Next Article in Journal
Successional Effects of No-Till Cover Cropping with Black Oat (Avena strigosa) vs. Soil Solarization on Soil Health in a Tropical Oxisol
Previous Article in Journal
Effects of Cold Temperature and Acclimation on Cold Tolerance and Cannabinoid Profiles of Cannabis sativa L. (Hemp)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 8
Issue 6
10.3390/horticulturae8060528
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cloning and Functional Analysis of NtMYB9 in ‘Jinzhanyintai’ of Narcissus tazetta var. chinensis

by
Keke Fan
1,2,†,
Yanjun Ma
1,2,†,
Yanting Chang
1,2,
Xiaomeng Hu
1,2,
Wenbo Zhang
1,2,
Yayun Deng
1,2,
Mengsi Xia
1,2,
Zehui Jiang
1,2,* and
Tao Hu
1,2,*
1
International Center for Bamboo and Rattan, No. 8, Futong Eastern Avenue, Wangjing Area, Chaoyang District, Beijing 100102, China
2
Key Laboratory of National Forestry and Grassland Administration/Beijing for Bamboo & Rattan Science and Technology, No. 8, Futong Eastern Avenue, Wangjing Area, Chaoyang District, Beijing 100102, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2022, 8(6), 528; https://doi.org/10.3390/horticulturae8060528
Submission received: 4 May 2022 / Revised: 31 May 2022 / Accepted: 14 June 2022 / Published: 15 June 2022
(This article belongs to the Topic Plant Breeding, Genetics and Genomics)
Browse Figures
Review Reports Versions Notes

Abstract

:
Narcissus tazetta var. chinensis M.Roem. (Chinese Narcissus) is a traditional and famous flower in China, and its corona shows a transition from green to yellow with the opening of flowers, which is of great ornamental value. To investigate the molecular mechanism of the corona color-forming in the Chinese Narcissus, in this study, a MYB gene was screened from the transcriptome of the corona by bioinformatics analysis methods, named NtMYB9. The expression level of the NtMYB9 gene was significantly higher in the corona than in the tepal, filament, ovary and leaf, and reached the highest level at the fourth period of complete coloration of the corona. The full-length sequence of the NtMYB9 coding region was cloned using the corona cDNA as a template. Sequence analysis revealed that NtMYB9 protein contained R2 and R3 domains, phylogenetic tree analysis showed that the NtMYB9 protein was most closely related to flavonol activators. Subcellular localization showed that NtMYB9 was localized in the nucleus. The overexpression of NtMYB9 gene into tobacco leaves and the expression level of seven enzyme genes related to the flavonoid biosynthesis pathway were significantly up-regulated. The transient transformation of Petunia × hybrida (Petunia) and Phalaenopsis aphrodite (Phalaenopsis) significantly revealed that the NtMYB9 gene could turn flowers yellow. These results suggest that the NtMYB9 gene is involved in the positive regulation of flavonoid biosynthesis in the Chinese Narcissus and may promote the synthesis of flavonols. In conclusion, these findings provide a valuable resource for further studies on the regulatory mechanism of the flavonoid biosynthesis pathway, and they are also beneficial to the molecular breeding of Chinese Narcissus.

1. Introduction

Chinese Narcissus (N. tazetta var. chinensis M.Roem.) is a traditional and famous flower in China [1], with beautiful posture, bright flower color, beautiful flower shape, freshness and elegance, which is of great ornamental value [2]. Compared with other flowers, the Chinese Narcissus lack the key gene ANS for anthocyanin synthesis, so there are fewer color varieties, and the flower colors are mainly yellow and white. Flower color is one of the most important traits of ornamental plants, and ‘Jinzhanyintai’, as a cultivar of Chinese Narcissus, has six white tepals and a yellow wineglass-shaped corona. Yellow is popular as the symbolic color of Chinese culture and Chinese civilization, and the wineglass-shaped corona is of great ornamental value [3,4]. It is one of the hot spots for breeders to analyze the mechanism of flower color-forming and to innovate new varieties of flower color using molecular biology tools.
The research on the flavonoid biosynthetic pathway of plant is relatively mature, and the metabolic pathway has been basically clarified, in which the flavonoid metabolites are one of the most important pigments of ornamental plants [5]. In higher plants, the flavonoid biosynthesis pathway is influenced by a variety of transcription factors, and the transcription factors in the flavonoid synthesis pathway are mainly MYB, bHLH and WD40, etc. The MBW (MYB-bHLH-WD40) complex is also jointly involved in the expression of related enzyme genes in the flavonoid synthesis pathway [6]. The MYB is one of the transcription factor families with the largest number of studies and the most extensive roles in ornamental plants. Most MYB transcription factors belong to R2R3-MYB [7], which directly regulates the transcription and expression of related enzyme genes by binding to their promoters [8], thereby activating or repressing the synthesis of flavonoid metabolites [9], which in turn affects the production and accumulation of phytochrome [10]. Currently, many MYB transcription factors that regulate plant flower color have been identified in many ornamentals and model plants. Some of these MYB factors can activate the expression of relevant genes in the flavonoid biosynthetic pathway and promote the synthesis and accumulation of anthocyanins [11], such as AtMYB75 and AtMYB90 in Arabidopsis thaliana [12], MdMYB1 in Malus domestica [13], and VvMYBA1 and VvMYBA2 in Vitis vinifera [14,15]. Several MYB transcriptional repressors have also been identified in the flavonoid biosynthesis pathway of plants, such as AtMYB3 and AtMYB4 in A. thaliana [16], FaMYB1 in Fragaria × ananassa [17], PpMYB18 in Prunus persica [18], VvMYBC2-L2 and VvMYBC2-L3 in V. vinifera [19,20], which inhibit the expression of downstream genes related to the flavonoid biosynthesis pathway, thereby suppressing the synthesis of anthocyanins.
In recent years, R2R3-MYB transcription factors have been characterized to regulate the flavonoid synthesis pathway in the corona of the Chinese Narcissus, but most of them are transcriptional repressors [21], and there are fewer studies about the flavonoid biosynthesis pathway in the color-forming mechanism of the corona during the flowering of the Chinese Narcissus. Therefore, the research on the color-forming mechanism of the corona is very meaningful.
In this study, based on the transcriptomic data of the corona coloring process in the Chinese Narcissus ‘Jinzhanyintai’ (unpublished), using the MYB protein sequences of A. thaliana and O. sativa as query sequences and identifying the MYB sequences of the Chinese Narcissus by HEMMER and MEGA7, a differentially expressed MYB transcription factor related to the flavonoid biosynthesis pathway was screened and named NtMYB9. The sequence and expression pattern of the NtMYB9 gene were analyzed, and its function in the flavonoid biosynthesis pathway of the corona was analyzed by subcellular localization and transient transformation, with a view to providing a theoretical basis for conducting research on the flavonoid metabolic regulatory network and flower color innovation in the Chinese Narcissus.

