Next Article in Journal
PhSPEAR1 Participates in Regulating the Branch Development of Petunia
Previous Article in Journal
Effect of Biochar Amendment and Organic Fertilization on the Yield and Nutritional Quality of Artichoke (Cynara cardunculus L.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 9
10.3390/horticulturae10090911
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of the Class III Peroxidase Gene Family in Ginger and Expression Analysis under High Temperature and Intense Light Stress

by
Min Gong
1,2,
Yajun Jiang
3,
Shihao Tang
1,
Haitao Xing
1,
Hui Li
1,2,
Jiajia Gu
1,
Minmin Mao
1,
Wei Wang
4,
Maoqin Xia
1,* and
Hong-Lei Li
1,3,*
1
Chongqing Engineering Research Center for Horticultural Plant, College of Smart Agriculture, Chongqing University of Arts and Sciences, Chongqing 402160, China
2
College of Biology and Food Engineering, Chongqing Three Gorges University, Chongqing 404020, China
3
Chongqing Key Laboratory for Germplasm Innovation of Special Aromatic Spice Plants, College of Smart Agriculture, Chongqing University of Arts and Sciences, Chongqing 402160, China
4
State Key Laboratory of Plant Diversity and Specialty Crops, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China
*
Authors to whom correspondence should be addressed.
Horticulturae 2024, 10(9), 911; https://doi.org/10.3390/horticulturae10090911
Submission received: 26 June 2024 / Revised: 21 August 2024 / Accepted: 24 August 2024 / Published: 27 August 2024
(This article belongs to the Section Medicinals, Herbs, and Specialty Crops)
Browse Figures
Versions Notes

Abstract

:
Ginger, valued for its medicinal properties and economic significance, is vulnerable to environmental stressors such as intense light and high temperatures, which can hinder its growth and development. Class III peroxidases (PRXs) are plant-specific oxidoreductases essential for plant development, growth, and stress responses. Despite their importance, there is limited information available on the function of the class III peroxidase gene family in ginger (ZoPRX). In this study, 103 ZoPRX members within the ginger genome were identified, unevenly distributed across 11 chromosomes. The identified ZoPRX members were categorized into five subfamilies based on gene structures, protein motifs, and phylogenetic analysis. Gene duplication analysis revealed that ZoPRX has primarily undergone segmental duplication. Interspecies homology analysis between ginger and Arabidopsis thaliana, Oryza sativa, and Musa acuminata suggested most ZoPRXs in ginger originated after the divergence of dicotyledon and monocotyledon. Analysis of promoter cis-acting elements identified defense and stress response elements in 39 genes and hormone response elements in 95 genes, indicating their potential roles in responding to environmental stresses. Quantitative Real-Time PCR (qRT-PCR) analysis confirmed that the majority of ZoPRX members are responsive to high temperature and intense light stress. This study provides a comprehensive understanding of the PRX family in ginger, thereby laying the groundwork for future investigations into the functional role of ZoPRX genes under high-temperature and intense light-stress conditions.

1. Introduction

Due to global warming, significant challenges are posed to agricultural production [1]. Throughout their growth and development, plants frequently encounter various adverse environmental conditions [2]. Temperature and light are pivotal elements influencing plant yield [3,4]. Excessive heat stress may trigger the accumulation of ROS, which could decrease enzyme activity, disrupt metabolic processes, lead to cell mortality, lower the rate of photosynthesis, and ultimately reduce both crop yield and the quality of the produce [5]. High temperatures frequently occur in conjunction with intense light, presenting a confluence of stresses that profoundly impede plant physiological processes. Studies have demonstrated that the concurrent stresses of elevated temperatures and intense light exposure have a more pronounced detrimental effect on plant health than the impact of high temperatures or intense light in isolation [6]. To counteract ROS-induced damage, plants have established a sophisticated system to maintain ROS homeostasis [7]. This system primarily involves scavenging free radicals through endogenous antioxidant enzymes such as glutathione peroxidase (GPX), ascorbate peroxidase (APX), catalase (CAT), and superoxide dismutase (SOD) [8,9,10].
Within this antioxidant defense matrix, peroxidases (PRXs) play a critical role, which merits a closer examination. PRXs have been documented to protect cells from ROS by catalyzing reduction reactions. These enzymes constitute a large family found across numerous organisms [11,12,13]. Based on differences in their primary protein structures, PRXs are divided into three classes: Class I PRXs are present in a wide array of organisms, including plants, fungi, bacteria, and protozoa. Class II PRXs are specific to fungi, while Class III PRXs (EC 1.11.1.7) are unique to plants [14,15,16]. In their conventional peroxidative cycle, Class III plant peroxidases reduce H2O2 by transferring electrons to various donor molecules such as phenolic compounds, lignin precursors, auxin, or secondary metabolites [17,18]. While several abbreviations exist for Class III peroxidases, the term PRX is utilized in this context to maintain consistency with the terminology established in the well-recognized peroxidase database [19].
The functionality of PRXs extends beyond simple reduction as they are also integral to the plant’s broader stress response strategy. PRXs play numerous beneficial roles in helping plants cope with both biotic and abiotic stresses. They primarily participate in the peroxidative and hydroxylation cycles, reducing hydrogen peroxide production and the formation of ROS. Their capacity to diminish ROS concentrations renders them a crucial element of the antioxidant defense mechanism against both biotic and abiotic stressors. Various signaling pathways, mediated by H2O2 and involving stress hormones like salicylic acid, jasmonic acid and ethylene, detect H2O2 produced by cellular processes or in response to abiotic stress, subsequently triggering the activation of class III peroxidases [20]. PRXs are crucial for responding to various stress factors. For example, studies on sugarcane have shown that Class III PRX family genes can enhance tolerance to cadmium (Cd) and salt stresses by activating the antioxidant system and scavenging ROS [21]. Overexpression of AtPRX64 in Arabidopsis thaliana has been found to increase aluminum stress tolerance in transgenic tobacco plants [22]. In rice, overexpression of OsPRX30 helps maintain high levels of PRX activity and reduces H2O2 content, thereby increasing the plant’s tolerance to Xanthomonas oryzae pv. oryzae (Xoo) [23]. In Solanum lycopersicum, PRX inhibits Ep5C expression and reduces susceptibility to bacterial spot caused by Pseudomonas syringae infestation [24].
While PRXs have been extensively studied in various species, their characterization in ginger remains an untapped area of research. To date, whole-genome analyses have characterized PRX family members in various plants, identifying 73 PRXs in Arabidopsis thaliana [25,26,27], 138 PRXs in Oryza sativa [28], 119 PRXs in Zea mays [29], and 94 PRXs in Pyrus bretschneideri [30]. Ginger (Zingiber officinale Roscoe) is a perennial herb that belongs to the genus Zingiber in the Zingiberaceae family, valued for its medicinal and culinary uses of its rhizomes. The suitability of ginger for cultivation stems from its high yield per unit area and substantial economic benefits, making it a crop of significant economic importance [31]. However, adverse environmental conditions such as high temperatures and droughts negatively impact the growth and development of ginger, resulting in reduced yields and quality [31,32,33]. Despite the crucial role of PRXs in various abiotic stresses, there have not yet been any reports documenting the existence of PRX gene family members in ginger.
In our previous study, the sequencing and assembly of the ginger genome were successfully completed, establishing a foundation for a comprehensive analysis of the PRX gene family in ginger [34]. This study aims to systematically identify and characterize the PRX genes within the ginger genome, representing the first detailed investigation of this gene family in ginger. The key objectives are to catalog the PRX gene family members, examine their structural features, and assess their expression profiles under heat stress conditions. By applying advanced bioinformatics tools, we intend to elucidate the functional roles of ZoPRXs in ginger’s abiotic stress tolerance.

2. Materials and Methods

2.1. Plant Materials

In this study, a locally cultivated ginger variety, Z. officinale cv. southwest, sourced from Chongqing University of Arts and Sciences, China, was utilized as our experimental material. The ginger was planted in 10 pots (50 cm × 21 cm × 25 cm) filled with sterilized soil and incubated in the greenhouse at Chongqing University of Arts and Sciences starting on 15 May 2022. The cultivation conditions were maintained at a temperature of 25 °C, 75% humidity, a light intensity of 16,000 lux, and a photoperiod consisting of 14 h of light (from 6 am to 8 pm) followed by 10 h of darkness. After a 60-day incubation period, the ginger plants were transferred outdoors, subjected to natural climatic conditions with temperatures ranging from 31 °C to 41 °C. Over a span of four days, the plants endured temperatures soaring above 40 °C and light intensities reaching up to 103,833 lux. During this period, we stopped watering the ginger plantlets. For sampling, functional leaves, particularly the 3rd to 5th unfolded leaves from the top of the stem, were collected at 8:30 a.m. on day 1 to serve as the control group, and at 3:00 p.m. on days 1, 2, 3, and 4 for the experimental group (Figure 1). The design of our experimental sampling was informed by the methodology outlined in the study conducted by Gholizadeh et al. (2009) [35]. Three ginger plants were randomly selected, and one adult leaf from each plant was harvested and pooled for treatment. These mixed leaves were immediately stored in liquid nitrogen for subsequent qRT-PCR analysis. To ensure the accuracy and reliability of the results, three independent technical replicates were performed.

2.2. Identification and Physicochemical Properties Analysis

The ginger genomic data used in this study were obtained from the Ginger Genome Research Program of our group. The HMM model of the conserved structural domain of the class III PRX gene family (PF00141) was retrieved from InterPro (https://www.ebi.ac.uk/interpro/entry/pfam/PF00141/, accessed on 5 February 2024). This model was used to scan the Z. officinale genomic data, identifying PRX candidate genes with an e-value threshold of less than 10−5. Incomplete structural domain sequences were further eliminated using the NCBI Batch CDD search (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi, accessed on 5 February 2024). The identified family members were analyzed for physicochemical properties using ProtParam (https://web.expasy.org/protparam/, accessed on 6 February 2024).

2.3. Phylogenetic Analysis

The sequences of Class III PRX proteins from A. thaliana were obtained from the TAIR database (https://www.arabidopsis.org/browse/gene_family/peroxidase, accessed on 9 February 2024). The PRX protein sequences of ginger and A. thaliana were aligned using Clustal W 2.0.11. A phylogenetic tree was then constructed using the Neighbor-Joining (NJ) method in MEGA 11.0.10 software, with the substitution model set to the Poisson model [36]. The method for handling missing data was set to pairwise deletion, and the bootstrap value was set to 1000 to ensure reliability.

2.4. Genetic Structure, Motif Composition, Gene Duplication and Cis-Acting Elements

The exon–intron structure of the ZoPRX genes was analyzed using the Gene Structure Display Server (http://gsds.cbi.pku.edu.cn/, accessed on 15 February 2024). The identification of conserved motifs in ZoPRX proteins was performed using the MEME online tool (http://meme.nbcr.net/meme/intro.html, accessed on 17 February 2024). Gene duplication events among ginger PRX members were analyzed using the One Step MCScanX module of the TBtools v2.096 software. Genome-wide covariance analyses were conducted within ginger species and between ginger and A. thaliana, T. aestivum, O. sativa, and M. acuminata. The prediction of cis-acting elements within the ZoPRX promoters was carried out using the plantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 21 February 2024).

2.5. Gene Expression and qRT-PCR Analysis

The expression of peroxidase genes under abiotic stress conditions was evaluated using qRT-PCR (qTOWER 2.2, Analytik Jena AG, Jena, Germany). To mitigate potential experimental errors, each set of materials was subjected to three independent trials. Sixteen genes were randomly selected for this study, and the primers for qRT-PCR were designed using Primer5 software, as detailed in Table 1. The ZoTUB2 gene was used as an internal control for our experiments. The PCR program was initiated with a denaturation step at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing at 60 °C for 30 s. Each reaction was conducted in biological triplicates to ensure reproducibility. The relative expression levels of the peroxidase genes were quantified using the 2−ΔΔCt method [37].

3. Results

3.1. Genome-Wide Identification of the PRX Family in Ginger

Using the PRX protein domain (PF00141) as a query for the hidden Markov model (HMM) method, 103 PRX members in the Z. officinale reference genome were identified. Various gene characteristics were analyzed, including the lengths of the coding sequences (CDS), isoelectric point (pI), and protein molecular weight (MW) (Table S1). Among the 103 PRX members, ZoPRX13, ZoPRX44, and ZoPRX89 were the shortest, each with a length of 249 amino acids (aa). In contrast, ZoPRX6 was the longest, with a length of 1131 aa. ZoPRX6 also had the largest MW at 124,655.72 Da, while ZoPRX13 had the smallest at 26,971.67 Da. The pI values ranged from 4.23 (ZoPRX98) to 9.74 (ZoPRX82).

3.2. Chromosomal Distribution of the ZoPRX Genes

The analysis revealed that the 103 identified ZoPRX genes were unevenly distributed across 11 chromosomes. To enhance clarity and avoid confusion, these sequences were renamed from ZoPRX01 to ZoPRX103 based on their specific chromosomal locations. The distribution of ZoPRX genes across the chromosomes showed considerable variation. Chromosome 14 had the highest concentration with 20 ZoPRX genes, followed by chromosome 10 with 14 genes and chromosome 08 with 11 genes. In contrast, chromosome 16 and chromosome 2 had the fewest ZoPRX genes, with only three and four genes, respectively (Figure 2).

3.3. Conserved Motif Analysis of ZoPRXs

A comprehensive analysis of conserved motifs within the ZoPRX proteins was performed using the online tool MEME, as depicted in Figure 3B. Our analysis identified ten conserved motifs, numbered 1 through 10. The majority of ZoPRX proteins contained Motifs 2 and 6. Specifically, ZoPRX42 possessed a combination of five motifs: Motifs 2, 3, 5, 6, and 8. ZoPRX15 and ZoPRX86 are marked by the existence of two motifs: Motifs 2 and Motif 6. In contrast, ZoPRX1 was unique, presenting only Motifs 1 and 8, while ZoPRX102 was characterized by the exclusive presence of Motif 1. The rest of the ZoPRX proteins displayed a range of seven to ten conserved motifs.

3.4. Cis-Element Analysis of ZoPRXs

To further investigate the regulatory mechanisms governing ZoPRX genes under high temperature and intense light, the 2000 bp upstream sequences of 103 ZoPRX genes were extracted from the ginger genome for cis-acting elements, as depicted in Figure 4. The diversity of these cis-acting elements indicates that individual ZoPRX genes may possess distinct functional potentials. Our analysis reveals that a predominant portion of the ZoPRX genes play roles in growth and development, hormone regulation, and stress tolerance. The hormone-responsive elements identified include gibberellin, abscisic acid, salicylic acid, and auxin response elements. Stress-responsive elements feature cell cycle regulation, low temperature, drought inducibility, and defense and stress responsiveness. Elements related to physiological growth responses encompass endosperm expression, meristem expression, seed-specific regulation, circadian control, and root-specific elements. Notably, 39 genes harbor defense and stress-responsive elements, while 95 genes comprise hormone-responsive elements, with all exhibiting significant responses to light stress. Our results suggest that these genes play a key role in hormone regulation, light signal transduction, and adaptation to challenging environmental conditions.

3.5. Evolutionary Relationships of the ZoPRXs

To elucidate the evolutionary relationships within the PRX gene families, a phylogenetic tree was constructed, comprising 73 PRX genes from A. thaliana and 103 PRX genes from ginger (Figure 5). The ZoPRX members were classified into five distinct clusters based on their evolutionary proximities. Cluster I comprised 35 ZoPRX members, Cluster II encompassed 12 members, Cluster III included 31 members, Cluster IV consisted of seven members, and Cluster V contained 18 members. Subsequently, the analysis was expanded by incorporating 155 PRX genes from maize and a composite evolutionary tree was constructed (Supplementary Figure S1). The expanded tree of PRX genes exhibits a congruent structural arrangement with that observed in Figure 5.

3.6. Genome-Wide Duplication Events and Synteny Analysis of ZoPRXs

A synteny analysis of ZoPRX genes was performed using MCScan X software (Figure 6). Among the 103 members of the ZoPRX family, 12 pairs were identified as syntenic, with a notable degree of synteny observed on Chr08, Chr10, Chr14, Chr20, and Chr22. To further explore the evolutionary mechanisms of the ZoPRX gene family, comparative synteny maps were constructed using genomic data from A. thaliana, O. sativa, and M. acuminata (Figure 7). Our analysis revealed that 64 PRX genes in ginger exhibited synteny with M. acuminata, seven PRX genes showed synteny with O. sativa, and one PRX gene was syntenic with A. thaliana. This indicates that these syntenic PRX gene pairs may have originated from a common ancestor and could share functional similarities.

3.7. Expression Patterns of ZoPRX Genes in High Temperature and Intense Light Stresses

In order to elucidate the role of the ZoPRX gene family under adverse environmental conditions, qRT-PCR was conducted to examine their expression levels during high-temperature and intense light exposure (Figure 8). The genes showed differential expression responses to these stressors. Specifically, the expression levels of ZoPRX34, ZoPRX75, and ZoPRX89 decreased. Notably, ZoPRX40 and ZoPRX42 expression increased on the third day after initially reaching their nadir on the second day. In contrast, another group of ZoPRX genes, including ZoPRX09, ZoPRX41, ZoPRX44, ZoPRX47, ZoPRX51, and ZoPRX86, showed a decrease initially, followed by an increase in expression levels. The temporal expression profiles of these ZoPRX genes suggest a time-specific response to high temperature and intense light, with ZoPRX09, ZoPRX44, ZoPRX51, and ZoPRX86 peaking on the first day, ZoPRX47 on the second day, and ZoPRX41 on the fourth day of treatment.

4. Discussion

Class III peroxidase genes regulate lignification, cellular elongation, and the response to biotic and abiotic stress by oxidizing molecules and modulating reactive oxygen species levels. Under abiotic stress, plants enhance their antioxidant activity to mitigate the harmful effects of reactive oxygen species. Class III peroxidases play a crucial role in the breakdown of hydrogen peroxide (H2O2), thereby enhancing plant resilience to stress. The biological significance of the Class III peroxidase family has been well documented in A. thaliana [38], maize [29], potato [39], and other species, yet it remains unexplored in ginger. In the present study, a comprehensive analysis of the ZoPRX family members was performed, encompassing protein characterization, chromosomal localization, evolutionary relationships, conserved motifs, cis-acting elements, gene duplication events, and their expression response to high temperature and intense light stress. This study represents a significant step in understanding the role of the PRX gene family under high-temperature intense light conditions in ginger, offering valuable insights for future research in this area.
Through bioinformatics analysis, the Class III peroxidase gene family in ginger was systematically examined, and a total of 103 members were identified. These members were divided into five clusters based on the similarity of their gene structures and conserved motifs, consistent with the result of previous studies [29,38,39]. Understanding gene structure and conserved motifs is crucial for inferring gene function and classification [30,40]. The structure of ZoPRX genes was explored, revealing that the 103 ZoPRX genes contain varying numbers of exons and introns. ZoPRX genes from different clusters exhibited distinct structural features. Analysis of the conserved motifs showed that nearly all members contain Motif 6 and Motif 2, with more closely related members sharing similar motif structures. The genetic relationship of ginger with A. thaliana, M. acuminata and O. sativa was compared. This comparison revealed only a single pair of homologous genes with A. thaliana, while a greater number of homologous gene pairs were found with M. acuminata and O. sativa. This suggests that the evolution of PRX genes may be influenced by differences in species morphology, growth environment, and adaptative strategies.
The expansion of gene families within plant genomes is generally attributed to genome duplication, tandem duplication, and segmental duplication. These processes are pivotal in evolution, fostering the emergence of novel functions and expression patterns [41]. In A. thaliana, there are 73 PRX genes, including 9 pairs of segmentally duplicated genes and 10 clusters of tandem duplication [25]. In maize, there are 119 PRX genes, with 16 segmentally and 12 tandem duplication clusters [29]. In Populus trichocarpa, 93 PRX genes have been identified, encompassing 37 clusters of tandemly replicated genes originating from 14 pairs of genes duplicated during a genome-wide event approximately 60 to 65 million years ago [42]. Ginger has also experienced a genome-wide duplication event in its evolutionary history [34]. This study investigates the amplification of the PRX gene family in ginger. The analysis reveals that ZoPRX predominantly undergoes segmental replication, with 17 pairs of segmentally replicated genes and 11 clusters of tandem replication genes. Previous research indicates that many gene families expand predominantly through segmental and tandem duplication, which are crucial for promoting functional diversity and the evolution of gene families [43,44,45]. This is consistent with observations in A. thaliana and rice, suggesting that the ginger PRX gene family primarily expands through similar mechanisms.
Extensive research has established that plant peroxidases participate in numerous cellular processes during plant growth and development, as well as in plant responses to both abiotic and biotic stresses. In Vitis vinifera, 30 PRX genes were induced by NaCl, drought, and ABA [46]. Analysis of cis-acting elements in gene promoters uncovered several key elements, including those involved in light response, hormone response, expression in meristematic tissue and endosperm, and the MYB-binding site responsive to drought. This evidence suggests that the ZoPRX gene family not only plays a role in various abiotic stress responses but also modulates ginger growth and development by regulating hormone levels [47]. In this study, the regulatory role of the ZoPRX gene under high temperature and intense light stress was investigated using RNA-seq and qRT-PCR techniques. The expression pattern of the ZoPRX gene significantly changed under stress treatment, with 28 genes being induced by high temperature and intense light stress. These genes are likely involved in peroxidase synthesis and consequently in the scavenging of cellular ROS in ginger upon exposure to high temperature and intense light stress. However, some genes exhibited a pattern of increase and subsequent decrease in expression, leading us to hypothesize that the peroxidase activity may be progressively inactivated by the prolonged exposure to high temperature and intense light stress.

5. Conclusions

This study presents a comprehensive characterization of the Class III peroxidase (PRX) family in ginger, with an analysis of its expression under high-temperature and intense light-stress conditions. Through the application of bioinformatic tools, 103 PRX genes in ginger were identified and classified into five distinct subfamilies based on gene structure, conserved motifs, and phylogenetic analysis. These subfamilies exhibited a high degree of conservation. Chromosomal localization analysis showed a non-random distribution of the 103 ZoPRX genes across 11 chromosomes in ginger. Gene duplication analysis revealed that tandem and segmental duplications have played significant roles in the evolution of the ZoPRX gene family. Comparative genomics analysis with A. thaliana, rice, and M. acuminata suggested a closer homology of the ZoPRX genes with M. acuminata. The QRT-PCR results demonstrated that the expression of ZoPRX09, ZoPRX32, ZoPRX41, ZoPRX44, ZoPRX47, ZoPRX59, and ZoPRX86 was significantly upregulated under high temperature and intense light stress, highlighting their crucial roles in the regulatory mechanisms of ginger against these stressors. In summary, these findings are pivotal for further analysis of the ZoPRX gene, and detailed exploration of the biological functions and resistance mechanisms of each member of the ginger Class III peroxidase family will provide valuable insights for the molecular breeding of ginger.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae10090911/s1, Table S1: List of the 103 ZoPRX genes identified in this study. Figure S1. Phylogenetic analysis of PRX proteins from Z. officinale, A. thaliana and Z. mays.

Author Contributions

Conceptualization, M.G., H.-L.L. and M.X.; methodology, M.G.; software, M.G., Y.J., S.T. and H.L.; validation, H.X. and W.W.; formal analysis, M.G., Y.J., S.T. and H.L.; investigation, J.G. and M.M.; resources, H.X. and W.W.; data curation, M.G., Y.J., S.T., H.L., J.G. and M.M.; writing, M.G., H.-L.L. and M.X.; visualization, M.G., Y.J., S.T., H.L., J.G. and M.M.; supervision, H.-L.L. and M.X.; project administration, H.-L.L. and M.X.; funding acquisition, H.-L.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Foundation for Chongqing Talents Program for Young Top Talents (CQYC20220510999), Chongqing Science and Technology support projects (CSTB2023TIADKPX0025), The Yongchuan Ginger Germplasm Resource Garden of Chongqing City (ZWZZ2020014), Chongqing Modern Agricultural Industry Technology Innovation Team Project, and the Scientific and Technological Research Program of Chongqing Municipal Education Commission (KJZD-M202101301). The funds were utilized for this study’s design, data collection, analysis, and interpretation, as well as for writing the manuscript and covering the open access fees.

Data Availability Statement

The data utilized in this study are currently not publicly available as they are part of the ginger genome and have not been released. However, the data presented in this study can be made available upon request to the corresponding author.

Acknowledgments

We express our gratitude to the Chongqing University of Arts and Sciences for providing the experimental platform and to everyone who contributed to this article.

Conflicts of Interest

The authors have no conflicts of interest to declare.

References

  1. Gomez-Zavaglia, A.; Mejuto, J.C.; Simal-Gandara, J. Mitigation of emerging implications of climate change on food production systems. Food Res. Int. 2020, 134, 109256. [Google Scholar] [CrossRef] [PubMed]
  2. Franco, J.A.; Bañón, S.; Vicente, M.M.J.; Miralles, J.; Martínez-Sánchez, J.J. Review Article: Root development in horticultural plants grown under abiotic stress conditions—A review. J. Hortic. Sci. Biotechnol. 2011, 86, 543–556. [Google Scholar] [CrossRef]
  3. Castoria, R.; Caputo, L.; De Curtis, F.; De Cicco, V. Resistance of postharvest biocontrol yeasts to oxidative stress: A possible new mechanism of action. Phytopathology 2003, 93, 564–572. [Google Scholar] [CrossRef]
  4. Rivero, R.M.; Mittler, R.; Blumwald, E.; Zandalinas, S.I. Developing climate-resilient crops: Improving plant tolerance to stress combination. Plant J. 2022, 109, 373–389. [Google Scholar] [CrossRef]
  5. Ippolito, A.; Nigro, F. Impact of preharvest application of biological control agents on postharvest diseases of fresh fruits and vegetables. Crop Prot. 2000, 19, 715–723. [Google Scholar] [CrossRef]
  6. Kong, F.; Ran, Z.; Zhang, J.X.; Zhang, M.G.; Wu, K.B.; Zhang, R.T.; Liao, K.; Cao, J.Y.; Zhang, L.; Xu, J.L.; et al. Synergistic effects of temperature and light intensity on growth and physiological performance in Chaetoceros calcitrans. Aquac. Rep. 2021, 21, 100805. [Google Scholar] [CrossRef]
  7. Lamaoui, M.; Jemo, M.; Datla, R.; Bekkaoui, F. Heat and Drought Stresses in Crops and Approaches for Their Mitigation. Front. Chem. 2018, 6, 26. [Google Scholar] [CrossRef]
  8. Roxas, V.P.; Lodhi, S.A.; Garrett, D.K.; Mahan, J.R.; Allen, R.D. Stress Tolerance in Transgenic Tobacco Seedlings that Overexpress Glutathione S-Transferase/Glutathione Peroxidase. Plant Cell Physiol. 2000, 41, 1229–1234. [Google Scholar] [CrossRef] [PubMed]
  9. Chao-Zeng, Z.; Lei, Z.; Li-Juan, Y.; Ming, C.; Qing-Yu, W.; Lian-Cheng, L.; Zhao-Shi, X.; You-Zhi, M.; Malcolm, B. Two Wheat Glutathione Peroxidase Genes Whose Products Are Located in Chloroplasts Improve Salt and H2O2 Tolerances in Arabidopsis. PLoS ONE 2013, 8, e73989. [Google Scholar]
  10. Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
  11. Wood, Z.A.; Schr?Der, E.; Harris, J.R.; Poole, L.B. Structure, mechanism and regulation of peroxiredoxins. Trends Biochem. 2003, 28, 32–40. [Google Scholar] [CrossRef] [PubMed]
  12. Passardi, F.; Cosio, C.; Penel, C.; Dunand, C. Peroxidases have more functions than a Swiss army knife. Plant Cell Rep. 2005, 24, 255–265. [Google Scholar] [CrossRef] [PubMed]
  13. Almagro, L.; Gómez Ros, L.; Belchi-Navarro, S.; Bru, R.; Ros Barceló, A.; Pedreño, M. Class III peroxidases in plant defence reactions. J. Exp. Bot. 2009, 60, 377–390. [Google Scholar] [CrossRef]
  14. Piontek, K.; Smith, A.T.; Blodig, W. Lignin peroxidase structure and function. Biochem. Soc. Trans. 2001, 29, 111–116. [Google Scholar] [CrossRef]
  15. Zámocký, M.; Furtmüller, P.G.; Obinger, C. Evolution of structure and function of Class I peroxidases. Arch. Biochem. Biophys. 2010, 500, 45–57. [Google Scholar] [CrossRef]
  16. Shigeto, J.; Tsutsumi, Y. Diverse functions and reactions of class III peroxidases. New Phytol. 2016, 209, 1395–1402. [Google Scholar] [CrossRef]
  17. Susumu, H.; Katsutomo, S.; Hiroyuki, I.; Yuko, O.; Hirokazu, M. A Large Family of Class III Plant Peroxidases. Plant Cell Physiol. 2001, 462, 462–468. [Google Scholar]
  18. Passardi, F.; Penel, C.; Dunand, C. Performing the paradoxical: How plant peroxidases modify the cell wall. Trends Plant Sci. 2004, 9, 534–540. [Google Scholar] [CrossRef]
  19. Passardi, F.; Theiler, G.; Zamocky, M.; Cosio, C.; Rouhier, N.; Teixera, F.; Margis-Pinheiro, M.; Ioannidis, V.; Penel, C.; Falquet, L. PeroxiBase: The peroxidase database. Phytochemistry 2007, 68, 1605–1611. [Google Scholar] [CrossRef]
  20. Kidwai, M.; Ahmad, I.Z.; Chakrabarty, D. Class III peroxidase: An indispensable enzyme for biotic/abiotic stress tolerance and a potent candidate for crop improvement. Plant Cell Rep. 2020, 39, 1381–1393. [Google Scholar] [CrossRef]
  21. Shang, H.; Fang, L.; Qin, L.; Jiang, H.; Duan, Z.; Zhang, H.; Yang, Z.; Cheng, G.; Bao, Y.; Xu, J. Genome-wide identification of the class III peroxidase gene family of sugarcane and its expression profiles under stresses. Front. Plant Sci. 2023, 14, 1101665. [Google Scholar] [CrossRef]
  22. Wu, Y.; Yang, Z.; How, J.; Xu, H.; Chen, L.; Li, K. Overexpression of a peroxidase gene (AtPrx64) of Arabidopsis thaliana in tobacco improves plant’s tolerance to aluminum stress. Plant Mol. Biol. 2017, 95, 157–168. [Google Scholar] [CrossRef]
  23. Liu, H.; Dong, S.; Li, M.; Gu, F.; Yang, G.; Guo, T.; Chen, Z.; Wang, J. The Class III peroxidase gene OsPrx30, transcriptionally modulated by the AT-hook protein OsATH1, mediates rice bacterial blight-induced ROS accumulation. J. Integr. Plant Biol. 2021, 63, 393–408. [Google Scholar] [CrossRef] [PubMed]
  24. Coego, A.; Ramirez, V.; Ellul, P.; Mayda, E.; Vera, P. The H2O2-regulated Ep5C gene encodes a peroxidase required for bacterial speck susceptibility in tomato. Plant J. 2010, 42, 283–293. [Google Scholar] [CrossRef] [PubMed]
  25. Tognolli, M.; Penel, C.; Greppin, H.; Simon, P. Analysis and expression of the class III peroxidase large gene family in Arabidopsis thaliana. Gene 2002, 288, 129–138. [Google Scholar] [CrossRef] [PubMed]
  26. Valério, L.; De Meyer, M.; Penel, C.; Dunand, C. Expression analysis of the Arabidopsis peroxidase multigenic family. Phytochemistry 2004, 65, 1331–1342. [Google Scholar] [CrossRef] [PubMed]
  27. Duroux, L.; Welinder, K.G. The Peroxidase Gene Family in Plants: A Phylogenetic Overview. J. Mol. Evol. 2003, 57, 397–407. [Google Scholar] [CrossRef]
  28. Passardi, F.; Longet, D.; Penel, C.; Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants. Phytochemistry 2004, 65, 1879–1893. [Google Scholar] [CrossRef]
  29. Wang, Y.; Wang, Q.; Zhao, Y.; Han, G.; Zhu, S. Systematic analysis of maize class III peroxidase gene family reveals a conserved subfamily involved in abiotic stress response. Gene 2015, 566, 95–108. [Google Scholar] [CrossRef]
  30. Yunpeng, C.; Yahui, H.; Dandan, M.; Dahui, L.; Qing, J.; Yi, L.; Yongping, C. Structural, Evolutionary, and Functional Analysis of the Class III Peroxidase Gene Family in Chinese Pear (Pyrus bretschneideri). Front. Plant Sci. 2016, 7, 1874. [Google Scholar]
  31. Semwal, R.B.; Semwal, D.K.; Combrinck, S.; Viljoen, A.M. Gingerols and shogaols: Important nutraceutical principles from ginger. Phytochemistry 2015, 117, 554–568. [Google Scholar] [CrossRef]
  32. Xu, Y.; Liu, H.; Gao, Y.; Xiong, R.; Xiang, Y. The TCP transcription factor PeTCP10 modulates salt tolerance in transgenic Arabidopsis. Plant Cell Rep. 2021, 40, 1971–1987. [Google Scholar] [CrossRef] [PubMed]
  33. Ballester, P.; Cerdá, B.; Arcusa, R.; Marhuenda, J.; Yamedjeu, K.; Zafrilla, P. Effect of ginger on inflammatory diseases. Molecules 2022, 27, 7223. [Google Scholar] [CrossRef] [PubMed]
  34. Li, H.L.; Wu, L.; Dong, Z.; Jiang, Y.; Jiang, S.; Xing, H.; Li, Q.; Liu, G.; Tian, S.; Wu, Z. Haplotype-resolved genome of diploid ginger (Zingiber officinale) and its unique gingerol biosynthetic pathway. Hortic. Res. 2021, 8, 189. [Google Scholar] [CrossRef]
  35. Gholizadeh, F.; Mirmazloum, I.; Janda, T. Genome-wide identification of HKT gene family in wheat (Triticum aestivum L.): Insights from the expression of multiple genes (HKT, SOS, TVP and NHX) under salt stress. Plant Stress 2024, 13, 100539. [Google Scholar] [CrossRef]
  36. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  37. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
  38. Llorente, F.; López-Cobollo, R.M.; Catalá, R.; Martínez-Zapater, J.M.; Salinas, J. A novel cold-inducible gene from Arabidopsis, RCI3, encodes a peroxidase that constitutes a component for stress tolerance. Plant J. 2010, 32, 13–24. [Google Scholar] [CrossRef]
  39. Yang, X.; Yuan, J.; Luo, W.; Qin, M.; Yang, J.; Wu, W.; Xie, X. Genome-wide identification and expression analysis of the class III peroxidase gene family in potato (Solanum tuberosum L.). Front. Genet. 2020, 11, 593577. [Google Scholar] [CrossRef]
  40. Han, Y.; Ding, T.; Su, B.; Jiang, H. Genome-Wide Identification, Characterization and Expression Analysis of the Chalcone Synthase Family in Maize. Int. J. Mol. Sci. 2016, 17, 161. [Google Scholar] [CrossRef]
  41. Oliver, K.R.; Mccomb, J.A.; Greene, W.K. Transposable Elements: Powerful Contributors to Angiosperm Evolution and Diversity. Genome Biol. Evol. 2013, 5, 1886–1901. [Google Scholar] [CrossRef]
  42. Ren, L.L.; Liu, Y.J.; Liu, H.J.; Qian, T.T.; Qi, L.W.; Wang, X.R.; Zeng, Q.Y. Subcellular Relocalization and Positive Selection Play Key Roles in the Retention of Duplicate Genes of Populus Class III Peroxidase Family. Plant Cell 2014, 26, 2404–2419. [Google Scholar] [CrossRef]
  43. Cannon, S.B.; Mitra, A.; Baumgarten, A.; Young, N.D.; May, G. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana. BMC Plant Biol. 2004, 4, 10. [Google Scholar] [CrossRef]
  44. Wang, Y.; Wang, X.; Paterson, A.H. Genome and gene duplications and gene expression divergence: A view from plants. Ann. N. Y. Acad. Sci. 2012, 1256, 1–14. [Google Scholar] [CrossRef] [PubMed]
  45. Zhou, Y.; Tao, J.; Ahammed, G.J.; Li, J.; Yang, Y. Genome-wide identification and expression analysis of aquaporin gene family related to abiotic stress in watermelon. Genome 2019, 62, 643–656. [Google Scholar] [CrossRef] [PubMed]
  46. Mika, A.; Boenisch, M.J.; Hopff, D.; Lüthje, S. Membrane-bound guaiacol peroxidases from maize (Zea mays L.) roots are regulated by methyl jasmonate, salicylic acid, and pathogen elicitors. J. Exp. Bot. 2010, 61, 831–841. [Google Scholar] [CrossRef]
  47. Hwarari, D.; Guan, Y.; Li, R.; Movahedi, A.; Chen, J.; Yang, L. Comprehensive bioinformatics and expression analysis of TCP transcription factors in Liriodendron chinense reveals putative abiotic stress regulatory roles. Forests 2022, 13, 1401. [Google Scholar] [CrossRef]
Horticulturae 10 00911 g001
Figure 1. Ginger planting and processing timeline.
Figure 1. Ginger planting and processing timeline.
Horticulturae 10 00911 g001
Horticulturae 10 00911 g002
Figure 2. Chromosomal location of PRX genes in ginger. The red color indicates a higher gene density in this chromosome region, while blue represents a lower gene density.
Figure 2. Chromosomal location of PRX genes in ginger. The red color indicates a higher gene density in this chromosome region, while blue represents a lower gene density.
Horticulturae 10 00911 g002
Horticulturae 10 00911 g003
Figure 3. Phylogenetic relationship, gene structure, and conserved motif structure of ZoPRX protein. (A) Phylogenetic tree constructed based on the ZoPRX protein sequences. (B) Distribution of conserved motifs in ZoPRX proteins.
Figure 3. Phylogenetic relationship, gene structure, and conserved motif structure of ZoPRX protein. (A) Phylogenetic tree constructed based on the ZoPRX protein sequences. (B) Distribution of conserved motifs in ZoPRX proteins.
Horticulturae 10 00911 g003
Horticulturae 10 00911 g004
Figure 4. The cis-acting element structure of the ZoPRX promoter region. Different colors represent different elements.
Figure 4. The cis-acting element structure of the ZoPRX promoter region. Different colors represent different elements.
Horticulturae 10 00911 g004
Horticulturae 10 00911 g005
Figure 5. The phylogenetic tree of PRX gene family. The arcs in different colors indicate different subfamilies of PRX.
Figure 5. The phylogenetic tree of PRX gene family. The arcs in different colors indicate different subfamilies of PRX.
Horticulturae 10 00911 g005
Horticulturae 10 00911 g006
Figure 6. Schematic presentations of the inter-chromosomal relationships of ginger PRX genes. The red lines indicate duplicated PRX gene pairs in ginger. The chromosome number is indicated in the middle of each chromosome.
Figure 6. Schematic presentations of the inter-chromosomal relationships of ginger PRX genes. The red lines indicate duplicated PRX gene pairs in ginger. The chromosome number is indicated in the middle of each chromosome.
Horticulturae 10 00911 g006
Horticulturae 10 00911 g007
Figure 7. Synteny analysis between the PRX genes of ginger and three representative plant species.
Figure 7. Synteny analysis between the PRX genes of ginger and three representative plant species.
Horticulturae 10 00911 g007
Horticulturae 10 00911 g008
Figure 8. Expression analysis of PRX genes under abiotic stresses with data normalized to TUB-2 gene. Vertical bars represent the standard deviation. (CK refers to the control group, and D1-D4 refers to the first to the fourth day of treatment respectively).
Figure 8. Expression analysis of PRX genes under abiotic stresses with data normalized to TUB-2 gene. Vertical bars represent the standard deviation. (CK refers to the control group, and D1-D4 refers to the first to the fourth day of treatment respectively).
Horticulturae 10 00911 g008
Table 1. Primer sequences used in qRT-PCR.
Table 1. Primer sequences used in qRT-PCR.
Genes NameForward Primer (5′→3′)Reverse Primer (5′→3′)
ZoTUB2GAACATGATGTGTGCTGCCGATCTTCAGCCCTTTCGGAGG
ZoPRX9AAACATCTAAACCCAAACCATTCTGGCATCCTTACA
ZoPRX27AGCGTTTGGTGGGTGACGACTTCAAGACACTACCG
ZoPRX32TGTAAGGATGCCAGAATATTCTGGCATCCTTACA
ZoPRX34GTGACGACGCTCAACGGTGACTAATCCAAGGCAC
ZoPRX40CGGCTACTGGGACAACGTGGACGCAGTAAGGTGT
ZoPRX41TATTAGGTGTTTACGGAGTGCGCACTCCGTAAACACC
ZoPRX42CGACATTTCTGCGTTCAACCTCTTACGCCGCACT
ZoPRX44CTTTCTTTCGCTCTTGTACAAGAGCGAAAGAAAG
ZoPRX47CGGTGATTCTGACAAGGTCAGACTCACATCCACC
ZoPRX51TGGGACGAACAGGAGGAATTCCTCCTGTTCGTCCC
ZoPRX59GTCCGCAGCCCATACCTAGTCGAAGATCCACGCCAGCAGCCG
ZoPRX63AAAGAAAGGCAACAATGTAGTCGACAGATTCCCCATGAATGA
ZoPRX75ATGTTGGCTTATGACTTGTCATAAGCCAACATTC
ZoPRX86AGTGTTTCCGTCCTCTAATGAACTTGATGGGTCTA
ZoPRX89ATTGCCAAGGAACTCAGCTTGGCAATGCCATGCACATTTTTG
ZoPRX102TATCCAGAATAATCCCAATCATGAGGTTTTTCTTGATTCCGGGAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gong, M.; Jiang, Y.; Tang, S.; Xing, H.; Li, H.; Gu, J.; Mao, M.; Wang, W.; Xia, M.; Li, H.-L. Genome-Wide Identification of the Class III Peroxidase Gene Family in Ginger and Expression Analysis under High Temperature and Intense Light Stress. Horticulturae 2024, 10, 911. https://doi.org/10.3390/horticulturae10090911

AMA Style

Gong M, Jiang Y, Tang S, Xing H, Li H, Gu J, Mao M, Wang W, Xia M, Li H-L. Genome-Wide Identification of the Class III Peroxidase Gene Family in Ginger and Expression Analysis under High Temperature and Intense Light Stress. Horticulturae. 2024; 10(9):911. https://doi.org/10.3390/horticulturae10090911

Chicago/Turabian Style

Gong, Min, Yajun Jiang, Shihao Tang, Haitao Xing, Hui Li, Jiajia Gu, Minmin Mao, Wei Wang, Maoqin Xia, and Hong-Lei Li. 2024. "Genome-Wide Identification of the Class III Peroxidase Gene Family in Ginger and Expression Analysis under High Temperature and Intense Light Stress" Horticulturae 10, no. 9: 911. https://doi.org/10.3390/horticulturae10090911

APA Style

Gong, M., Jiang, Y., Tang, S., Xing, H., Li, H., Gu, J., Mao, M., Wang, W., Xia, M., & Li, H. -L. (2024). Genome-Wide Identification of the Class III Peroxidase Gene Family in Ginger and Expression Analysis under High Temperature and Intense Light Stress. Horticulturae, 10(9), 911. https://doi.org/10.3390/horticulturae10090911

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop