Table Grape Ferritin1 Is Implicated in Iron Accumulation, Iron Homeostasis, and Plant Tolerance to Iron Toxicity and H₂O₂ Induced Oxidative Stress

Abstract

In plants, Ferritin is the earliest discovered regulator of iron (Fe) metabolism and plays a critical role in maintaining Fe storage and sequestration, which contributes to cellular Fe homeostasis and tolerance to abiotic stresses. However, biological functions of Ferritin proteins in perennial fruit crops are largely rare. In this study, VvFerritin1 was isolated from ‘Irsay Oliver’ table grape, and it was mainly expressed in roots and induced under Fe toxicity, H₂O₂ stress, and abscisic acid (ABA) treatment. Complementation of VvFerritin2 in yeast mutant DEY1453 directly restored the mutant growth, and VvFerritin1 can transport Fe²⁺ in yeast. The heterologous expression of VvFerritin1 in fer1-2 mutant effectively rescued the dwarfed growth of Arabidopsis fer1-2 mutant, under the control condition, Fe toxicity, or H₂O₂ stress, embodied in enhanced fresh weight (126%, 81%, or 48%), total root length (140%, 98%, or 64%), total root surface (70%, 84%, or 120%), and total leaf chlorophyll (56%, 51%, or 53%), respectively. In particular, tissue Fe concentration and activities of nitrite reductase (NiR), aconitase (ACO), and succinate dehydrogenase (SDH) were significantly enhanced in fer1-2/35S::Ferritin1 lines, respectively, compared to that of fer1-2 mutant. This work contributes to the study of molecular mechanisms of Fe storage and homeostasis in ‘Irsay Oliver’ table grape.

1. Introduction

Iron (Fe) is one of the most important mineral elements in plant cells, which was directly involved in photosynthesis, respiration, energy metabolism, DNA repair, and hormone synthesis [1,2,3]. In soils, Fe deficiency severely reduces fruit yield and fruit quality [4,5]. In plants, there are two types of Fe transport and absorption strategies, including Strategy I and Strategy II, especially under Fe deficiency conditions [5,6,7,8,9]. In dicotyledons and non-gramineous monocotyledons (Strategy I), Fe³⁺ is reduced to Fe²⁺ through ferric reduction oxide (FRO), and Fe²⁺ is absorbed by iron regulated transporters (IRTs). In gramineous plants (Strategy II), Fe³⁺ is absorbed through the Fe³⁺ chelator phytosideophore (PS) pathway, which depends on yellow stripe (YS) or yellow stripe-like (YSL) transporters [5,8,9].

Under Fe deficiency conditions, the mobilization of intracellular Fe²⁺ is indispensable for plant growth and development [5,6,7,8,9,10]. When Fe²⁺ is excessively stored in the cytoplasm, it will cause Fe²⁺ toxicity that hinders normal growth and development [5,6,7,8,9,10,11,12]. Previous studies showed that natural resistance associated macrophage proteins (NRAMPs), permease in chloroplast (PIC), and vacuolar iron transporter (VIT) are implicated in the transport and distribution of Fe²⁺ within plant cells [5,6,7,8,9,10]. Notably, intracellular Fe²⁺ is stored in vacuoles or might be chelated with Ferritins, which are being used in various metabolic pathways that depend on Fe²⁺ [9,10,11,12].

Ferritin plays a crucial role in maintaining cellular Fe balance and protecting plants against oxidative damage [9,10,11,12,13]. In Arabidopsis, four Ferritin family genes have been identified. Notably, AtFerritin1 is enhanced by Fe toxicity and H₂O₂ treatment, AtFerritin2 is increased by abscisic acid (ABA), and AtFerritin3 is up-regulated by Fe toxicity [13,14,15]. AtFerritin proteins participate in the regulation of Fe²⁺ storage and sequestration, and contribute to plant tolerance to undesired abiotic stresses, including water loss [14], drought [16], and reactive oxygen species (ROS) [13,14,17,18]. The germination rate of Arabidopsis fer2 mutant seeds was severely decreased under ROS stress [13,17,18]. The growth of Arabidopsis fer1fer3fer4 mutant was severely impaired, and the intracellular Fe²⁺ concentration was significantly reduced. Moreover, Ferritin proteins are also implicated in regulating the root structure. The abrupt ROS production leads to the destruction of fer1fer3fer4 roots [15]. Subsequently, Ferritin family genes have been identified in cut rose [14], cassava [16], and peach [17]. However, biological and molecular functions of Ferritin family proteins in perennial fruit crops are still unknown.

Table grape (Vitis vinifera) is a worldwide popular perennial fruit crop, and its genome has been published [18]. Fe as the highest amount of trace elements in vines correlates with grape quality and yield [4,5]. Grapes are highly sensitive to Fe deficiency, and when the soil Fe content is low, the young leaves of new shoots are the first to show chlorosis and yellowing. Due to nutrient deficiency in grapevines, they suffer from malnutrition, slow growth of new shoots, weakened tree vigor, and reduced fruit size, which greatly affects the quality and yield of grapes [4,5]. In this study, a Ferritin family gene VvFerritin1 was isolated from table grape cultivar ‘Irsay Oliver’, and their expression profiles and putative biological function were further verified. This study helps to reveal the molecular mechanisms of Fe transport, storage, and utilization in fruit trees.

2. Materials and Methods

2.1. Plant Material and Growth Condition

The ‘Irsay Oliver’ seedlings grown in the National Grape Germplasm Repository (Yantai, China) were used throughout this study. One-month-old tissue-cultured ‘Irsay Oliver’ seedlings were cultivated on half-strength MS medium (pH 5.8) for 2 weeks, and then transferred to the half-strength MS liquid solution in plastic containers and cultured in the incubator under conditions of 25 °C day 16 h/20 °C night 8 h, with a relative humidity of 75%. For Fe depletion treatments, Fe was deleted from the MS solution [3,17,19]. For Fe toxicity treatments, 500 μmol∙L⁻¹ FeCl₃ was added in half-strength MS solution. For ABA treatments, 100 μol∙L⁻¹ ABA was supplied in half-strength MS medium. For H₂O₂ induced oxidative stress treatments, fresh H₂O₂ was added in half-strength MS solution to a final concentration of 10% (v/v) [14,19]. After being subjected to stress treatments for 48 h, samples of leaves, stems, and roots were collected, respectively, and quickly frozen in liquid nitrogen before further analyses.

The wild type Arabidopsis (Col-0), fer1-2 knockout mutants, and fer1-2/35S::Ferritin2 lines were germinated in half-strength MS medium and exposed to Fe depletion, Fe toxicity, or H₂O₂ stress for 14 days before physiological analysis. Biological repeats were carried out three times, each with 20 seedlings.

2.2. Physiological Analysis

The fresh weight of Arabidopsis seedlings was determined by the Analytical Balance (Thermo Electron, Waltham, MA, USA). Roots of Arabidopsis seedlings were scanned using the Epson Rhizo scanner (Epson, Long Beach, CA, USA), and the total root length and total surface area were calculated by the Epson WinRHIZO 2.0 software (Long Beach, CA, USA). Fe concentration was measured by ICP-AES systems (IRIS Advantage, Thermo Electron, Waltham, MA, USA). The activity of aconitase (ACO), nitrite reductase (NiR), and succinate dehydrogenase (SDH) was executed using commercial detection kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Total leaf chlorophyll was quantified by the BioRad SmartSpec 3000 spectrophotometer (BioRad, Wadsworth, IL, USA), as previously mentioned [17,19,20,21]. Biological repeats were carried out three times, each with 20 seedlings.

2.3. Isolation and Cloning of VvFerritin1 from Table Grape

Both Arabidopsis Ferritin1 [1,22] and peach Ferritin1 [17] were taken as reference sequences, and one putative Ferritin family gene was screened throughout the Grape Genome Database [18]. The genomic DNA sequence, coding sequence (CDS), and amino acid sequence of putative VvFerritin1 were downloaded, respectively. The amino acid sequence of VvFerritin1 protein was verified via InterProScan 4.8 and Pfam online servers. The independent prime pair of VvFerritin1 was designed for CDS cloning. Total RNA of 1-month-old ‘Irsay Oliver’ seedling was extracted with the help of RNAprep Pure Plant Kit (TianGen, Beijing, China), and the first strand cDNA template was synthesized using the PrimeScript^TM RT reagent kit (Takara, Dalian, China). The CDS of VvFerritin1 was amplified using Prime STAR^TM HS DNA polymerase (Takara, Dalian, China), and then sequenced in Shenggong Bioengineering Co., Ltd. (Shanghai, China). The tertiary structure of Ferritin homologous proteins was predicted utilizing the Phyre2 online server (https://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?%20Predicting%20using%20id=index) (accessed on 25 October 2024).

2.4. Phylogenetic Tree Construction

The alignment of amino acid sequences of Ferritin homologues from table grape (VvFerritin1), A. thaliana (AtFer1-4, Gene ID: 818622, 820276, 824775, 831720), Arachis hypogaea (AdFer1-4: 107485043, 107475384, 107469395, 107478374), Camellia oleifera (CoFer1-3: 106433816, 106452550, 106382764), Brassica rapa (BrFer1-3: 103855410, 103870409, 103830031), Cicer arietinum (CaFer1-3: 101503152, 101498435, 101510209), Gossypium hirsutum (GhFer1-3: 107943203, 107960065, 107904058), Glycine max (GmFer1-4: 547824, 547988, 547476, 547477), Hevea brasiliensis (HbFer2-4: 110640712, 110645561, 10638947), M. domestica (MdFer3-4: 103406424, 103450693), Manihot esculenta (MeFer1-4: 110619691, 110622202, 110624811, 110619936), Nicotiana tabacum (NtFer1-2: 107789800, 107832545), Prunus persica (PpFer1-2: 18787640, 18773611), Ricinus communis (RcFer2-3: 8263108, 8272083), Solanum lycopersicum (SlFer1-2: 102577492, 102581985), and Fragaria vesca (FvFer3-4: 101293015, 105353074) was conducted with the help of the ClusterX 2.0.13 software. The phylogenetic tree of these Ferritin homologues was well constructed using the maximum likelihood method in MEGA 13.0.

2.5. Quantitative Real Time PCR (qRT-PCR)

Specific primer pairs of VvFerritin1 (forward: GATCCCCAGTTGACAGATTT, reverse: CCACCCTCTTCGAGGAGCAT) were designed via the NCBI/Primer-BLAST on-line server. A qRT-PCR analysis was executed on the 7500 Real Time PCR System (Applied Biosystems, New York, NY, USA), labelled with SYBR Premix Ex Taq (TaKaRa, Kyoto, Japan). The Ubiquitin of wine grape was used as the internal control as described in previous studies [19,23]. To calculate the concentration of the starting template and RT-qPCR efficiency for each cDNA sample, the linear regression of the log (fluorescence) per cycle number data was used by taking the logarithm on both sides of an equation as follows: log (Nc) = log (No) + log(Eff) × C, where Nc is fluorescence, No is the initial concentration of a template, Eff is efficiency, and C is the cycle number. The relative expression level of VvFerritin1 was presented after normalization to the internal control from three independent biological repeats, each with four technical replicates.

2.6. Complementation of VvFerritin2 Gene in Yeast Mutant

The recombinant plasmid pYH23-Ferritin1 was constructed by cloning the CDS region of VvFerritin2 gene into the pYH23 vector [19,24], using the forward primer of 5′- GACGGATCCATGCTTGTGGGAGGTGTTTC- 3′ (BamH Ⅰ was underlined) and reverse primer of 5′-GAGTCTAGA TCATGCTGCACCACCCTCTTC-3′ (Xba Ⅰ was underlined). According to the description of Vert et al. [24] and Song et al. [19], the yeast fet3fet4 double mutant strain DEY1453 was transformed with the empty plasmid pYH23 or the recombinant plasmid pYH23-Ferritin1. Yeast transformants were further cultured in liquid YPD (containing 10 μmol·L⁻¹ FeSO₄) medium to OD₆₀₀ of 1.0, and then diluted to 10⁻¹, 10⁻², and 10⁻³ concentrations. Yeast cell growth was determined in a synthetic-defined medium (containing 10 μmol·L⁻¹ FeSO₄, pH 4.5) in the absence or presence of 30 μmol·L⁻¹ bathophenanthroline disulfonic acid (BPDS), respectively. The plates were incubated at 30 °C for 60 h before colony observation.

2.7. Over-Expression of VvFerritin1 in Arabidopsis fer1-2 Mutant

The CDS region of VvFerritin1 gene was cloned into the pBH vector [19,25] to obtain the recombinant plasmid pBH-Ferritin1, using the forward primer of 5′- GACGAGCTCATGCTTGTGGGAGGTGTTTC- 3′ (SacⅠ was underlined) and reverse primer of 5′- GAGTCTAGA TCATGCTGCACCACCCTCTTC-3′ (Xba Ⅰ was underlined). The pBH vector or the recombinant plasmid pBH-Ferritin1 was transformed into Agrobacterium tumefaciens EHA 105, and then further introduced into the Arabidopsis fer1-2 knockout homozygote mutant [17,26]. Individual T1 generation of fer1-2/35S::Ferritin1 lines were identified by screening hygromycin resistant transgenic Arabidopsis seedlings. The genomic DNA of T1 generation of fer1-2/35S::Ferritin1 lines was extracted. Then, the existence of a 786-bp product of VvIRT7 was further checked by reverse transcription PCR. Verified T3 generation seeds of #1, #2, and #6 fer1-2/35S::Ferritin1 lines were harvested and cultivated on half-strength MS medium for 12 days before physiological analysis. Biological repeats were performed three times, each with 20 seedlings.

2.8. Statistical Analysis

Bar graphs were produced via the Origin 12.0 software. Significant differences were analyzed using IBM SPSS Statistics 23 (Armonk, New York, NY, USA) followed by Fisher’s LSD test method at p < 0.01 level.

3. Results

3.1. Isolation of VvFerritin1 in Grape

One putative Ferritin family gene was isolated from grape genome, which was entitled as VvFerritin1 with seven introns of different lengths (PQ862906, Figure 1A). Protein domain verification showed that VvFerritin1 contained the classical Ferritin domain (PF00210), implying that all of it belongs to Ferritin family transporters. The identity value of amino acid sequences among grape VvFerritin1, peach PpFerritin1, and Arabidopsis AtFerritin1 was 72.40% (Figure 1B). Meanwhile, the tertiary structure prediction analysis showed that four Ferritin homologous proteins (VvFerritin1, AtFerritin1, PpFerritin1, and MeFerritin1) exhibited a similar tertiary structure (Figure 2), implying that they may possess similar biological functions.

A phylogenetic tree analysis indicated that Ferritin homologues belonging to the same genus, such as Arabidopsis and turnip (Brassica rapa) of Cruciferae, soybean (Glycine max), peanut (Arachis hypogaea), and chickpea (Cicer arietinum) of Leguminosae, rubber tree (Hevea brasiliensis), cassava (Manihot esculenta), and castor (Ricinus communis) of Euphorbiaceae, and peach (Prunus persica), apple (Malus domestica), and strawberry (Fragaria vesca) of Rosaceae, were prone to be closely clustered together and exhibited a closer genetic distance during evolution (Figure 2). Notably, VvFerritin1 was closely clustered with cassava MeFerritin1 and other Euphorbiaceae homologues (Figure 3).

3.2. Expression Profiles of VvFerritin1

Results showed that the expression levels of VvFerritin1 were different among distinct tissues of tissue-cultured seedlings, and the maximum expression amount was observed in roots, followed by leaves and stems (Figure 4). In addition, VvFerritin1 exhibited a different response to Fe depletion, Fe toxicity, H₂O₂ stress, and ABA stress, respectively. VvFerritin1 was quite sensitive to Fe toxicity, whose expression levels were induced throughout the entire seedling. The expression of VvFerritin1 was significantly increased in leaves and roots under H₂O₂ stress and enhanced in roots under ABA stress, while it slightly changed under Fe depletion (Figure 4).

3.3. VvFerritin1 Restored the Growth of Yeast Mutant DEY1453

The DEY1453 mutant, which was deficient in Fe²⁺ uptake, cannot grow normally on YPD medium in the absence of Fe² [19,24]. In this study, DEY1453 cells harboring either the empty plasmid pYH23 or the recombinant plasmid pYH23-Ferritin1 grew well on YPD medium (containing 10 μmol‧L⁻¹ Fe²⁺) (Figure 5). When 30 μmol·L⁻¹ BPDS was present in YPD medium, only DEY1453 cells harboring pYH23-Ferritin1 thrived and DEY1453 cells harboring the empty plasmid pYH23 cannot grow normally, implying that VvFerritin1 is directly implicated in Fe²⁺ transport or accumulation in yeast, thereby restoring the normal growth of the DEY1453 mutant.

3.4. VvFerritin1 Recovered the Impaired Growth of Arabidopsis fer1-2 Mutant

To determine whether VvFerritin1 could restore the normal growth of fer1-2 mutant, VvFerritin1 was introduced into the expression vector pHB (Figure 6A). In this work, four positive (#1, #2, #6, and #9) T1 generation fer1-2/35S::Ferritin1 lines were validated by PCR for the presence of a 786-bp amplification product of VvFerritin1 (Figure 6B). Purified T3 generation of #2 and #6 fer1-2/35S:: Ferritin1 lines were selected randomly for further physiological analysis. Given that #2 and #6 fer1-2/35S::Ferritin1 lines exhibited a similar growth status, data of #2 fer1-2/35S::Ferritin1 lines were shown in this present work.

Compared to the wild type, the growth of fer1-2 lines was seriously hindered, accompanied by decreased fresh weight, total root length, total root surface, and total leaf chlorophyll, respectively, under the control conditions, Fe toxicity, and H₂O₂ stress (Figure 6C and Figure 7). In contrast, #2 fer1-2/35S::Ferritin1 lines exhibited a better growth phenotype than that of the fer1-2 mutant lines under all tested conditions. The fresh weight, dry weight, total root length, total root surface, and total leaf chlorophyll of #2 fer1-2/35S::Ferritin1 lines were significantly increased, compared to the fer1-2 mutant, similar to that of the wild type (Figure 6C and Figure 7). All these findings imply that the complementation of VvFerritin1 rescued the impaired growth of fer1-2 mutant.

In comparison to the wild type control, the Fe concentration, and ACO, NiR, and SDH activities of fer1-2 mutant lines were significantly decreased under control conditions, Fe toxicity, and H₂O₂ stress, respectively (Figure 7). Compared to the fer1-2 mutant, the Fe concentration, and ACO, NiR, and SDH activities of #2 fer1-2/35S::Ferritin1 lines were significantly induced.

4. Discussion

Fe is the most indispensable mineral nutrient in fruit trees and it was closely associated with tree growth, flowering, fruit quality, and fruit yield [1,2,4,5]. However, molecular mechanisms of Fe uptake and transport in fruit trees are essentially unclear. In this study, VvFerritin1 transporter was isolated from grape, and amino acid sequences of VvFerritin1 and homologues from other 15 plants were highly conserved, with the identity of 64.67%. VvFerritin1 was tightly clustered with Euphorbiaceae homologues, implying that grape Ferritin1 has a close genetic distance to Euphorbiaceae plants. In particular, VvFerritin1 exhibited a similar tertiary structure with other plant homologous Ferritin proteins (AtFerritin1, PpFerritin1, and MeFerritin1), indicating that they may possess similar biological functions. Therefore, this study helps to reveal the biological function of Ferritin homologues from Euphorbiaceae and Vitis plants.

In this work, VvFerritin1 was majorly expressed in roots of seedlings, which was consistent with Arabidopsis AtFer2 and tomato SlFerrrine1, but different from AtFerritin1, AtFerritin3, and AtFerritin4 in Arabidopsis [22], PbFerritin2 in pear [27], and MeFerritin4 in cassava [16], which are highly expressed in leaves. Given that cut rose RhFerrintin1 [14] and peach PpFerritin1 (17) are highly expressed in flowers and peach PpFerritin2 [17] is specifically expressed in young fruit, we speculate that Ferritin family genes have extensive expression profiles and VvFerritin1 is prone to be functioned in grape roots. More convincingly, a functional verification in DEY1453 mutant cells demonstrated that VvFerritin1 could transport or utilize Fe²⁺, indicating that it could be a functional Ferritin that directly contributes to Fe²⁺ accumulation and homeostasis in roots of table grape.

In pear, the expression of PbFerritin2 was reduced by Fe deficiency [27]. However, VvFerritin1 was not responsive to Fe depletion, similar to that of PpFerritin genes in peach seedlings. These findings indicate that different Ferritin family genes from perennial fruit crops are likely to possess different physiological roles due to the external Fe supply status, and VvFerritin1 may be active in table grape under excessive Fe status, but not Fe depletion treatment. Moreover, AtFerritin1 and AtFerritin3 in Arabidopsis [22] and PpFerritin1 and PpFerritin3 in peach [17] were induced by Fe toxicity and H₂O₂ stress, and RhFer1 in cut rose [14] and AtFerritin2 in Arabidopsis [22] were induced by the ABA treatment. Consistently, VvFerritin1 was responsive to Fe toxicity, H₂O₂ stress, and ABA treatment, which was mainly induced, implying that VvFerritin1 may be implicated in the Fe uptake/transport in grape roots under adverse environmental stresses, thus maintaining Fe accumulation and homeostasis, so as to secure Fe-dependent basic metabolic activities. The abrupt increase in VvFerritin1 expression may be one of the crucial indicators that vines respond to such environmental stresses.

In Arabidopsis, AtFeritin1 regulates the cellular Fe accumulation and knockout of AtFerritin1 accelerated plant senescence and impaired the normal growth [26]. The maximum expression of VvFerritin1 was observed in roots and was up-regulated under both Fe toxicity and H₂O₂ stress. Remarkably, the heterologous expression of VvFerritin1 in fer1-2 mutant effectively recovered the retarded growth of fer1-2 mutant. In particular, the Fe content and activity of Fe-dependent enzymes (ACO, NiR, and SDH) were significantly enhanced in fer1-2/35S::Ferritin1 lines, which may partially account for the restored growth performance. Over-expression of VvFerritin1 in fer1-2 mutant may positively strengthen the Fe transport and storage capacity in fer1-2/35S::Ferritin1 lines, maintaining basic Fe-dependent metabolic processes, thereby preventing the transgenic seedlings from Fe toxicity or H₂O₂ stress. Meanwhile, the Fe content and total leaf chlorophyll were indeed induced in fer1-2/35S::Ferritin1 lines. Furthermore, MeFerritin4 was up-regulated by a low temperature, and the heterologous expression of MeFerritin4 in cassava favorably enhanced plant resistance to cold stress [16]. These findings favor the proposition that Ferritin transporters are implicated in regulating Fe homeostasis and H₂O₂ induced stress in plants, especially under undesired abiotic stresses [14,15,16,17]. Nonetheless, this study provides a foundation for genetic improvement programs aimed at enhancing stress tolerance and nutrient use efficiency in table grape cultivars.

5. Conclusions

VvFerritin1 was isolated and determined from table grape. It was mainly expressed in roots and was enhanced under Fe toxicity, H₂O₂ stress, and ABA treatment. VvFerritin1 can transport Fe²⁺ in yeast mutant DEY1453. Over-expression of VvFerritin1 recovered the impaired growth of fer1-2 knockout mutant, especially under Fe toxicity and H₂O₂ stress. VvFerritin1 may be a crucial Ferritin transporter that is involved in Fe storage and homeostasis in table grape, especially under Fe toxicity or H₂O₂ stress. This study provides a foundation for genetic improvement programs aimed at enhancing stress tolerance and nutrient use efficiency in table grape cultivars.