2. Materials and Methods

2.1. Plant Materials

Chinese Narcissus ‘Jinzhanyintai’ plants were purchased in Zhangzhou, Fujian, China and grown in an artificial climate chamber in December at 20 °C for 16 h in the light, 16 °C for 8 h in the dark, with a humidity of 70%. The corona, tepal, filament, ovary and leaf from the same period were collected from the largest flower on the inflorescence during the five periods of the flowering process (Figure 1), wrapped with tin foil, quick-frozen in liquid nitrogen for 10 min and stored in a −80 °C refrigerator for later use.
Nicotiana benthamiana (Tobacco) was grown in a light incubator at 22 °C for 22 h of light, 2 h of dark at 50–70% humidity for transient transformation assays. ‘W115’ P. × hybrida (Petunia) and ‘Hangzhoumeinu’ P. aphrodite (Phalaenopsis) were used for the transient transformation assays and grown in the artificial climate chamber at 22 °C for 14 h in the light and 20 °C for 10 h in the darkness. Petunia were given by Associate Professor Hu Huirong of Huazhong Agricultural University, Wuhan, China, and Phalaenopsis were purchased from Chaolai Spring Flower Market, Beijing, China.

2.2. Total RNA Extraction and cDNA Synthesis

The total RNA of the ‘Jinzhanyintai’ corona, tepal, filament, ovary and leaf were extracted using the Quick RNA Isolation Kit (0416-50GX, Huayueyang, Beijing, China), according to the manufacturer’s instructions. The RNA concentration was tested by NanoDrop2000. And the clarity and integrity of band was checked using 1% agarose gel electrophoresis. The RNA was reverse transcribed using the Reverse Transcription Kit (A3500, Promega, Madison, WI, USA), according to the manufacturer’s instructions. The RT-PCR reaction system (20 µL total volume) was as follows: 4 μL of 25 mM MgCl2, 2 μL of RT 10× Buffer, 2 μL of 10 mM dNTP Mixture, 0.5 μL of Recombinant RNasin Ribonuclease Inhibitor, 0.63 μL of AMV Reverse Transcriptase, 0.5 μL of Oligo(dT)15 Primer, 1 μg of total RNA and ddH2O up to 20 μL. The cDNA was stored in the refrigerator at −20 °C for later use.

2.3. Screening of NtMYB9 Gene

The basic local alignment search tool (BLAST) [22] was used to screen out homologous NtMYB gene sequences, based on the transcriptome data of corona at five periods in ‘Jinzhanyintai’ and 419 MYB protein sequences of A. thaliana and Oryza sativa from the PlantTFDB (http://planttfdb.gao-lab.org/index.php, accessed on 12 October 2020) database [23]. HMMER (https://www.ebi.ac.uk/Tools/hmmer/search/hmmsearch, accessed on 15 October 2020) [24] was used to check the sequences of NtMYB for MYB conserved domains, and those without MYB domains were removed. The sequences with MYB domains were constructed in the MEGA7 software (V7.0.21) by the neighbor-joining (NJ) method [25,26] and the same sequences and the sequences that could not be clustered into one branch were removed. The NtMYB were compared with all the different expression genes (DEGs) in the corona transcriptome, and a MYB transcription factor gene related to flavonoid biosynthesis was screened and named NtMYB9.

2.4. Fluorescence Quantification of NtMYB9 in ‘Jinzhanyintai’

Quantitative reverse-transcription PCR assays (qRT-PCR) were carried out to detect the expression level of NtMYB9 gene in different tissues and five periods of the corona coloring process in ‘Jinzhanyintai’ (Figure 1). Based on the sequence of NtMYB9, qRT-PCR-specific primers with a single common PCR gel band were designed using SnapGene software (V2.3.2) (Table 1). The Actin gene (GenBank accession number JN204912.1), reported by Wang Guiqing, was used as the internal reference gene [27]. The qRT-PCR assays were performed using TB Green Premix Ex Taq Ⅱ (RR820A, Takara, Kusatsu, Japan), following the manufacturer’s recommendations. The PCR reaction system (10 µL total volume) contained 5 µL of TB Green Premix Ex Taq, 1 µL of cDNA template, 0.4 µL of (F + R) primer and 3.6 µL of ddH2O, and three biological replicates were performed. The PCR program was carried out with 95 °C pre-denaturation for 30 s, 40 cycles of 95 °C for 5 s and 62 °C for 30 s, the melting curve was 60 °C to 95 °C and the temperature was increased by 1 °C every 15 s. When the peak of the melting curve appeared single and smooth above 85 °C, the experimental results were reliable. Then the relative expression level of the NtMYB9 gene at different tissues and corona coloring processes in ‘Jinzhanyintai’ were calculated by the 2−ΔΔCt method [28], with the expression level in the filament and in the first period of corona being the control group.

2.5. Cloning of NtMYB9 Gene

Primers of the NtMYB9 gene were designed using SnapGene software (V2.3.2) (Table 1). The target full-length gene was amplified using the LA Taq kit (iRR002A, TaKaRa) with corona cDNA as the template. PCR products were detected by 1% agarose gel electrophoresis, and the target bands were recycled using a Agarose Gel DNA Extraction Kit (DP103-03, Tiangen, Beijing, China). Then, the target sequence was ligated to the pMD19-T vector at room temperature by the pMDTM19-T Vector Cloning Kit (6013, TaKaRa) and the ligation products were transformed into a DH5α Escherichia coli competent cell. The correct plasmids solution was sent to the company Anshengda, Beijing, China, for sequencing after colony PCR validation and plasmids extraction (DP103, Tiangen).

2.6. Bioinformatics Analysis of NtMYB9

The MYB protein sequences of the flavonoid synthesis pathways from other species were obtained from National Center for Biotechnology Information (NCBI: https://www.ncbi.nlm.nih.gov/, accessed on 17 May 2021) public databases. The multiple sequences alignment was performed utilizing the amino acid sequences of NtMYB9 and other R2R3-MYB proteins in Citrus sinensis, Diospyros kaki, F. × ananassa, M. domestica, V. vinifera, Zea mays, P. × hybrida and A. thaliana through DNAMAN software (V6.0.3.99). The phylogenetic tree was constructed with the NtMYB9 protein sequence and MYB protein sequences in 13 species using MEGA7 software through the neighbor-joining method (NJ) and 1000 bootstrap replicates. The NtMYB9 protein sequences was submitted to MEME (http://meme-suite.org/tools/meme, accessed on 21 May 2021) for motif analysis along with the MYB protein sequences from other species [29], with parameters set to an expected motif site distribution of 0 or 1, the number 8, and a width of 5 to 50.

2.7. Construction of Plant Overexpression Vectors

Restriction endonucleases (New England Biolabs, Inc., Ipswich, MA, USA) KpnⅠ and BamHI were used for double digestion of the P1300-LV-GFP (35S::-GFP) plasmid (Shanghai Weidi Biotechnology Co., Ltd., Shanghai, China) to obtain single-stranded vector. Based on the digestion site of the P1300-LV-GFP vector and the CDS sequence of NtMYB9, seamless cloning primers were designed by SnapGene software (V2.3.2) (Table 1). Seamless cloning was performed by KOD DNA polymerase (KOD-401, TOYOBO) using the pMD19-T vector ligated with the full-length cDNA of NtMYB9 as a template. The DNA products were recycled and ligated with the single-stranded vector plasmids of P1300-LV-GFP to construct the plant overexpression vectors, P1300-LV-NtMYB9-GFP (35S::NtMYB9-GFP), using the 2×EasyGeno Assembly Mix Kit (VI201-02, Tiangen). NtMYB9 was expressed under the control of the 35S promoter. The 10 µL reconstitution system contained 5 µL of 2×EasyGeno Assembly Mix, 2.5 µL of the single-stranded vector plasmids and 2.5 µL of PCR fragment. The reconstitution reaction system was put in a 50 °C water-bath for 30 min, then transformed into a DH5α E. coli competent cell and placed in an incubator at 37 °C for 16 h. Single colonies were picked, identified by colony PCR, and sent to the company Anshengda, Beijing, China, for sequencing. The plasmids of the correctly sequenced colonies were extracted and stored in a refrigerator at 20 °C.

2.8. Subcellular Localization Assay of NtMYB9 Proteins in Tobacco

The plant overexpression vector plasmid, P1300-LV-NtMYB9-GFP, was transferred into GV3101 Agrobacterium tumefaciens competent cells (Shanghai Weidi Biotechnology Co., Ltd., Shanghai, China) by heat stimulation. The single colonies were cultured for 60 h and identified by colony PCR. Positive single colonies were picked and placed into 20 mL LB liquid medium containing 50 mg/L kanamycin and 25 mg/L rifampicin and incubated at 28 °C with shaking at 200 rpm until the OD600 value was about 0.5. The bacteria were collected by centrifugation at 28 °C and 5000 rpm for 10 minutes and resuspended in infection solution (10 mM MES-KOH, 10 mM MgCl2, 200 µM AS) until OD600 = 0.5 at room temperature for 2–3 h. Infection solution was injected into the back of tobacco leaves using a de-needled 1 mL sterile syringe. Transferred to a light incubator for 2–4 d after 1 d of dark incubation, after which the infected tobacco leaves were cut and stained with the DPAI solution (C0060, Solarbio) for 10 min at room temperature, rinsed 2–3 times with PBS solution. The fluorescence signal was observed using a Zeiss Axio Imager M2 microscope (Zeiss, Germany); GFP fluorescence was excited at 488 nm and DAPI fluorescence was excited at 365 nm. The plant expression vector plasmid P1300-LV-GFP was used as a positive control and treated as P1300-LV-NtMYB9-GFP.

2.9. Fluorescence Quantification of Flavonoid-Related Enzyme Genes in Tobacco

Three tobacco plants in good growth condition were selected. Their leaves were injected with infection solution with P1300-LV-NtMYB9-GFP. While the other three non-infected tobacco plants were selected as blank controls grown in the same conditions as the infected tobacco plants. All tobacco plants were incubated in the dark for 1 d and then transferred to a light incubator. The expression of the NtMYB9 gene was viewed by the GFP fluorescence signal using a Zeiss Axio Imager M2 microscope. Tobacco leaves with the strongest GFP fluorescence signals and non-infected tobacco leaves from the same period were collected and immediately frozen in liquid nitrogen. RNA was extracted from the above tobacco leaf samples and reverse transcribed into cDNA.
The expression levels of PAL (phenylalanine ammonia-lyase), 4CL (4-coumarate CoA ligase), CHS (chalcone synthase), CHI (chalcone isomerase), F3′H (flavonoid 3′-hydroxylase), F3H (flavonoid 3-hydrox-ylase), FLS (flavonol synthase), DFR (dihydroflavonol 4-reductase), ANS (anthocyanidin sythase), UFGT (glucose-flavonoid 3-o-glucosyltransferase), LAR (leucoanthocyanidin reductase) and ANR (anthocyanidin reductase) of the flavonoid synthesis pathway in tobacco were detected by qRT-PCR, and the primers of enzyme genes were designed with reference to Guiqing Wang (Table 2) [30].

2.10. Transient Transformation Assay of NtMYB9 Proteins in Petunia and Phalaenopsis

Positive single colonies were shaken in 20 mL LB liquid medium containing 50 mg/L kanamycin and 25 mg/L rifampicin at 28 °C and 200 rpm until the OD600 value was about 0.6, centrifuged at 4 °C and 5000 rpm for 10 min to collect the bacteria, which were the GV3101 A. tumefaciens competent cells, in which the plant overexpression vector plasmid P1300-LV-NtMYB9-GFP was transferred. The bacteria were resuspended in the infection solution (4.43 g MS powder was added to 1 L ddH2O, sterilized at 121 °C for 25 min and 200 mmol/L AS for 500 µL was added before use) at room temperature for 2–3 h until OD600 = 0.6, generating the suspension [31]. Then, the suspension was slowly injected into newly opened petals of Petunia and fully opened petals and sepals of Phalaenopsis using a de-needled 1 mL sterile syringe. Petunia and Phalaenopsis were incubated in the dark for 1 d, then transferred to the artificial climate chamber and continuously observed after transient transformation.

3. Results and Analysis

3.1. Determination of the Periods of Corona Coloring Process

The corona coloring process of the ‘Jinzhanyintai’ was divided into five periods (Figure 1). ‘Jinzhanyintai’ were cultivated with hydroponics until the scape was drawn and the states of involucre and inflorescence during the flowering process were observed. The color of the corona showed a transition from green to yellow as the flowers of ‘Jinzhanyintai’ opened. The transformation of the flower color was recorded with reference to the fifth edition of the Royal Horticultural Society color chart. The corona coloring process was divided into five periods. In the first period, before the rupture of the involucre of the inflorescence, the corona was green, with the color code GREEN GROUP 143-B; in the second period, after the rupture of the involucre, the inflorescence was fully extracted and the florets were exposed, the corona was yellow-green, with the color code YELLOW–GREEN GROUP 144-A; in the third period, the tepal was slightly expanded, the corona was yellow-green, with the color code YELLOW–GREEN GROUP N144-A; in the fourth period, the flowers were fully opened, the tepal was fully expanded, the corona was yellow, with color code YELLOW GROUP 13-A; in the fifth period, 4 d, after the flowers were fully opened, the tepal and corona color were the same as the fourth period, and the corona was yellow, with color code YELLOW GROUP 13-A.

3.2. Screening for a Transcription Factor Involved in Corona Coloring

Previous studies have shown that NtMYBs is related to the color-forming of the yellow corona. A NtMYB gene was a differentially expressed gene (DEG) in the third-generation and second-generation transcriptome database of the corona coloring process (unpublished). Then, the NtMYB gene was obtained using the MYB protein sequences of A. thaliana and O. sativa as query sequences and identified by HEMMER and MEGA7 as a member of the MYB gene family, named NtMYB9 with the GenBank accession number OM925904.

3.3. Analysis of Tissue Expression Specificity and Cloning of NtMYB9

To investigate the function of NtMYB9 in the coloration process of ‘Jinzhanyintai’, the expression pattern of NtMYB9 in N. tazetta var. chinensis M.Roem. was quantified by qRT-PCR. The result showed that the expression level of the NtMYB9 gene was significantly different in different tissues of ‘Jinzhanyintai’ (Figure 2A) and was significantly higher in the corona than in other tissues, followed by in the tepal, and almost not expressed in the filaments. NTMYB9 was four times more abundantly expressed in the corona than in the tepal. The expression of NtMYB9 was also detected in five periods of the corona coloration process. The result revealed that NtMYB9 was expressed in all five periods (Figure 2B), with the highest expression level in the fourth period of complete coloration, a low expression level in the third and fifth periods and almost no expression in the first and second periods. This result was consistent with the expression level of NtMYB9 in the transcriptome database. Then, the full-length sequence of the NtMYB9 gene was obtained by cloning.

3.4. Bioinformatics Analysis of NtMYB9 Protein

The bioinformatics analysis of NtMYB9 was analyzed. The results revealed that the open reading frame (ORF) of the NtMYB9 gene was 1008 bp, which encoded 336 amino acids. A sequence analysis revealed that NtMYB9 protein contained the R2 and R3 MYB DNA-binding domains, indicating that NtMYB9 protein was a R2R3-MYB transcription factor (Figure 3). The phylogenetic tree, constructed by MEGA7 software, revealed that 26 MYB sequences from 13 species were divided into two groups. The activators of the flavonoid biosynthesis pathway were clustered into one group, including three branches of the Anthocyanin pathway, Proanthocyanin pathway and flavonol pathway, in which NtMYB9 protein and flavonol activators were on one branch, such as AtMYB11 and AtMYB111 from A. thaliana [7], MdMYB22 [32] in M. domestica and CsMYBF1 [33] in C. sinensis. The inhibitors of flavonoid synthesis pathway were clustered into one group, including MYB4-like and FaMYB1-like branches (Figure 4A). The conserved motifs of the 26 MYB proteins sequences from 13 species were analyzed, and a total of 8 conserved motif were identified (Figure 4B). Motif 1 was R3-MYB, which was presented in all branches. Motif 2 was the R2-MYB and was highly conserved. Motif 7 was presented only in the branches of Anthocyanin pathway and Proanthocyanidin pathway. Motif 5 and Motif 8 were specific to MYB4-like branch and had the function of MYB4-like proteins.

3.5. Subcellular Expression of NtMYB9 in Tobacco

In order to explore the subcellular localization of the NtMYB9 protein, the NtMYB9 gene was constructed into the P1300-LV-GFP vector and expressed as a fusion with the GFP gene. The fluorescence signals of the NtMYB9 protein were observed under microscope. It was found that the green fluorescence signals excited by GFP were localized in the nucleus of epidermal cells in tobacco and overlapped with the blue fluorescence signals excited by DAPI, while the control group was observed with green fluorescence signals in both the cell membrane and nucleus, and the green fluorescence signals in the nucleus overlapped with the blue fluorescence signals (Figure 5). It indicated that the NtMYB9 gene mainly functions in the nucleus as a transcription factor.

3.6. Effect of Transient Expression of NtMYB9 on Expression of Flavonoid-Related Genes in Tobacco

To investigate the function of the NtMYB9 gene, NtMYB9 gene was overexpressed in tobacco leaves. The expression level of the enzyme genes related to flavonoid biosynthesis in common and transgenic tobacco plants was analyzed by qRT-PCR assays. This revealed that the expression levels of PAL and 4CL in transgenic tobacco leaves were significantly up-regulated and the expression levels of CHI, F3′H, FLS, DFR and UFGT were up-regulated, while the expression levels of CHS, F3H, ANS, LAR and ANR were not significantly changed compared with common tobacco (Figure 6).

3.7. Effect of Transient Expression of NtMYB9 in Petunia and Phalaenopsis on Coloring

To further investigate the function of NtMYB9, P1300-LV-NtMYB9-GFP fusion overexpression vectors were transformed into ‘W115’ Petunia and ‘Hangzhoumeinv’ Phalaenopsis. The overexpression vectors of P1300-LV-NtMYB9-GFP and P1300-LV-GFP transformed into ‘W115’ Petunia and the petals of transgenic Petunia became significantly more yellow and were similar to the base of petals compared with those transferred into P1300-LV-GFP in color (Figure 7A). The flower colors of the transgenic Phalaenopsis became significantly more yellow compared with the control group (Figure 7B). The results indicated that the NtMYB9 gene had a role in promoting the synthesis of yellow metabolites in the petals and sepals of Phalaenopsis.

4. Discussion

N. tazetta var. chinensis M.Roem. have a high economic value as annual flowers. The pigment components in the yellow corona of Chinese Narcissus mainly include flavonol and flavonoid metabolites in the flavonoid synthesis pathway. With the growth and development of ornamental plants, the pigment content in flowers changes continuously. The color of the corona shows a transition from green to yellow with the opening of flowers in ‘Jinzhanyintai’. In this study, the coloration process of the corona was divided into five periods. Due to the spatiotemporal specificity of gene expression in plants, it was found using fluorescence quantitative assays that the NtMYB9 gene had the highest expression in the corona of ‘Jinzhanyintai’. The expression level of the NtMYB9 gene was continuously up-regulated during the coloration process, with a sudden increase in the fourth period when the corona becames completely yellow and a significant decrease in the fifth period. Therefore, it is speculated that the NtMYB9 gene mainly functions during the fourth period of the corona coloration process and plays a role in the synthesis of metabolites related to the flavonoid synthesis pathway.
MYB transcription factors are widely involved in the flavonoid biosynthesis pathway of plants [34,35]. The results of subcellular localization assays showed that the NtMYB9 protein was localized in the nucleus of epidermal cells in tobacco leaves, which indicated that the NtMYB9 gene had the general characteristics of transcription factors. Sequence analysis revealed that NtMYB9 protein was the R2R3-MYB transcription factor with the motifs of R2-MYB and R3-MYB and was highly homologous to other R2R3-MYB plants, such as MdMYB22 in M. domestica. Phylogenetic tree analysis revealed that the NtMYB9 protein was clustered with other flavonol activators, such as AtMYB11 and AtMYB111 in A. thaliana and CsMYBF1 in C. sinensis, and they could control the synthesis of flavonols by activating the expression of related genes (CHS, CHI, F3H, FLS, etc.) in the flavonoid biosynthesis pathway [36]. Therefore, it was hypothesized that the NtMYB9 gene plays a transcription-promoting role in the flavonoid biosynthetic pathway by activating the expression of enzyme genes.
Tobacco and Petunia are commonly used for the verification of flower color genes. Their transformation systems have matured, and good experimental results are obtained [30,37]. Transient transformation is widely used to verify the function of plant flower color genes and is a technique with a short experimental period and the ability to obtain transient high expression level of the target genes [38]. The flavonoid biosynthesis pathway is known to have several branches, such as the flavonol pathway, anthocyanin pathway and proanthocyanidin pathway [39]. In the flavonoid biosynthesis pathway, Phenylalanine is synthesized as Dihydroflavonol by PAL, C4H, 4CL, CHS, CHI, F3′H, F3H and F3′5′H [40]. Dihydroflavonol is produced as a flavonol by FLS; Dihydroflavonol can also be synthesized as Leucoanthocyanidin by DFR; Leucoanthocyanidin is synthesized as Anthocyanin by ANS; Anthocyanin is modified to form stable and colorful Arachidoside by UFGT and MT; and Leucoanthocyanidin and Anthocyanin are synthesized as Proanthocyanidin by LAR and ANR, respectively [41]. It was found that the color of transgenic tobacco leaves had no significant change from transient transformation. Furthermore, fluorescence quantitative PCR assays revealed that the expression levels of seven flavonoid-related genes, PAL, 4CL, CHI, F3′H, FLS, DFR and UFGT, were significantly increased in tobacco leaves with the overexpression of the NtMYB9 gene. It indicated that the NtMYB9 gene as a transcriptional activator could promote the expression level of most enzyme genes in flavonoid biosynthesis pathway of tobacco. The expression levels of FLS and DFR were both up-regulated in the transgenic tobacco, so it was hypothesized that the content of flavonols and leucoanthocyanidins were increased in the leaves of transgenic tobacco. As the expression level of ANS, LAR and ANR had no significant change, the leucoanthocyanidins accumulated by DFR were not converted into anthocyanins and proanthocyanidins. The color of flavonols is usually yellowish, so the accumulation of flavonols content did not lead to significant changes in tobacco leaf color.
Further validation through the transient transformation of ‘W115’ Petunia and ‘Hangzhoumeinv’ Phalaenopsis showed clearly that the overexpression of the NtMYB9 gene turned the flowers of Petunia and Phalaenopsis yellow. As for the tissue specificity of the gene expression in the plants, the petals in petunia are white and the petal bases are yellow, so the genes controlling the synthesis of yellow metabolites are expressed in the petal bases. The overexpression of the NtMYB9 gene into petunia petals showed that the petal discoloration sites were similar to the color of the petal bases. It was speculated that the NtMYB9 gene might promote the expression level of flavonoid-related genes in ‘W115’ petunia petals to produce yellow metabolites to make the petals yellow. The yellow metabolites might be flavonols. However, this speculation needs to be further verified. Both FLS and DFR act on Dihydroflavonol in the flavonoid biosynthesis pathway, so there is substrate competition between the flavonol pathway and the anthocyanin pathway [42]. The main pigment component in the petals and sepals of Phalaenopsis is anthocyanins [43], and flavonoids and flavonols are auxiliary pigments of arachidosides [44]. The flavonoid metabolites in the corona of Chinese Narcissus are mainly flavonols, and since there is no ANS gene in Chinese Narcissus, the flavonoid synthesis pathway cannot flow toward the anthocyanin synthesis pathway [27]. All of these led to the speculation that the overexpression of the NtMYB9 gene allowed the substrate that synthesizes arachidoside to be used for the synthesis of flavonols, causing Phalaenopsis flowers to turn yellow, but this speculation needs further research.

5. Conclusions

In this study, a R2R3-MYB transcription factor gene with R2 and R3 conserved motifs and the highest expression and specificity in the corona of N. tazetta var. chinesis M.Roem. was identified by bioinformatics, cloned and named NtMYB9. NtMYB9 played a role in the corona coloring process. Furthermore, the NtMYB9 gene could up-regulate the expression level of related genes and promote the synthesis of metabolites in the flavonoid biosynthesis pathway.

Author Contributions

Conceptualization, K.F., Y.M., Z.J. and T.H.; methodology, K.F., Y.M. and X.H.; software, K.F. and Y.C.; validation, W.Z., Y.D. and Y.C.; data curation, K.F. and X.H.; writing—original draft preparation, K.F., Y.M. and M.X.; writing—review and editing, K.F., Y.M. and T.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by ICBR Fundamental Research Funds Grant (NO. 1632020021 and NO. 1632021018).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data in this study can be found in the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jiang, Z.; Peng, Z. Chinese Narcissus; China Forestry Publishing House: Beijing, China, 2014; ISBN 978-75-0386-911-2. [Google Scholar]
  2. Cheng, J. Chinese Narcissus Origin Examination. Jiangsu Soc. Sci. 2011, 6, 238–245. [Google Scholar]
  3. Zeng, L.; Luo, P.; Wu, X. Expression of Flavonoid Biosynthetic Genes in Narcissus tazetta var. chinensis. Mod. Landsc. Archit. 2015, 12, 295–296. [Google Scholar]
  4. Chen, D.; Gao, J.; Peng, Z. Advances and Perspectives in Studies on Narcissus plants. Sci. Silvae Sin. 2008, 44, 140–146. [Google Scholar]
  5. Grossmann, K.; Schmülling, T. The Effects of the Herbicide Quinclorac on Shoot Growth in Tomato Is Alleviated by Inhibitors of Ethylene Biosynthesis and by the Presence of an Antisense Construct to the 1-Aminocyclopropane-1-Carboxylic Acid (ACC) Synthase Gene in Transgenic Plants. Plant Growth Regul. 1995, 16, 183–188. [Google Scholar] [CrossRef]
  6. Xu, W.; Dubos, C.; Lepiniec, L. Transcriptional Control of Flavonoid Biosynthesis by MYB-BHLH-WDR Complexes. Trends Plant Sci. 2015, 20, 176–185. [Google Scholar] [CrossRef]
  7. Dubos, C.; Stracke, R.; Grotewold, E.; Weisshaar, B.; Martin, C.; Lepiniec, L. MYB Transcription Factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef]
  8. Meng, J.; Gao, Y.; Han, M.; Liu, P.; Yang, C.; Shen, T.; Li, H. In Vitro Anthocyanin Induction and Metabolite Analysis in Malus Spectabilis Leaves Under Low Nitrogen Conditions. Hortic. Plant J. 2020, 5, 284–292. [Google Scholar] [CrossRef]
  9. Czemmel, S.; Heppel, S.C.; Bogs, J. R2R3 MYB Transcription Factors: Key Regulators of the Flavonoid Biosynthetic Pathway in Grapevine. Protoplasma 2012, 249, 109–118. [Google Scholar] [CrossRef]
  10. Xing, W.; Jing, X. Recent Advances of MYB Transcription Factors Involved in the Regulation of Flavonoid Biosynthesis. Mol. Plant Breed. 2015, 13, 689–696. [Google Scholar]
  11. Nishihara, M.; Nakatsuka, T. Genetic Engineering of Flavonoid Pigments to Modify Flower Color in Floricultural Plants. Biotechnol. Lett. 2011, 33, 433–441. [Google Scholar] [CrossRef]
  12. Shi, Q.; Zhou, L.; Li, K.; Wang, Y. Transcriptional Regulation Involved in Anthocyanin Biosynthesis in Plants. For. Res. 2015, 4, 570–576. [Google Scholar]
  13. Hu, D.; Sun, C.; Ma, Q.; You, C.; Hao, Y. MdMYB1 Regulates Anthocyanin and Malate Accumulation by Directly Facilitating Their Transport into Vacuoles in Apples. Plant Physiol. 2016, 170, 1315–1330. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Fan, X.; Zhao, R.; Wang, Q.; Liu, C.; Fang, J. Anthocyanin Composition and MybA-Related Genotype in Kyoho Grape and Its Derivatives. HortScience 2018, 53, 1766–1771. [Google Scholar] [CrossRef] [Green Version]
  15. Terrier, N.; Torregrosa, L.; Ageorges, A.; Vialet, S.; Verries, C.; Cheynier, V.; Romieu, C. Ectopic Expression of VvMybPA2 Promotes Proanthocyanidin Biosynthesis in Grapevine and Suggests Additional Targets in the Pathway. Plant Physiol. 2009, 149, 1028–1041. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Yang, L.; Wang, Y.; Yang, J.; Li, Y. Research Advances on Negative Regulators of Anthocyanin Accumulation. Acta Hortic. Sin. 2014, 9, 1873–1884. [Google Scholar]
  17. Schaart, J.G.; Dubos, C.; Romeo De La Fuente, I.; van Houwelingen, A.M.M.L.; de Vos, R.C.H.; Jonker, H.H.; Xu, W.; Routaboul, J.M.; Lepiniec, L.; Bovy, A.G. Identification and Characterization of MYB-BHLH-WD40 Regulatory Complexes Controlling Proanthocyanidin Biosynthesis in Strawberry (Fragaria × Ananassa) Fruits. New Phytol. 2013, 197, 454–467. [Google Scholar] [CrossRef]
  18. Zhou, H.; Lin-Wang, K.; Wang, H.; Gu, C.; Dare, A.P.; Espley, R.V.; He, H.; Allan, A.C.; Han, Y. Molecular Genetics of Blood-fleshed Peach Reveals Activation of Anthocyanin Biosynthesis by NAC Transcription Factors. Plant J. 2015, 82, 105–121. [Google Scholar] [CrossRef]
  19. Zhu, Z.; Li, G.; Liu, L.; Zhang, Q.; Han, Z.; Chen, X.; Li, B. A R2R3-MYB Transcription Factor, VvMYBC2L2, Functions as a Transcriptional Repressor of Anthocyanin Biosynthesis in Grapevine (Vitis vinifera L.). Molecules 2018, 24, 92. [Google Scholar] [CrossRef] [Green Version]
  20. Cavallini, E.; Matus, J.T.; Finezzo, L.; Zenoni, S.; Loyola, R.; Guzzo, F.; Schlechter, R.; Ageorges, A.; Arce-Johnson, P.; Tornielli, G.B. The Phenylpropanoid Pathway Is Controlled at Different Branches by a Set of R2R3-MYB C2 Repressors in Grapevine. Plant Physiol. 2015, 167, 1448–1470. [Google Scholar] [CrossRef]
  21. Wu, L.; Zhou, P.; Fan, Y.; Wang, G.; Zeng, L. Cloning and Functional Analysis of NtMYB8 in Narcissus tazetta var. chinensis. Acta Hortic. Sin. 2021, 48, 1895–1906. [Google Scholar]
  22. Altschul, S.F. Basic Local Alignment Search Tool (BLAST). J. Mol. Biol. 2012, 215, 403–410. [Google Scholar] [CrossRef]
  23. Jin, J.; Tian, F.; Yang, D.C.; Meng, Y.Q.; Kong, L.; Luo, J.; Gao, G. PlantTFDB 4.0: Toward a Central Hub for Transcription Factors and Regulatory Interactions in Plants. Nucleic Acids Res. 2017, 45, D1040–D1045. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Finn, R.D.; Clements, J.; Eddy, S.R. HMMER Web Server: Interactive Sequence Similarity Searching. Nucleic Acids Res. 2011, 39, 29–37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Saitou, N.; Nei, M. The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
  27. Wang, G.; Yang, B.; Wu, J.; Luo, P.; Muhammad, A. Identification of Genes Involved in Flavonoid Biosynthesis of Chinese Narcissus (Narcissus tazetta L. var. chinensis). Plant Mol. Biol. Rep. 2018, 36, 812–821. [Google Scholar] [CrossRef]
  28. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−∆∆CT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  29. Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for Motif Discovery and Searching. Nucleic Acids Res. 2009, 37, W202–W208. [Google Scholar] [CrossRef]
  30. Wang, G.; Yao, H.; Wu, J.; Muhammad, A.; Zeng, L. Cloning and Functional Characterization of NtMYB7 Gene in Narcissus tazetta var. chinensis. Acta Bot. Boreali Occident. Sin. 2018, 38, 33–42. [Google Scholar]
  31. Meng, N.; Liu, Y.; Dou, X.; Liu, H.; Li, F. Transient Gene Expression in Phalaenopsis aphrodite Petals via Agrobacterium tumefaciens Infiltration. Acta Bot. Boreali Occident. Sin. 2018, 38, 1017–1023. [Google Scholar]
  32. Hellens, R.P.; Allan, A.C.; Friel, E.N.; Bolitho, K.; Grafton, K.; Templeton, M.D.; Karunairetnam, S.; Gleave, A.P.; Laing, W.A. Transient Expression Vectors for Functional Genomics, Quantification of Promoter Activity and RNA Silencing in Plants. Plant Methods 2005, 1, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Liu, C.; Long, J.; Zhu, K.; Liu, L.; Yang, W.; Zhang, H.; Li, L.; Xu, Q.; Deng, X. Characterization of a Citrus R2R3-MYB Transcription Factor That Regulates the Flavonol and Hydroxycinnamic Acid Biosynthesis. Sci. Rep. 2016, 6, 25352. [Google Scholar] [CrossRef] [PubMed]
  34. Boase, M.R.; Brendolise, C.; Wang, L.; Ngo, H.; Espley, R.V.; Hellens, R.P.; Schwinn, K.E.; Davies, K.M.; Albert, N.W. Failure to launch: The self-regulating Md-MYB10 R6 gene from apple is active in flowers but not leaves of Petunia. Plant Cell Rep. 2015, 34, 1817–1823. [Google Scholar] [CrossRef] [PubMed]
  35. Zhou, H.; Lin-Wang, K.; Wang, F.; Espley, R.V.; Ren, F.; Zhao, F.; He, H.; Jiang, Q.; Allan, A.; Han, Y. Activator type R2R3-MYB genes induce a repressor type R2R3-MYB gene to balance anthocyanin and proanthocyanidin accumulation. New Phytol. 2018, 221, 1919–1934. [Google Scholar] [CrossRef] [Green Version]
  36. Stracke, R.; Ishihara, H.; Huep, G.; Barsch, A.; Weisshaar, B. Differential Regulation of Closely Related R2R3-MYB Transcription Factors Controls Flavonol Accumulation in Different Parts of the Arabidopsis Thaliana Seedling. Plant J. 2007, 50, 660–677. [Google Scholar] [CrossRef] [Green Version]
  37. Li, B.; Zheng, B.; Wang, J.; Tsai, W.C.; Lu, H.; Zou, L.; Wan, X.; Zhang, D.; Qiao, H.; Liu, Z. New Insight into the Molecular Mechanism of Colour Differentiation among Floral Segments in Orchids. Commun. Biol. 2020, 3, 89. [Google Scholar] [CrossRef] [Green Version]
  38. Liao, J.; Niu, C.; Xie, Q.; Xing, Q.; Qi, H. The Recent Advances of Transient Expression System in Horticultural Plants. Acta Hortic. Sin. 2017, 44, 1796–1810. [Google Scholar]
  39. Lai, Y.; Li, H.; Masumi, Y. A Review of Target Gene Specificity of Flavonoid R2R3-MYB Transcription Factors and a Discussion of Factors Contributing to the Target Gene Selectivity. Front. Biol. China 2013, 8, 577–598. [Google Scholar] [CrossRef]
  40. Williams, C.A.; Grayer, R.J. Anthocyanins and Other Flavonoids. Nat. Prod. Rep. 2004, 21, 539–573. [Google Scholar] [CrossRef]
  41. Koes, R. Flavonoids: A Colorful Model for the Regulation and Evolution of Biochemical Pathways. Trends Plant Sci. 2005, 10, 236–242. [Google Scholar] [CrossRef]
  42. Lepiniec, L.; Debeaujon, I.; Routaboul, J.M.; Baudry, A.; Pourcel, L.; Nesi, N.; Caboche, M. Genetics and biochemistry of seed flavonoids. Annu. Rev. Plant Biol. 2006, 57, 405–430. [Google Scholar] [CrossRef] [PubMed]
  43. Li, C.; Ren, Y.; Huang, S.; Huang, S.; Yang, G. Floral Colors of Phalaenopsis Type Dendrobium and Their Flavonoid Composition. Acta Hortic. Sin. 2013, 40, 107–116. [Google Scholar]
  44. Fossen, T.; Andersen, O.M. Cyanidin 3-O-(6″-Succinyl-β-Glucopyranoside) and Other Anthocyanins from Phragmites Australis. Phytochemistry 1998, 49, 1065–1068. [Google Scholar] [CrossRef]
Horticulturae 08 00528 g001 550
Figure 1. Five periods of N. tazetta var. chinesis M.Roem. ‘Jinzhanyintai’. 1–5: the overall states of ‘Jinzhanyintai’ in five periods of the coloring process, t-1–t-5: the states of ‘Jinzhanyintai’ tepal in five periods of coloring process, c-1–c-5: the states of ‘Jinzhanyintai’ corona in five periods of the coloring process.
Figure 1. Five periods of N. tazetta var. chinesis M.Roem. ‘Jinzhanyintai’. 1–5: the overall states of ‘Jinzhanyintai’ in five periods of the coloring process, t-1–t-5: the states of ‘Jinzhanyintai’ tepal in five periods of coloring process, c-1–c-5: the states of ‘Jinzhanyintai’ corona in five periods of the coloring process.
Horticulturae 08 00528 g001
Horticulturae 08 00528 g002 550
Figure 2. The expression level of the NtMYB9 gene in different tissues and different periods of the corona coloring process in ‘Jinzhanyintai’. (A) The expression level of the NtMYB9 gene in five different tissues, 1 to 5 are tepal, corona, filament, ovary and leaf, respectively. (B) The expression level of the NtMYB9 gene in the five periods of corona coloring process. c-1 to c-5 were the first period to the fifth period of the corona coloring process, respectively. Different small letters indicated significant difference at p < 0.05 level by Duncan test.
Figure 2. The expression level of the NtMYB9 gene in different tissues and different periods of the corona coloring process in ‘Jinzhanyintai’. (A) The expression level of the NtMYB9 gene in five different tissues, 1 to 5 are tepal, corona, filament, ovary and leaf, respectively. (B) The expression level of the NtMYB9 gene in the five periods of corona coloring process. c-1 to c-5 were the first period to the fifth period of the corona coloring process, respectively. Different small letters indicated significant difference at p < 0.05 level by Duncan test.
Horticulturae 08 00528 g002
Horticulturae 08 00528 g003 550
Figure 3. Multiple sequences alignment of the NtMYB9 and other MYB proteins in N. tazetta var. chinensis M.Roem. (Nt), C. sinensis (Cs), D. kaki (Dk), F. × ananassa (Fa), M. domestica (Md), Vitis vinifera (Vv), Z. mays (Zm), A. thaliana (At) and P. × hybrida (Ph). The R2 and R3 domains shown refer to two MYB DNA-binding domains of the MYB proteins. Blue–black indicated amino acid sequence similarity of 100%, pink indicated amino acid sequence similarity of greater than or equal to 75% and blue indicated amino acid sequence similarity of greater than or equal to 50%.
Figure 3. Multiple sequences alignment of the NtMYB9 and other MYB proteins in N. tazetta var. chinensis M.Roem. (Nt), C. sinensis (Cs), D. kaki (Dk), F. × ananassa (Fa), M. domestica (Md), Vitis vinifera (Vv), Z. mays (Zm), A. thaliana (At) and P. × hybrida (Ph). The R2 and R3 domains shown refer to two MYB DNA-binding domains of the MYB proteins. Blue–black indicated amino acid sequence similarity of 100%, pink indicated amino acid sequence similarity of greater than or equal to 75% and blue indicated amino acid sequence similarity of greater than or equal to 50%.
Horticulturae 08 00528 g003
Horticulturae 08 00528 g004a 550Horticulturae 08 00528 g004b 550
Figure 4. Phylogenetic and conserved motif analysis of MYB proteins. (A) Phylogenetic tree and conserved motif analysis of NtMYB9 and other MYB proteins (including GenBank accession numbers and MYB protein names) known to regulate the flavonoid biosynthesis pathway in A. thaliana (At), P. × hybrida (Ph), M. domestica (Md), Litchi chinensis (Lc), Lilium hybrid (Lh), V. vinifera (Vv), Phalaenopsis hybrid (Ph), F. × ananassa (Fa), D. kaki (Dk), N. tazetta var. chinensis M.Roem. (Nt), C. sinensis (Cs), Gossypium hirsutum (Gh), Z. mays (Zm) and Populus tremula × Populus tremuloides (Pt), the black dot was the NtMYB9 protein. (B) Sequence identification of the predicted eight motifs of the MYB proteins.
Figure 4. Phylogenetic and conserved motif analysis of MYB proteins. (A) Phylogenetic tree and conserved motif analysis of NtMYB9 and other MYB proteins (including GenBank accession numbers and MYB protein names) known to regulate the flavonoid biosynthesis pathway in A. thaliana (At), P. × hybrida (Ph), M. domestica (Md), Litchi chinensis (Lc), Lilium hybrid (Lh), V. vinifera (Vv), Phalaenopsis hybrid (Ph), F. × ananassa (Fa), D. kaki (Dk), N. tazetta var. chinensis M.Roem. (Nt), C. sinensis (Cs), Gossypium hirsutum (Gh), Z. mays (Zm) and Populus tremula × Populus tremuloides (Pt), the black dot was the NtMYB9 protein. (B) Sequence identification of the predicted eight motifs of the MYB proteins.
Horticulturae 08 00528 g004aHorticulturae 08 00528 g004b
Horticulturae 08 00528 g005 550
Figure 5. Subcellular localization analysis of P1300-LV-NtMYB9-GFP fusion proteins in epidermal cells of tobacco. The scale bar is 100 µm.
Figure 5. Subcellular localization analysis of P1300-LV-NtMYB9-GFP fusion proteins in epidermal cells of tobacco. The scale bar is 100 µm.
Horticulturae 08 00528 g005
Horticulturae 08 00528 g006 550
Figure 6. The expression level of enzyme genes of flavonoid biosynthesis pathway in tobacco leaves.
Figure 6. The expression level of enzyme genes of flavonoid biosynthesis pathway in tobacco leaves.
Horticulturae 08 00528 g006
Horticulturae 08 00528 g007 550
Figure 7. Functional verification of the NtMYB9 gene in the transient expression system of Petunia and Phalaenopsis. (A) Transient expression of the NtMYB9 protein in petals of ‘W115’ Petunia. Overexpression of the NtMYB9 gene caused yellowing around the injection sites of Petunia petals, and the discoloration areas were similar in color to the base of the petals. (B) Transient expression of the NtMYB9 protein in petals and sepals of ‘Hangzhoumeinv’ Phalaenopsis. Overexpression of the NtMYB9 gene caused yellowing around the injection sites of Phalaenopsis petals and sepals. The black arrows indicate the injection sites.
Figure 7. Functional verification of the NtMYB9 gene in the transient expression system of Petunia and Phalaenopsis. (A) Transient expression of the NtMYB9 protein in petals of ‘W115’ Petunia. Overexpression of the NtMYB9 gene caused yellowing around the injection sites of Petunia petals, and the discoloration areas were similar in color to the base of the petals. (B) Transient expression of the NtMYB9 protein in petals and sepals of ‘Hangzhoumeinv’ Phalaenopsis. Overexpression of the NtMYB9 gene caused yellowing around the injection sites of Phalaenopsis petals and sepals. The black arrows indicate the injection sites.
Horticulturae 08 00528 g007
Table
Table 1. The primer sequences used for PCR.
Table 1. The primer sequences used for PCR.
Primer NamePrimer Sequence (5′→3′)Description
NtMYB9-FGCTCTAGAATGGGTAGGCACTCTTGTTGCTPCR amplification
NtMYB9-RTCCCCCCGGGAATCTGTCCAAACACTGAAGAAATCTTCTG
q-NtMYB9-FTCCCCTCTCACCCAATTGAATTCqRT-PCR
q-NtMYB9-RCACGGCAACATTTCACCACC
q-Actin-FTGCCCAGAAGTGCTATTCCAGqRT-PCR
q-Actin-RGTTGACCCACCACTAAGAACAATG
P1300-LV-NtMYB9-FGAGAACACGGAGCTCGGTACCATGGGTAGGCACTCTTGTTGConstruction of expression vector
P1300-LV-NtMYB9-RTCCTCCTCCTCCTCCGGATCCAATCTGTCCAAACACTGAAG
Table
Table 2. The primer sequences used for qRT-PCR.
Table 2. The primer sequences used for qRT-PCR.
Primer NamePrimer Sequence (5′→3′)Description
PAL-FAACCAACAGTCAGGGGAATGqRT-PCR
PAL-RTTGGGCATCGAGAGTTCCAG
4CL-FTCATTGACGAGGATGACGAGqRT-PCR
4CL-RTGGGATGGTTGAGAAGAAGG
CHS-FGTACAACTAGTGGTGTAGACAqRT-PCR
CHS-RCCAACTTCACGAAGGTGAC
CHI-FGAAATCCTCCGATCCAGTGAqRT-PCR
CHI-RCAACGTTGACAACATCAGGC
F3′H-FTCCAAGAATACTGGCCCAAGqRT-PCR
F3′H-RCTCACAACTCTCGGATGCAA
F3H-FACAGGGTGAAGTGGTCCAAGqRT-PCR
F3H-RCCTTGGTTAAGGCCTCCTTC
FLS-FGTCCACAACGTTGCATGGTGqRT-PCR
FLS-RCACAACTTCTCGCAGCCTC
DFR-FAACCAACAGTCAGGGGAATGqRT-PCR
DFR-RTTGGGCATCGAGAGTTCCAG
ANS-FTGGCGTTGAAGCTCATACTGqRT-PCR
ANS-RGGAATTAGGCACACACTTTGC
UFGT-FCAATGTTTGGGATGGTGTCAqRT-PCR
UFGT-RTTCCTCCTCTGCCTCTTTCA
LAR-FTCAAGGTCCTTTACGCCATCqRT-PCR
LAR-RACGAACCTGCTTCTCTTTGG
ANR-FCATTTGACTTTCCCAAACGCqRT-PCR
ANR-RATTGGGCTTTTGAGTTGTGC
ACTIN-FAATGATCGGAATGGAAGCTGqRT-PCR
ACTIN-RTGGTACCACCACTGAGGACA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Fan, K.; Ma, Y.; Chang, Y.; Hu, X.; Zhang, W.; Deng, Y.; Xia, M.; Jiang, Z.; Hu, T. Cloning and Functional Analysis of NtMYB9 in ‘Jinzhanyintai’ of Narcissus tazetta var. chinensis. Horticulturae 2022, 8, 528. https://doi.org/10.3390/horticulturae8060528

AMA Style

Fan K, Ma Y, Chang Y, Hu X, Zhang W, Deng Y, Xia M, Jiang Z, Hu T. Cloning and Functional Analysis of NtMYB9 in ‘Jinzhanyintai’ of Narcissus tazetta var. chinensis. Horticulturae. 2022; 8(6):528. https://doi.org/10.3390/horticulturae8060528

Chicago/Turabian Style

Fan, Keke, Yanjun Ma, Yanting Chang, Xiaomeng Hu, Wenbo Zhang, Yayun Deng, Mengsi Xia, Zehui Jiang, and Tao Hu. 2022. "Cloning and Functional Analysis of NtMYB9 in ‘Jinzhanyintai’ of Narcissus tazetta var. chinensis" Horticulturae 8, no. 6: 528. https://doi.org/10.3390/horticulturae8060528

APA Style

Fan, K., Ma, Y., Chang, Y., Hu, X., Zhang, W., Deng, Y., Xia, M., Jiang, Z., & Hu, T. (2022). Cloning and Functional Analysis of NtMYB9 in ‘Jinzhanyintai’ of Narcissus tazetta var. chinensis. Horticulturae, 8(6), 528. https://doi.org/10.3390/horticulturae8060528

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop