 ab	0.24 ± 0.03 a	0.16 ± 0.01 b
C14:0	Myristic acid	14.56 ± 4.88 a	13.18 ± 2.47 a	17.48 ± 0.20 a
C15:0	Pentadecanoic acid	9.94 ± 0.45 a	7.14 ± 0.67 b	7.22 ± 0.79 b
C16:0	Palmitic acid	3368.01 ± 231.68 a	2540.19 ± 184.04 b	2626.22 ± 487.65 b
C17:0	Heptadecanoic acid	23.42 ± 6.28 a	28.17 ± 5.48 a	28.83 ± 2.33 a
C18:0	Stearic acid	639.40 ± 46.61 a	510.75 ± 84.13 b	586.19 ± 65.06 ab
C20:0	Arachidic acid	9.42 ± 1.81 a	8.54 ± 2.97 a	11.42 ± 0.57 a
C22:0	Behenic acid	0.52 ± 0.15 a	0.49 ± 0.13 a	0.65 ± 0.07 a
C23:0	Tricosanoic acid	0.64 ± 0.04 a	0.46 ± 0.03 b	0.58 ± 0.08 ab
C24:0	Lignoceric acid	6.89 ± 0.83 b	5.77 ± 0.81 b	9.16 ± 0.30 a

Note: Data in the same line followed by different letters indicate significant (p < 0.05) differences.

and Table 4), and the other 28 fatty acids included C6:0, C8:0, C10:0, C12:0, C14:1, C15:1T, C15:1, C16:1T, C16:1, C17:1T, C17:1, C18:1N-12T, C18:1N-9T, C18:1N-7T, C19:1N-12T, C19:1N-9T, C18:3N-6, C20:1T, C21:0, C20:3N-6, C22:1N-9T, C22:1N-9, C20:3N-3, C20:4N-6, C20:5N-3, C24:1, C22:4, and C22:5N-6 were not detected (Supplementary Material Figure S3). In seeds, the highest levels of C16:0 were found in SFAs, followed by C18:0 and C17:0 (Table 3). Compared with the Control treatment, inoculation with R.i. significantly reduced the levels of C11:0, C15:0, C16:0, C18:0, and C23:0 in seeds by 64.5%, 28.2%, 24.6%, 20.1%, and 28.1%, respectively, and spraying of EG significantly reduced the levels of C11:0, C15:0, and C16:0 by 46.5%, 27.4%, and 22.0%, respectively, along with a significant increase in C24:0 levels (33.0%), after spraying of EG. Compared to R.i. inoculation, exogenous EG treatment significantly decreased the level of C13:0 (33.3%) but increased the level of C24:0 (58.8%).

3.4. Changes in Unsaturated Fatty Acid Levels of Seeds

C18:1N-9C had the greatest amount of any of the 12 UFA components, followed by C18:1N-12, C18:2N-6, C18:1N-7, and C14:1T in decreasing order (Table 4). Inoculation with R.i. significantly increased the C18:2N-6 level by 40.6% but decreased the C20:1 level by 64.3%, coupled with no significant change in other UFA components, compared with the Control treatment. Compared to the Control treatment, spraying EG significantly increased C18:1N-12, C18:1N-9C, C18:1N-7, C18:2N-6, and C22:5N-3 levels by 140.6%, 59.7%, 97.6%, 60.6%, and 30.9%, respectively, whereas significantly decreased C20:1 and C22:2 levels by 58.0% and 32.4%, respectively. Compared with the R.i. inoculation, exogenous EG treatment significantly increased the C18:1N-12 level by 53.3% but significantly decreased the C22:6N-3 level by 52.5%. In addition, the proportion of UFAs to total fatty acids was 81.1% in the Control treatment but increased to 87.2% and 89.9% after R.i. inoculation and exogenous EG spraying, respectively.

Table 4. Effects of inoculation with AM fungi and spraying with easily extractable glomalin-related soil protein (EG) on unsaturated fatty acid (UFA) levels in seeds of Camellia oleifera.

Abbreviations	UFAs	Treatments (μg/g FW)
		Control	R.i.	EG
C14:1T	Myristelaidic acid	117.79 ± 22.4 a	78.70 ± 8.36 a	119.74 ± 25.71 a
C18:1N-12	Petroselinic acid	1972.84 ± 317.9 b	3095.92 ± 465.14 b	4746.35 ± 721.01 a
C18:1N-9C	Oleic acid	14208.79 ± 3227.01 b	16614.00 ± 1566.81 ab	22698.45 ± 4917.37 a
C18:1N-7	Vaccenic acid	143.04 ± 47.17 b	224.50 ± 39.65 ab	282.61 ± 48.96 a
C18:2N-6T	Linolelaidic acid	9.58 ± 1.63 a	7.33 ± 3.88 a	11.24 ± 0.66 a
C18:2N-6	Linoleic acid	836.34 ± 76.41 b	1176.02 ± 168.62 a	1343.04 ± 121.87 a
C20:1	11-Eicosenoic acid	20.13 ± 2.17 a	7.18 ± 0.88 b	8.45 ± 1.62 b
C18:3N-3	Alpha linolenic aicd	87.10 ± 11.78 a	85.67 ± 16.55 a	94.43 ± 19.60 a
C20:2	11-14 Eicosadienoic acid	4.17 ± 2.33 a	4.43 ± 3.50 a	5.52 ± 0.69 a
C22:2	Docosadienoic aicd	1.06 ± 0.38 a	0.67 ± 0.16 ab	0.43 ± 0.06 b
C22:5N-3	Docosapentaenoic acid	2.49 ± 0.29 b	2.74 ± 0.39 ab	3.26 ± 0.22 a
C22:6N-3	Docosahexaenoic aicd	2.16 ± 0.89 ab	2.99 ± 0.62 a	1.42 ± 0.30 b
UFAs/total fatty acids		81.1%	87.2%	89.9%

Note: Data in the same line followed by different letters indicate significant (p < 0.05) differences.

Table 4. Effects of inoculation with AM fungi and spraying with easily extractable glomalin-related soil protein (EG) on unsaturated fatty acid (UFA) levels in seeds of Camellia oleifera.

Abbreviations	UFAs	Treatments (μg/g FW)
		Control	R.i.	EG
C14:1T	Myristelaidic acid	117.79 ± 22.4 a	78.70 ± 8.36 a	119.74 ± 25.71 a
C18:1N-12	Petroselinic acid	1972.84 ± 317.9 b	3095.92 ± 465.14 b	4746.35 ± 721.01 a
C18:1N-9C	Oleic acid	14208.79 ± 3227.01 b	16614.00 ± 1566.81 ab	22698.45 ± 4917.37 a
C18:1N-7	Vaccenic acid	143.04 ± 47.17 b	224.50 ± 39.65 ab	282.61 ± 48.96 a
C18:2N-6T	Linolelaidic acid	9.58 ± 1.63 a	7.33 ± 3.88 a	11.24 ± 0.66 a
C18:2N-6	Linoleic acid	836.34 ± 76.41 b	1176.02 ± 168.62 a	1343.04 ± 121.87 a
C20:1	11-Eicosenoic acid	20.13 ± 2.17 a	7.18 ± 0.88 b	8.45 ± 1.62 b
C18:3N-3	Alpha linolenic aicd	87.10 ± 11.78 a	85.67 ± 16.55 a	94.43 ± 19.60 a
C20:2	11-14 Eicosadienoic acid	4.17 ± 2.33 a	4.43 ± 3.50 a	5.52 ± 0.69 a
C22:2	Docosadienoic aicd	1.06 ± 0.38 a	0.67 ± 0.16 ab	0.43 ± 0.06 b
C22:5N-3	Docosapentaenoic acid	2.49 ± 0.29 b	2.74 ± 0.39 ab	3.26 ± 0.22 a
C22:6N-3	Docosahexaenoic aicd	2.16 ± 0.89 ab	2.99 ± 0.62 a	1.42 ± 0.30 b
UFAs/total fatty acids		81.1%	87.2%	89.9%

Note: Data in the same line followed by different letters indicate significant (p < 0.05) differences.

3.5. Changes in Unsaturated Index of Fatty Acids and Fatty Acid-Associated Gene Expression in Seeds

Spraying EG and inoculation with R.i. significantly increased the fatty acid unsaturation index of seeds by 109.61% and 60.00%, respectively, compared with the Control treatment (Figure 3a). There were no significant differences between the two treatments. In addition, inoculation with R.i. significantly up-regulated the expression of the CoFAD2 gene (4.6 folds) but suppressed the expression of the CoFAE gene (2.0 folds), with no effect on the expression of the CoSAD and CoFAD3 genes, compared with the Control treatment (Figure 3b). Spraying EG treatment significantly up-regulated the expression of CoSAD, CoFAD2, and CoFAD3 by 3.9-, 6.8-, and 3.9-fold, respectively, but reduced the expression of CoFAE by 17.9-fold, compared with the Control treatment.

3.6. Correlationship Studies

The C18:1N-9C levels in seeds showed a significant and positive correlation with CoSAD expression levels (Figure 4). The C18:2N-6 levels were significantly and positively correlated with CoSAD, CoFAD2, and CoFAD3 expression levels, and negatively correlated with CoFAE expression levels. The C20:1 levels were significantly and positively correlated with CoFAE expression levels, while negatively correlated with CoFAD2 expression levels.

4. Discussion

The present study showed that spraying EG treatment substantially boosted fruit growth, alongside enhancing the number and weight of the seeds in C. oleifera, which is in concordance with the results elucidated by Liu et al. [15] and Meng et al. [14] in citrus. Moreover, exogenous EG application did not significantly affect root AM fungal colonization. This implied that the effect of EG was due to EG itself, rather than a shift in root AM fungal colonization rate. Such a result was attributable to the fact that EG is rich in elements favorable for fruit growth, such as potassium, calcium, and silica [14]. It may also be because GRSP has a similar humic acid structure that promotes plant growth. Liu et al. [16] also reported that exogenous EG application promoted the levels of auxins and cytokinins in host plants, thereby regulating host growth. The ability of AM fungi to improve plant yield and quality has been demonstrated in crops, like sorghum [29], rice [30], and peanut [31]. Nevertheless, in this study, inoculation with R.i. did not have a significant effect on fruit traits, which may be attributed to the age of the selected C. oleifera plants, the mycorrhizal specific association with host plants, and inoculation time of the AM fungus used [32].

The composition of fatty acids in seeds of C. oleifera is crucial for their nutritional value [33]. Among fatty acids, the conversion of SFAs to UFAs plays an important role in the physiological function of cells and the quality of seed oils in C. oleifera [8]. Based on the GC-MS data, a total of 23 FAs, including 11 SFAs and 12 UFAs, were detected in seeds of C. oleifera. Here, palmitic acid (C16:0) and stearic acid (C18:0) made up the majority of SFAs, accounting for more than 97% of SFAs. The levels of the two were reduced after inoculation with R.i. and spraying with exogenous EG. This is in line with earlier findings on citrus [8] and soybean [34] inoculated with AM fungi. Xia et al. [35] showed that lower SFAs, palmitic acid, and stearic acid levels in seeds indicated higher quality of seed oils in C. oleifera. The present study showed that inoculation with R.i. and exogenous spraying of EG had a significant effect on decreasing major SFA component levels in seeds, indicating a positive effect on the balance of fatty acid composition and nutritional value.

On the other hand, UFAs in seeds are of great significance, and the increase in UFAs content in oilseed crops directly improves the quality and shelf life of the seed oil [36]. UIFA reflects the fluidity of biological membranes and is an important indicator of the oil quality of C. oleifera [37]. In the present study, UFAs were increased in total fatty acids by both R.i. inoculation and exogenous EG treatments, with the exogenous EG treatment showing a more significant increase in the level of oleic acid (C18:1N-9C) and linoleic acid (C18:2N-6). This is in line with Seyed Sharifi [38] who found that biofertilizers significantly increased the levels of UFAs (e.g., linoleic, linolenic, and oleic acids) in soybean. Oleic acid is a monounsaturated fatty acid, whereas linoleic (C18:2N-6) and linolenic acids (C18:3N-3) are polyunsaturated fatty acids that cannot be synthesized by the human body itself and need to be ingested externally [33]. Linoleic acid has anticancer, antioxidant, and fat accumulation-inhibiting effects, while linolenic acid has hypolipidemic, hypotensive, and anticancer effects [39]. The increase in UFAs and UIFA after inoculation with AM fungi and spraying with exogenous EG may contribute to increased availability of nutrients and improved supply of lipid metabolism, especially phosphorus, which provides essential ATP and NADPH for the biosynthesis pathway of FAs [36,40]. In this experiment, the proportion of UFAs in total fatty acids in seeds of C. oleifera increased from 81.1% (Control) to 87.2% and 89.9% following inoculation with R.i. and spraying with EG, respectively. The increase in AM fungus-inoculated seedlings was attributed to a decrease in SFAs (especially palmitic and stearic acids) and an increase in UFAs (mainly oleic, linoleic, and linolenic acids) [8]. This is consistent with the findings of Gholinezhad and Darvishzadeh [41] who inoculated sesame plants with Funneliformis mosseae and Rhizophagus irregularis. The results showed that the treatments in this experiment helped to increase UFAs and UIFA in seeds of C. oleifera. The conversion pattern of major fatty acids in seeds of C. oleifera is shown in Figure 5 [42]. The composition and unsaturation of fatty acids in plant tissues significantly affect cell membrane lipid mobility, and their saturation is mainly regulated by the expression of fatty acid desaturase genes [8].

SAD mediates the conversion of stearic acid into oleic acid [8,43], thereby modulating UFA levels beyond the C18 threshold, as well as the balance between SFAs and UFAs within oil compositions [42]. The present study demonstrated that spraying exogenous EG, but not R.i. inoculation, significantly increased CoSAD expression, resulting in a significant increase in the levels of C18:1N-12, C18:1N-9C, and C18:1N-7 in EG-treated plants, but not in R.i.-inoculated plants. The FAE genes are responsible for the synthesis of ultra-long-chain fatty acids, which govern the conversion of oleic acid (C18:1N9C) to eicosapentaenoic acid (C22:5N-3) [44]. The FAD2 gene mainly regulates the desaturation of oleic acid (C18:1N-9C) to generate linoleic acid (C18:2N-6) [45]. The results of this experiment showed that the expression of the CoFAE gene was significantly down-regulated after inoculation with R.i. and spraying with exogenous EG, implying that the level of arachidonic acid (C20:2) was reduced and C18:1 was converted more to linoleic acid (C18:2N-6). Our findings also revealed that the expression of the CoFAD2 gene was up-regulated after inoculation with R.i. and spraying with exogenous EG, resulting in a significant rise in C18:2N-6 levels in EG-treated plants (Figure 5). This experiment showed that inoculation of R.i. and spraying of exogenous EG on C. oleifera also positively regulated the expression of CoFAD2, resulting in an increase in linoleic acid content, which is in agreement with the findings obtained by Wu et al. [8] on citrus inoculated with AM fungi.

FAD3 is a crucial gene that regulates the formation of linoleic acid (C18:2N-6) from linolenic acid (C18:3N-3) [42]. This study showed that spraying EG, rather than inoculating with R.i., significantly up-regulated CoFAD3 expression, but the level of C18:3N-3 did not change significantly. The alternation could be explained by the fact that the conversion of C18:2 to C18:3 is controlled by multiple genes (e.g., FAD3, FAD7, and FAD8) (Figure 5) [46]. Overall, the fatty acid accumulation characteristics of EG-treated C. oleifera plants corresponded to the expression of key enzyme genes controlling their transformation [47]. As a result, spraying EG as a biostimulator could modulate the fatty acid profile in seeds of C. oleifera for better UIFA and UFA components. Future studies will be required to clarify how EG and AM fungi regulate fatty acid conversion and whether this regulatory effect also occurs in later years.

5. Conclusions

In this study, the EG treatment improved fruit traits in C. oleifera plants. AM fungi and EG treatment increased major unsaturated fatty acid levels of seeds, with spraying exogenous EG having a greater effect than inoculation with AM fungi. A schematic diagram of the regulation of fatty acid transformation under EG treatment conditions is presented in Figure 5. Thus, spraying EG as a biostimulant provides a beneficial nutritional value of seed oil fatty acid profile in C. oleifera. However, the intrinsic molecular mechanisms, as well as several consecutive EG observation experiments have yet to be investigated.