Effects of Sulfate on the Physiology, Biochemistry, and Activity of Group 1 Sulfate Transporters in Seedlings of Brassica pekinensis

Abstract

It is well known that some plants have the capability of taking up sulfur as a nutrient from the atmosphere through foliar absorption and can survive well in polluted environments. In order to observe the effects of the relationship between atmospheric hydrogen sulfide (H₂S) deposition and soil sulfur nutrition, the current study used Brassica pekinensis as a model plant. The objective in conducting this study was to understand the regulatory mechanisms engaged in the uptake and assimilation of sulfate (SO₄²⁻) in plants by studying the modulation of transcription levels of sulfate transporter genes (STGs) (Sultr1;1 and Sultr1;2), changes in growth physiology, and the potential of roots to uptake the SO₄²⁻ when allowed to grow in the presence or absence of SO₄²⁻ in a hydroponic nutrient solution. Changes in growth, physico-chemical parameters, and gene expression levels of Group 1 STGs were observed when sulfur-treated and non-treated plants were exposed to phytotoxic H₂S levels in the air. Sulfur deficiency enhanced nitrate and free amino acid (FAA) concentrations in the shoot and root regions of the plant. However, there was a significant decrease in the biomass, shoot/root ratio (SRR), chlorophyll content, and thiol content, with p-values < 0.01. This, in turn, increased the sulfur-uptake capacity of plants from the atmosphere through foliar absorption. When the sulfur-uptake capacity of plants increased, there was an increase in the expression level of Group 1 sulfate transporter genes (Sultr1;1 and Sultr1;2), which regulate sulfur transportation through roots. The growth, physico-chemical characteristics, and level of gene expression of Group 1 STGs were unaffected by the availability of excess sulfur in the atmosphere of up to 0.3 μL l⁻¹.

1. Introduction

Brassica is a plant genus in the mustard family (Brassicaceae), also referred to as cruciferous vegetables. Cabbage, cauliflower, broccoli, and Brussels sprouts are all members of the Brassica family, and certain seeds are commonly consumed. Important horticultural and agricultural crops belong to this genus. Brassica plants have a high growth need for sulfur [1,2,3]. Sulfur is present in amino acids (cysteine and methionine), oligopeptides (phytochelatins and glutathione (GSH)), and cofactors and vitamins (thiamine, biotin, CoA, and S-adenosyl-methionine). In addition, sulfur is also present in the form of secondary sulfur compounds; for instance, glucosinolates (cruciferous vegetables) and allyl-cysteine sulfoxides (allium) [4,5,6,7]. Sulfur deficiency in plants may lead to a loss in crop output and quality as well as a reduction in their ability to withstand environmental stress and pests [2,7,8].

Sulfate uptake by the root, as well as its successive reduction and dispersion, are all influenced and controlled by the conditions of sulfur (S) in the plant and the demand for S for growth [9,10]. When a plant is deprived of SO₄²⁻ in the root surroundings, its SO₄²⁻ uptake, reduction potential, distribution, and efficiency to assimilate are often improved by physiological and morphological changes [9,11,12]. The SO₄²⁻ transporters that are engaged in the up taking and distribution of SO₄²⁻ in plants can be categorized into numerous SO₄²⁻ transporter categories based on their gene sequence, role, and cellular location [9,13]. Brassicaceae family members have been shown to have cDNAs for up to 14 distinct putative STGs that are divided into five groups [14,15]. The Group 1 sulfate transporters (G1STs) Sultr1.1 and Sultr1.2 have high affinity, while Sultr1.3 is mainly responsible for the primary SO₄²⁻ uptake across the plasma membrane, particularly in the root [16,17,18]. From various experimental evidence, it has been found that in the S-deficient plant tissue, there is a reduced level of thiol compounds, SO₄²⁻, and proteins. In addition to this, it has also been found that such plants have increased levels of nitrate (NO₃²⁻) and FAAs [7,8]. Atmospheric sulfur dioxide (SO₂) is directly absorbed by plant shoots, primarily through the stomata, and is removed from the atmosphere [19,20]. Obviously, sulfur fumes (namely H₂S and SO₂) have the potential to be phytotoxic, but they can also be used as a source of sulfur, and they are even useful when the root is not sufficiently fertilized with sulfur [21,22]. Excessive quantities of H₂S or SO₂ can harm plant growth, and particularly high levels can cause immediate observable damage in plants [19]. According to Ausma and De Kok, H₂S uptake by foliage exhibits saturation kinetics in relation to the concentration of hydrogen sulfide in the air, which can be explained by the Michaelis–Menten equation. The rate at which SO₂ is taken up varies significantly among species, which may account for the variations in plant sulfur requirements [2,20,23,24]. The rate of uptake of SO₂ is dominated by the apparent internal (mesophyll) resistance of the shoots, which represents the rate of sulfide metabolism [19,22,24,25,26].

It is currently unclear how signal transduction pathways concerned with the SO₄²⁻ uptake, assimilation, and coordination from shoot to root have been affected. There is a possibility of quick responses to environmental changes, such as the supply of sulfur through the activation and deactivation of sulfur absorption enzymes by metabolites [27], or the expression and de-repression of genes producing SO₄²⁻ transporters by metabolites [11,26,28]. Investigators have shown that the activity and expression of the adenosine 5′-phosphosulfate reductase (APR) enzyme in Brassica shoots and roots are reduced by hydrogen sulfide. The investigators found that that its reduction in curly kale was about 80% when H₂S was 0.8 μL l⁻¹ [21,26]. It has been observed that these features were unaffected by H₂S for other SO₄²⁻ assimilation enzymes, including adenosine triphosphate sulfurylase (ATPS), O-acetylserine (thiol) lyase (OAS-TL), and sulfite reductase (SIR) [24,29]. Plant SO₄²⁻ transporter regulation can occur at the transcriptional, translational, and post-translational stages. More research is required to completely comprehend the signal transduction pathways involved in plants [14]. According to Amtmann and Armengaud [30] and Qian et al. [6], changing growing patterns, for instance, variations in root development and the shoot-to-root ratio, can regulate SO₄²⁻ uptake and reduction. These also necessitate many cell–cell transport steps via various transmembrane inter- and intracellular transport channels [20].

To date, it is not clearly known to what level SO₄²⁻ or other sulfur assimilation metabolites are directly engaged in sensing or serving as regulatory signals. Uncertainty exists regarding the comprehensive networks of the complete gene–protein–metabolite system of sulfur metabolism. Even today, many questions remain unanswered regarding the intricate signaling cascade of sulfur nutritional stress. Developing Brassica pekinensis seedlings cultivated in SO₄²⁻-sufficient and SO₄²⁻-deprived environments, as well as exposed to varying amounts of ambient H₂S, will be used to examine the direct effect of sulfur with regard to its uptake and overall effect on the growth of the plant and metabolism. The main objective of this study is to determine the optimal hydrogen sulfide concentration for the growth of Brassica pekinensis in a hydroponic system and to understand how seedlings respond to exposure to both hydrogen sulfide from the air and sulfate from the hydroponic medium. We have assessed Group 1 STG expression and activity, SO₄²⁻-uptake capacity, and sulfur metabolite concentrations for these purposes.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions in a Climate-Controlled Room

Seeds of Chinese cabbage (Brassica pekinensis cv. Vitimo F1) obtained from Nickerson-Zwaan, The Netherlands, were germinated in vermiculite in a climate-controlled room. Day and night temperatures were 22 and 18 °C (±1 °C), respectively, and the relative humidity was 60–70%. The photoperiod was 14 h at a photon fluence rate of 300 ± 20 μmol m⁻² s⁻¹ (within the 400–700 nm range) at plant height, supplied by Philips GreenPower LED (deep red/white 120) production modules. Ten-day-old seedlings were transferred to 30 L containers with either 0 mM sulfate (−S, S-deprived; all sulfate salts were replaced by chloride salts) or 0.5 mM sulfate (+S, S-sufficient) in 25% Hoagland nutrient solution. There were 20 plants per 30 L container. The 25% Hoagland nutrient solution was adjusted to a pH of 6.0 with KOH and contained 1.25 mM Ca(NO₃)₂·4H₂O; 0.23 mM KH₂PO₄; 1.25 mM KNO₃; 0.5 mM MgSO₄·7H₂O; 11.6 μM H₃BO₃; 2.3 μM MnCl₂·4H₂O; 0.24 μM ZnSO₄·7H₂O; 0.080 μM CuSO₄·5H₂O; and 0.13 μM Na₂MoO₄·2H₂O. Plants were harvested 3 h after the onset of the light period, and the roots were rinsed in ice-cold, demineralized water (3 × 20 s). Roots were separated from the shoot, and their fresh weight was measured. For RNA isolation, the plant material was frozen immediately in liquid N₂ and stored at −80 °C. For the measurement of the water-soluble non-protein thiol content, freshly harvested plant material was used, and for the analysis of dry matter and sulfate content, plant tissue was dried at 80 °C for 24 h (Figure 1) [31].

2.2. H₂S Exposure and Growth Conditions in Fumigation Cabinets

For experiments on exposure to different levels of H₂S, plants were transferred after 14 days to 13 L stainless steel containers (ten plant sets per container, three plants per set) containing 25% Hoagland solution with either 0 mM sulfate (−S, indicating S-deprived; all sulfate salts were replaced by chloride salts) or 0.5 mM sulfate (+S, indicating S-sufficient). These containers were placed in fumigation cabinets and exposed to 0, 0.1, 0.2, and 0.3 μL l⁻¹ H₂S for six days to study the interaction between atmospheric H₂S and pedospheric S nutrition. H₂S levels in the cabinets were controlled by an SO₂ analyzer (model 9850) equipped with a H₂S converter (model 8770, Monitor Laboratories, Measurement Controls Corporation, Englewood, CO, USA). In the fumigation cabinet, day and night temperatures were maintained at 21 and 18 °C (±1 °C), respectively, the relative humidity was 55 ± 5%, and the photoperiod was 14 h at a photon fluence rate of 300 ± 20 µmol m⁻² s⁻¹ (within the 400–700 nm range) at plant height, supplied by Philips GreenPower LED (deep red/white 120) production modules. The air temperature was controlled by adjusting the cabinet wall temperature. The air exchange was 40 L min⁻¹, and the air inside the cabinets was circulated continuously by a ventilator. To prevent the absorption of atmospheric H₂S by the solution, the nutrient solution was aerated, and the lids of containers and plant sets were sealed. Upon harvest, plants were removed from the nutrient solution, and then the roots were rinsed three times in ice-cold, demineralized water for 20 s each. Roots and shoots were harvested separately and weighed. The plant material was immediately frozen in liquid nitrogen and stored at −80 °C until further use. For estimation of dry matter content (DMC), plant tissue was dried at 80 °C for 24 h (Figure 1) [31].

2.3. Pigments

Weighed plant material was immediately frozen in liquid N₂ and stored at −20 °C. Then, the plant material was homogenized in 96% ethanol (5 mL g⁻¹ fresh weight) with an Ultra Turrax (0 °C). The homogenate was filtered through one layer of Miracloth. The filtrate was centrifuged at 800× g for 20 min. The supernatant was collected and diluted to 0.5:5 with 96% ethanol. The measuring mix was vortexed, and thereafter the content of chlorophyll a, b, and carotenoids was measured in duplicate at 470, 648.6, and 664.2 nm, respectively. The experiment was carried out in darkness, and the samples were kept on ice [31].

2.4. Anions

Frozen plant material was homogenized in demineralized water (10 mL per g FW) with an Ultra Turrax for 30 s at 0 °C and subsequently filtered through one layer of Miracloth and incubated at 100 °C in a boiling water bath for 10 min. The filtrate was centrifuged at 30,000× g for 15 min at 0 °C. The anions were separated by HPLC using IonoSpher A, an anion exchange column (250 × 4.6 mm; Varian Benelux, Bergen op Zoom, The Netherlands), and determined refractometrically [32]. Anions were separated by HPLC on an Agilent IonoSpher 5A anion exchange column (250 × 4.6 mm; Agilent Technologies, Amstelveen, The Netherlands), and the sulfate content was determined refractometrically according to Shahbaz et al. [33]. The HPLC system consisted of a Knauer HPLC pump model 100 and a Knauer differential refractometer model 98.00 (Knauer, Berlin, Germany). The mobile phase contained 25 mM potassium biphthalate (pH 4.3) with 0.02% NaN₃ (w/v).

2.5. Water-Soluble Non-Protein Thiols

Fresh plant material was homogenized in an extraction medium with an Ultra Turrax at 0 °C (10 or 20 mL g⁻¹ fresh weight). This medium contained 80 mM sulfosalicylic acid, 1 mM EDTA, and 0.15% (w/v) ascorbic acid and was aspirated with N₂ to remove oxygen from the solution. The homogenate was filtered through one layer of Miracloth, and the filtrate was centrifuged at 30,000× g for 15 min at 0 °C. These samples were measured in duplicate. For the measurement, Ellman’s reagent (10 mM 5,5′-dithiobis[2-nitrobenzoic acid] (DTNB) in 0.02 M Tris, pH 7.0) and 0.4 M Tris-HCl, pH 8.0 were used. If DTNB reacts with an SH compound, it will become yellow and can be measured. The 1.0 mL supernatant of the sample, 0.1 mL of Ellman’s reagent, and 2.0 mL of Tris-HCl were mixed and measured at 413 nm. The SH concentration was calculated using a standard curve [23,34].

2.6. Free Amino Acids

Plant tissue extracts were prepared to a volume of 1 mL with distilled water, and then the ninhydrin reagent (1 mL) was added. The test tubes were placed in a boiling water bath for 20 min. After cooling the test tubes, 5 mL of diluent was added to each tube. At 570 nm, a spectrophotometer was used to determine the total amount of free amino acids [35].

2.7. RNA Extraction

Total RNA was isolated by a modified hot phenol method [36]. Frozen ground plant material was extracted in hot (80 °C) phenol/extraction buffer (1:1, v/v), 1 g mL⁻¹. The extraction buffer contained 0.1 M Tris-HCl, 0.1 M LiCl, 1% SDS (w/v), 10 mM EDTA, pH 8.0. After mixing, 0.5 mL of chloroform–isoamyl alcohol (24:1, v/v) was added and centrifuged at 13,400× g for 5 min at 4 °C. The aqueous phases were transferred to a new tube, and an equal volume of chloroform and isoamyl alcohol was added. The total RNA was precipitated by 4 M LiCl overnight at 4 °C. Total RNA was collected and washed with 70% ethanol. Possible genomic DNA contamination was removed with a DNase, and total RNA was precipitated by ethanol and dissolved in diethylpyrocarbonate-treated water. The quantity and quality of RNA were checked using ThermoNanoDrop 2000, and the concentration of RNA was adjusted equally in each sample. If any impurity was found, phenol–chloroform–isoamyl alcohol and chloroform–isoamyl alcohol were used for further purification and removal. The integrity of RNA was checked by electrophoresis by loading 1 μg of RNA on a 1% TAE-agarose gel.

2.8. Relative Expression of Sultr1;1, Sultr1;2 by Real-Time Quantitative PCR

DNA-free intact RNA (1 µg) was reverse transcribed into cDNA with oligo-dT primers using a first-strand cDNA synthesis kit (Promega, USA) according to the manufacture’s supplied instructions. Subsequently, the cDNA was used as a template in real-time PCR experiments with gene-specific primers (

Table 1. Primers used in the quantitative PCR (qPCR) analyses.

Primer Sequence (5′-3′)
Gene	Forward	Reverse
Sultr1;1	TGGCCATAGTGGTAGCTC	AGACCAAGGACGGCTGAT
Sultr1;2	GCAACAGACGGTGGAGAT	GCCCCCAATCGAAAACC
Actin	AGCAGCATGAAGATCAAGGT	GCTGAGGGATGC

). RT-PCR was performed on the Applied Bio Systems’ 7300 real-time PCR system using the SYBR Green master mix kit (Thermo Scientific) based on the manufacturer’s instructions. The transcript levels of the target gene and actin were measured using the comparative Ct method. Sultr1;1, Sultr1;2 relative expression was measured by qPCR in triplicate [33].

2.9. Sulfate-Uptake Capacity

Sulfate-uptake capacity was determined as described by Koralewska et al. [18]. Three sets of plants (3 plants per set) per treatment were transferred to a 25% Hoagland solution labeled with ³⁵S-sulfate (2 MBq l⁻¹) and incubated for 30 min at 25 °C at a photon fluence rate of 300 ± 20 µmol m⁻² s⁻¹ at plant height, supplied by Philips GreenPower LED (deep red/white 120) production modules. Subsequently, plants were removed and their roots rinsed in ice-cold non-labeled nutrient solution (3 × 20 s). Roots and shoots were separated and digested in 1 N HCl at room temperature for 7 days. The extracts were filtered through one layer of Miracloth (Calbiochem Corporation, La Jolla, CA, USA), and 100 µL of the filtrate was mixed with 1 mL Emulsifier plus (Perkin Elmer, Boston, MA, USA). Radioactivity was measured with a liquid scintillation counter (TRI-CARB 2000 CA Liquid Scintillation Analyzer, Perkin Elmer, Waltham, MA, USA).

2.10. Statistical Analysis

In the present study, Pearson’s correlation coefficient analyses were performed to assess the associations between different physico-chemical parameters and the transcription level of sulfur. Multivariate cluster analysis was conducted to construct a dendrogram based on the similarity matrix of the physico-chemical parameters using the paired group (UPGMA) method with arithmetic averages and a correlation similarity index. Non-metric multidimensional scaling was carried out to group the H₂S-treated and non-treated plants on the basis of their similarity in different physico-chemical parameters. Comparison and similarity groupings of all measured parameters were performed by using a two-way ANOVA to determine any significant variation between the means. These analyses were performed using PAST: Palaeontological Statistics Software Package, version 4.05 [37]. All the measured parameters were subjected to principal component analysis using the web tool ClustVis (https://biit.cs.ut.ee/clustvis/ (accessed on 6 June 2023)) to determine any significant relationship between one component and another.

3. Results

3.1. Impact of Sulfur on Plant Growth, Physico-Chemical Parameters, and Sulfate Transporter Gene Expression

It was observed that when plants were allowed to grow in the presence of 0.5 mM sulfate, there was a positive correlation between the gradual increase in biomass of the whole plant with the SRR, a high SO₄²⁻ composition in the shoot and root, a low nitrate composition in the shoot (

Table 2. The impact of sulfate deprivation on the biomass and the content of sulfate, nitrate, water-soluble non-protein thiols, and free amino acids of Brassica pekinensis seedlings. Ten-day-old seedlings were transferred to a 25% Hoagland solution with 0.5 mM sulfate (+S) or 0 mM sulfate (−S) in a climate-controlled room for up to 4 days. Data on biomass (g FW) and shoot/root ratio represent the mean (±SD) of 3 independent experiments with 12 plants with 4 measurements each. Data on sulfate, nitrate and free amino acid content (µmol g⁻¹ FW) represent the mean (±SD) of 3 measurements with 6 plants each. Data on water-soluble non-protein thiols (µmol g⁻¹ FW) represent the mean (±SD) of 3 measurements with 12 plants each. Different letters indicate significant differences between treatments (p ≤ 0.01, one-way ANOVA Tukey test).

	Initial	1 Day		2 Days		3 Days		4 Days
		+S	−S	+S	−S	+S	−S	+S	−S
Plant
Biomass	0.08 ± 0.00 a	0.08 ± 0.00 a	0.09 ± 0.01 b	0.11 ± 0.00 ac	0.11 ± 0.01 bc	0.19 ± 0.03 d	0.18 ± 0.01 d	0.23 ± 0.02 e	0.22 ± 0.03 de
Shoot/root ratio	3.7 ± 0.9 acd	3.3 ± 0.3 ad	3.1 ± 0.4 a	3.8 ± 0.6 cd	3.6 ± 0.5 ad	4.2 ± 0.4 ce	4.1± 0.2 c	5.1 ± 0.8 b	4.5 ± 0.3 be
Shoot
Sulfate	12.9 ± 1.7 c	13.2 ± 0.8 c	11.1 ± 0.7 c	13.3 ± 0.8 c	6.3 ± 1.1 c	14.0 ± 1.3 b	3.6 ± 0.7 c	14.3 ± 1.7 b	1.1 ± 0.4 a
Nitrate	0.3 ± 0.1 a	8.3 ± 0.5 b	8.5 ± 0.3 bc	15.7 ± 3.7 cd	26.4 ± 5.1 de	41.0 ± 3.2 ef	49.9 ± 2.9 f	49.5 ± 9.3 efg	65.8 ± 4.0 g
Thiols	0.28 ± 0.02 b	0.46 ± 0.01 c	0.43 ± 0.03 c	0.46 ± 0.04 c	0.40 ± 0.03 cd	0.61 ± 0.08 c	0.31 ± 0.02 bd	0.48 ± 0.04 c	0.11 ± 0.03 a
Free amino acids	3.9 ± 0.8 a	20.9 ± 1.0 b	23.6 ± 0.9 b	19.9 ± 5.4 b	24.1 ± 6.5 b	21.8 ± 2.2 b	25.0 ± 2.9 b	27.0 ± 3.9 b	27.8 ± 7.6 b
Root
Sulfate	9.0 ± 0.5 f	9.5 ± 0.0 f	7.5 ± 0.2 e	10.1 ± 0.5 cf	5.6 ± 0.3 d	11.5 ± 0.4 g	3.9 ± 0.2 b	12.5 ± 0.8 g	2.7 ± 0.4 a
Nitrate	3.1 ± 1.1 a	18.1 ± 1.2 b	19.6 ± 0.4 b	23.7 ± 0.9 c	27.2 ± 1.8 cd	24.4 ± 2.5 bcd	27.5 ± 1.1 d	24.6 ± 3.7 bc	30.4 ± 2.3 d
Thiols	0.30 ± 0.03 b	0.32 ± 0.07 ab	0.30 ± 0.04 ab	0.31 ± 0.01 b	0.33 ± 0.03 b	0.33 ± 0.02 b	0.38 ± 0.03 b	0.44 ± 0.08 b	0.19 ± 0.02 a
Free amino acids	9.7 ± 1.8 a	17.1 ± 2.6 abc	14.0 ± 1.8 abc	16.0 ± 2.4 abc	15.5 ± 2.3 abc	15.2 ± 0.6 b	17.0 ± 1.5 bc	18.8 ± 1.2 c	19.3 ± 2.7 bc

), and a gradual increase in the expression level of the gene Sultr1;2 (Figure 2). This suggests that due to high SO₄²⁻ levels in the root and shoot, there is a gradual increase in the growth of plants that consequently results in a gradual increase in biomass and SRR, a low nitrate content (Table 2), and a slow rise in the expression level of the gene Sultr1;2. Free amino acid and thiol levels in the shoot and root of sulfate-treated plants were positively correlated with the plant SO₄²⁻-uptake capacity, which implies that plants’ thiol content and their free amino acid content increase as their ability to absorb sulfate increases (Table 2 and Figure 2). There was a negative correlation between the nitrate content of roots and the gene expression level of Sultr1;1 in sulfate-treated plants, which suggests that with a decrease in nitrate content in treated plants, there is an increase in the expression level of the Sultr1;1 gene (Table 2 and Figure 2). In sulfate-sufficient roots, Sultr1;2 expression gradually increased, whereas Sultr1;1 expression was barely perceptible (determined by qRT-PCR) (Figure 2).

From the Pearson’s correlation coefficient analysis, it was observed that when plants were allowed to grow in the absence of SO₄²⁻, there was a positive correlation between an increase in the biomass of the whole plant, SRR, and the SO₄²⁻-uptake capacity of plants, a high nitrate content, a high free amino acid content in root and shoot, and an increase in gene expression level of Sultr1;2 (Table 2 and Figure 2). This suggests that in absence of sulfur, the transcription level of the Sultr1;2 gene increases, which in turn increases the nitrate content, free amino acid content, and SO₄²⁻-uptake capacity of plants. Due to the increase in nitrate content, there is an increase in root and shoot expansion, which in turn increases the biomass of the whole plant (Table 2). There was a negative correlation between the SO₄²⁻ content of the root and shoot with the biomass of the whole plant, SRR, nitrate content, free amino acid content, and SO₄²⁻ uptake capacity of plants. There was a negative correlation of SO₄²⁻ content with the gene expression level of Sultr1;1 and Sultr1;2 in sulfur-nontreated plants, which suggests that due to the low level of SO₄²⁻ in the shoot and root of plants, there is a significant increase in the gene expression level of Sultr1;1 and Sultr1;2 (Table 2 and Figure 2). The thiol content in the root and shoot is positively correlated with the SO₄²⁻ content of the root and shoot, which suggests that there is a decrease in thiol content with a reduction in the SO₄²⁻ content of plants (Table 2). The reduced biomass brought about by SO₄²⁻ deprivation was more severe in shoots than in roots, resulting in a lower SRR compared with plants grown in SO₄²⁻-containing medium. The plants all displayed additional signs of sulfur shortage, including yellowing of the leaves caused by a loss of color, very low levels of SO₄²⁻, increased levels of nitrate and FAAs, especially in the shoots, as well as an increased shoot DMC (Table 2). The thiol content of the plants is negatively correlated with the free amino acid content and expression level of the Sultr1;1 gene, which suggests that with a decrease in thiol content, there is an increase in the free amino acid content and transcription level of the Sultr1;1 gene (Table 2 and Figure 2). Sulfate deficiency has an influence on the amount of water-soluble non-protein thiols (Table 2). In sulfate-sufficient plants, these were not altered after the fourth day, whereas their levels drastically dropped in sulfate-deprived plants. Sulfate-deprivation caused a rapid and significant increase in Sultr1;2 gene expression within one day, whereas Sultr1;1 gene expression did not begin to increase until two days after the SO₄²⁻ deprivation. When developing seedlings were deficient in sulfate, the expression of Group 1 sulfate transporters increased, and this was accompanied by a significant improvement in SO₄²⁻-uptake capacity (up to 6-fold), which in turn gradually increased the SO₄²⁻-uptake capacity of the roots (Figure 2). From a two-way ANOVA, it was found that there was a significant variation (p < 0.01) in the growth physiology, physico-chemical parameters, and gene expression levels of STGs in plants grown in the presence of SO₄²⁻ compared with plants grown in the absence of sulfate.

3.2. Effects of H₂S Treatment on Growth, Physico-Chemical Parameters, and Sulfate Transporter Gene Expression in Plants Grown without and with Sulfate

Furthermore, plants grown in the presence of SO₄²⁻ were treated with H₂S for six days, and then changes in physico-chemical parameters and transcription levels of STGs were observed. There was a negative correlation between the DMC and SO₄²⁻-uptake capacity of the sulfur-treated plants, which suggested that after H₂S treatment, there was an increase in DMC in plants and a decrease in the SO₄²⁻-uptake capacity of sulfur-treated plants (

Table 3. The impact of sulfate deprivation and H₂S fumigation on B. pekinensis. Ten-day-old seedlings were transferred to a 25% Hoagland solution containing 0.5 mM sulfate. After 4 days, seedlings were transferred to fresh 25% Hoagland solutions containing either 0.5 mM sulfate (+S) or 0 mM (−S) sulfate. Plants were simultaneously exposed to 0, 0.1, 0.2, or 0.3 µL l⁻¹ H₂S. After 6 days, parameters were analyzed. Data on biomass production (g FW) and shoot/root ratio represent the mean (±SD) of 4 independent experiments, with 9 measurements of 3 plants in each. The initial shoot and root fresh weights were 0.222 ± 0.055 g and 0.046 ± 0.011 g FW, respectively. Data on dry matter content (DMC; %) represent the mean (±SD) of 2 independent experiments, with 3 measurements of 3 plants in each. Data on pigments (mg g⁻¹ FW), sulfate, nitrate, thiols, and free amino acids (µmol g⁻¹ FW) represent the mean of 3 measurements of 3 plants in each (±SD). Different letters indicate statistically significant differences between the treatments (p ≤ 0.01, one-way ANOVA Tukey test).

	0 µL l−1 H2S		0.1 µL l−1 H2S		0.2 µL l−1 H2S		0.3 µL l−1 H2S
	+S	−S	+S	−S	+S	−S	+S	−S
Plant
Biomass production	1.86± 0.58 bc	1.21 ± 0.23 a	1.96 ± 0.32 c	1.27 ± 0.26 a	1.94± 0.34 c	1.63 ± 0.39 b	2.03 ± 0.37 c	1.91 ± 0.33 c
Shoot/root ratio	5.5 ± 0.8 c	2.9 ± 0.7 a	5.0 ± 0.8 c	3.2 ± 0.6 ab	5.4 ± 1.2 c	3.8 ± 1.2 b	5.3 ± 0.9 c	3.8 ± 0.6 b
Shoot
DMC	8.2± 0.3 a	10.1 ± 0.4 b	8.3 ± 0.3 a	9.9 ± 0.5 b	8.4± 0.3 a	9.7 ± 0.5 b	8.4 ± 0.3 a	8.6 ± 0.2 a
Chlorophyll	0.68 ± 0.07 b	0.44 ± 0.03 a	0.72 ± 0.03 b	0.59 ± 0.04 b	0.59 ± 0.06 b	0.59 ± 0.04 b	0.60 ± 0.03 b	0.65 ± 0.06 b
Sulfate	14.3 ± 1.3 b	2.0 ± 0.2 a	14.0 ± 0.5 b	2.3 ± 0.6 a	13.6 ± 0.3 b	2.9 ± 0.7 a	12.7 ± 0.8 b	3.0 ± 0.3 a
Nitrate	56.4 ± 4.0 a	106.0 ± 4.3 b	55.1 ± 3.3 a	84.3 ± 14.0 b	62.6 ± 2.7 ab	71.1 ± 2.9 a	59.2 ± 7.8 a	69.0 ± 15.5 a
Thiols	0.36 ± 0.06 b	0.13 ± 0.06 a	0.44 ± 0.05 abc	0.14 ± 0.03 a	0.49 ± 0.01 c	0.20 ± 0.04 a	0.43 ± 0.01 bc	0.24 ± 0.02 a
Free amino acids	18.6 ± 0.7 a	68.8 ± 3.3 e	20.7 ± 1.8 a	49.8 ± 6.56 d	18.5 ± 0.2 a	31.7 ± 3.4 bc	23.5 ± 4.5 ab	24.9 ± 2.5 ab
Root
DMC	6.9 ± 0.9 b	5.7± 0.1 a	6.3 ± 0.6 ab	6.3 ± 0.3 ab	6.2± 0.3 ab	5.9 ± 0.4 a	6.3 ± 0.5 ab	5.9 ± 0.5 a
Sulfate	16.8 ± 3.5 c	1.1 ± 0.2 a	14.1 ± 1.1 bc	1.2 ± 0.4 a	12.4 ± 1.3 b	1.2 ± 0.1 a	10.0 ± 1.4 b	1.1 ± 0.4 a
Nitrate	65.1 ± 7.2 a	57.9 ± 8.8 abc	57.5 ± 3.2 ab	63.4 ± 7.5 ad	49.3 ± 3.4 bc	58.3 ± 2.8 ac	44.5 ± 5.1 bc	61.6 ± 2.7 ad
Thiols	0.37 ± 0.05 b	0.18 ± 0.05 a	0.34 ± 0.04 b	0.20 ± 0.02 a	0.32 ± 0.01 b	0.19 ± 0.00 a	0.32 ± 0.00 b	0.21 ± 0.02 a
Free amino acids	21.2 ± 1.8 ab	19.6 ± 2.0 ab	17.8 ± 0.4 a	25.4 ± 1.9 b	16.7 ± 1.2 a	19.5 ± 1.8 ab	16.8 ± 1.3 a	18.6 ± 4.3 a

and Figure 3).

Chlorophyll concentration and nitrate content in sulfur-treated plants exhibited a negative correlation, which suggests that there was an increase in chlorophyll content and a decrease in the nitrate content in the shoots of the sulfur-treated plants after H₂S treatment. The root’s DMC and the shoot’s thiol content were negatively correlated, which suggests that after H₂S treatment, there was an increase in DMC in the roots and a decrease in thiol content in the shoots of sulfur-treated plants. There was a negative correlation between the biomass of the whole plant and the SO₄²⁻ content of the root, which suggests that with an increase in the SO₄²⁻ content of the root, there was a significantly gradual increase in the growth of plants, which in turn elevated the biomass of the whole plant (Table 3). The sulfate content of roots, the sulfate content of shoots, and the plant’s ability to absorb sulfate are all positively connected (Figure 3). The DMC of the shoot is negatively correlated with the SO₄²⁻, nitrate, thiol, and free amino acid content of the root, which suggests that there is a decrease in SO₄²⁻, nitrate, thiol, and free amino acid content after H₂S treatment (Table 3). There was a positive correlation between the SRR and the expression level of the Sultr1;2 gene, suggesting that there was an increase in the growth of root and shoot in plants after H₂S treatment, which parallels the increased expression level of gene Sultr1;2. There was a positive correlation of thiol content of roots with the DMC, SO₄²⁻, and nitrate content in the roots of plants, which suggests that after H₂S treatment, there was a reduction in the thiol, SO₄²⁻, and nitrate content in the roots of sulfur-treated plants (Table 3 and Figure 3).

When sulfur-nontreated plants were treated with different concentrations of H₂S for six days, there was a positive correlation between the biomass of the whole plant and the SRR, the SO₄²⁻ and thiol content in the shoot, whereas there was a negative correlation with the DMC content in the shoot, the free amino acid content in the shoot, and the transcription level of STG (Sultr1;1 and Sultr1;2). This suggests that after H₂S treatment, there was a gradual decrease in DMC and FAA in shoots, whereas there was a gradual increase in SO₄²⁻ and thiol content in the shoots of SO₄²⁻ non-treated plants (Table 3).

There was a gradual increase in growth of the shoot and the root as well as a gradual decrease in transcription levels of STG (Sultr1;1 and Sultr1;2) in sulfur-non-treated plants after H₂S treatment (Figure 3). There was a negative correlation between the SRR of plants and the SO₄²⁻-uptake capacity as well as nitrate and free amino acid contents in the shoot, which implies that with an increase in the SO₄²⁻-uptake capacity of the plant, there was an increase in the nitrate and free amino acid content in the shoot, but growth of the shoot and root was inhibited after H₂S treatment. There was a negative correlation between the SRR of plants and the transcription level of both STGs, which suggests that there is a gradual increase in the expression level of these genes with the gradual increase in the growth of shoot and root due to H₂S treatment. There was a positive correlation between the SO₄²⁻-uptake capacity of the plants and the transcription level of STGs, which suggests that H₂S treatment increased the transcription level of both STGs, which, in turn, increased the SO₄²⁻-uptake capacity of plants. There was a negative correlation between chlorophyll and the SO₄²⁻ content of the shoots and the SO₄²⁻-uptake capacity of the plants, which suggests that when SO₄²⁻ and chlorophyll contents are low in plants, the SO₄²⁻-uptake capacity of the plants increases. There was a negative correlation between the DMC and thiol content in the shoot, which suggests that after H₂S treatment, there was an increase in DMC and a decrease in thiol content in the shoots of sulfur-non-treated plants. There was a positive correlation of the chlorophyll content with the thiol content in the root, whereas there was a negative correlation of the chlorophyll content with the nitrate and free amino acid contents. This suggests that after H₂S treatment, there was a decrease in the thiol content in the root and in the chlorophyll content in the shoot, whereas there was an increase in the nitrate and free amino acid contents in the shoots of sulfur-non-treated plants. There was a negative correlation of the SO₄²⁻ content of shoots with nitrate, the FAA content of shoots, and transcription levels of both STGs, which suggests that after H₂S treatment, there was a decrease in the SO₄²⁻ content of shoots, which resulted in an increase in the transcription level of STGs, nitrate content, and FAA content in shoots of the sulfur non-treated plants. There was a negative correlation of the thiol content of shoots with FAAs and the transcription level of both STGs, which suggests that after H₂S treatment, there was a decrease in thiol content, which, in turn, increased the transcription level of STGs and the free amino acid content in the shoots of sulfur non-treated plants (Table 3 and Figure 3).

The growth of Brassica pekinensis in a nutritional solution containing SO₄²⁻ was unaffected after 6 days of H₂S exposure at 0.3 μL l⁻¹, and the levels of SO₄²⁻ in the plant organs were unaltered as well. When plants were grown in a sulfate-deficient condition for 4 days and then exposed to 0.1, 0.2, and 0.3 μL l⁻¹H₂S for 6 days, the symptoms of sulfur deficiency were largely alleviated. Plant growth was restored, and after 6 days of exposure, it was even on par with that of plants cultivated at the same time on sulfate or sulfate + 0.3 μL l⁻¹ H₂S. The expression of G1ST, Sultr1;1 and Sultr1;2 and, likewise, the SO₄²⁻ and thiol contents are rarely modified after days under sulfate-sufficient conditions in a climate-controlled room or by increasing the H₂S concentration in the roots of seedlings. Whereas Sultr1;1 was highly up-regulated in sulfate-deprived seedlings, Sultr1;2 was barely impacted, and the contents of SO₄²⁻ and thiols were significantly decreased. Sultr1;1 and Sultr1;2 expression was up-regulated 10-fold and 2-fold simultaneously in sulfate-deprived seedlings compared with sulfate-sufficient seedlings. By increasing the H₂S content in seedling roots, SO₄²⁻ deprivation down-regulated Sultr1;1 and Sultr1;2 expression by around 1.8-fold and 0.5-fold, respectively (Table 3 and Figure 3).

When comparing between seedlings that received enough SO₄²⁻ and those that didn’t, the expression of Sultr1;1 and Sultr1;2 was found to have increased 35-fold and 3.2-fold, respectively (Table 3 and Figure 3). Sultr1;1 was exclusively expressed when SO₄²⁻ was not present in the root environment, but Sultr1;2 was expressed in both sufficient and deficient conditions. With SO₄²⁻ deprivation, the expression of the sulfate transporter increased along with the SO₄²⁻-uptake capacity. Sulfate-uptake capacity in Brassica pekinensis gradually increased during SO₄²⁻ deprivation in growing seedlings and decreased during an increase in H₂S up to 0.3 μL l⁻¹. However, while the expression level of Sultr1;2 was increased during sulfur deprivation, it was not significantly impacted in developing seedlings by increasing the H₂S concentration (Figure 2 and Figure 3).

3.3. Effects of H₂S Treatment on Sulfate Transporter Gene Expression in Plants Grown without and with Sulfate

While SO₄²⁻ deprivation in developing seedlings gradually increased the Sultr1;1 expression level, t decreased with rising H₂S concentrations, just like the SO₄²⁻-uptake capacity (Figure 2 and Figure 3). When seedlings were exposed to atmospheric H₂S, the ability of both sulfate-sufficient and sulfate-deprived roots to absorb SO₄²⁻ decreased in a concentration-dependent manner. Nevertheless, exposure to H₂S had little impact on Sultr1;1 and Sultr1;2 expression (Figure 3). It was observed that H₂S treatment had no direct relationship with an increase in the sulfur-uptake capacity of roots of the Brassica pekinensis seedling, regardless of whether they were grown in SO₄²⁻-containing or SO₄²⁻ deficient media. From two-way ANOVA, it was observed that there was significant variation (p < 0.01) in the growth physiology, physico-chemical parameters, and gene expression levels of STGs in the SO₄²⁻ treated and non-treated plants after H₂S treatment (Table 3, Figure 3).

3.4. Multivariate Cluster Analysis, Non-Metric Multidimensional Scaling, and Principal Component Analysis

A multivariate cluster analysis was performed to detect similarities in the growth, physico-chemical parameters, and transcription levels of STGs in plants after and without sulfur treatment. The cluster analysis grouped the sulfur-treated and non-treated plants into five groups on the basis of changes in their growth, physico-chemical parameters, and transcription level of STGs. Group A included the initial non-treated plants of 0 day which had low biomass, moderate SRR, moderate SO₄²⁻ content in the root and shoot, moderate SO₄²⁻-uptake capacity, and low nitrate, thiol and FAA content in the root and shoot. Even the transcription level of STGs (Sultr1;1 and Sultr1;2) was low at 0 day. Group B included sulfur-treated plants from the 1st and 2nd day that had a low biomass, moderate SRR, low SO₄²⁻-uptake capacity, high SO₄²⁻ content in the root and shoot, low nitrate content in shoots, moderate nitrate content in the root, moderate thiol content in roots and shoots, moderate FAA content in the root and shoot, low expression level of the Sultr1;1 gene, and moderate expression level of the Sultr1;2 gene. Group C included sulfur-treated plants of 3rd- and 4th-day plants that had a high biomass, high SRR, moderate SO₄²⁻-uptake capacity, high SO₄²⁻, thiol, nitrate and FAA content in the root and shoot, low expression level of the Sultr1;1 gene, and moderate expression level of the Sultr1;2 gene. Group D included non-sulfur treated plants from the 1st and 2nd days that had a low biomass, low SRR, high SO₄²⁻-uptake capacity, moderate SO₄²⁻ content in the shoot and root, moderate nitrate and FAA content in the root and shoot, high thiol content in the root and shoot, moderate gene expression level of Sultr1;1, and high expression level of Sultr1;2. Group E included sulfur non-treated plants from the 3rd and 4th day that had a high biomass, high SRR, high SO₄²⁻-uptake capacity, low SO₄²⁻ content in the shoot and root, high nitrate and FAA contents in the root and shoot, moderate thiol content in the root and shoot, and high gene expression level of both STGs (Sultr1;1 and Sultr1;2) (Figure S1 Supplementary Data, Tables S1 and S2 Supplementary Data). Similar clusters were formed by non-metric multidimensional scaling (MDS) (Figure S2 Supplementary Data), which supported the results of the multivariate cluster analysis.

Principle component analysis (PCA) showed that there was a 56.1% variation in sulfur-treated plants from the initial stage and a 25.1% variation of non-sulfur treated plants from the initial stage (Figure 4). The heatmap of PCA suggested that when plants were grown in presence of 0.5 mM SO₄²⁻ for 4 days, there was an increase in the biomass of the whole plant, SRR, and the nitrate, FAA, SO₄²⁻ and thiol contents in the root and shoot, whereas there was a decrease in the expression level of STGs (Sultr1;1 and Sultr1;2) and the SO₄²⁻-uptake capacity of the plant. When plants were grown in absence of SO₄²⁻ there was notable increase in biomass of whole plant, SRR, nitrate, FAA content in root and shoot as well as there was increase in expression level of STG (Sultr1;1 and Sultr1;2) whereas there was a decrease in the thiol and SO₄²⁻ contents in the root and shoot of the plants (Figure 4).

The multivariate cluster analysis was performed to detect similarities in the growth, physico-chemical parameters, and transcription level of STGs following SO₄²⁻ treatment and SO₄²⁻ non-treatment after 6 days of H₂S treatment. The cluster analysis grouped the H₂S-treated plants into four major groups on the basis of changes in their growth, physico-chemical parameters, and transcription level of STGs.

Group A included plants grown in presence of 0.5 mM SO₄²⁻ and further treated with 0 μL l⁻¹ and 0.1 μL l⁻¹ concentrations of H₂S. Group B included plants grown in presence of 0.5 mM SO₄²⁻ and further treated with 0.2 μL l⁻¹ and 0.3 μL l⁻¹ concentrations of H₂S. Group C included plants grown in absence of SO₄²⁻ and further treated with 0 μL l⁻¹ and 0.1 μL l⁻¹ concentrations of H₂S. Group D included plants grown in absence of SO₄²⁻ and further treated with 0.2 μL l⁻¹ and 0.3 μL l⁻¹ concentrations of H₂S (Tables S3 and S4 Supplementary Data, Figure S3 Supplementary Data). Similar clusters were also formed by non-metric multidimensional scaling (MDS) (Figure S4 Supplementary Data), which supported the results of the multivariate cluster analysis.

According to the PCA, there was a 75% variation in the growth, physico-chemical parameters, and STG expression levels of sulfur-treated plants after H₂S treatment, and a 13.1% variation in the growth, physico-chemical parameters, and STG expression levels of sulfur-non-treated plants after H₂S treatment (Figure 5). The heatmap of the PCA suggested that when plants grown in presence of 0.5 mM SO₄²⁻ were treated with a low concentration (0.1 μL l⁻¹) of H₂S for 6 days, there was an increase in the biomass of whole plant, SRR, DMC in the root, and thiol and SO₄²⁻ contents in the root and shoot, whereas there was low DMC in the shoot, low nitrate and low FAA content in the root and shoot, as well as a decrease in the expression level of STGs (Sultr1;1 and Sultr1;2) and SO₄²⁻-uptake capacity of plants. When plants grown in presence of 0.5 mM SO₄²⁻ were treated with a high concentration (0.2 μL l⁻¹ and 0.3 μL l⁻¹) of H₂S for 6 days, there was a moderate increase in the biomass of the whole plant, SRR, DMC in the root, and SO₄²⁻ and thiol contents in the root and shoot, whereas there was low DMC in the shoot, low nitrate and low FAA content in the root and shoot as well as a decrease in the expression level of STGs (Sultr1;1 and Sultr1;2) and the SO₄²⁻-uptake capacity of plants (Figure 5). When plants grown in absence of sulfur were treated with a low concentration (0.1 μL l⁻¹) of H₂S for 6 days, there was a decrease in the biomass of the whole plant, SRR, DMC in the root, and SO₄²⁻ and thiol contents in the root and shoot, whereas there was an increase in DMC in the shoot, an increase in the nitrate and FAA contents in the root and shoot as well as an increase in the expression level of STGs (Sultr1;1 and Sultr1;2) and the SO₄²⁻-uptake capacity of plants. When plants grown in absence of sulfur were treated with a high concentration (0.2 μL l⁻¹ and 0.3 μL l⁻¹) of H₂S for 6 days, there was a decrease in the biomass of the whole plant, SRR, DMC in the root, and SO₄²⁻ and thiol contents in the root and shoot, whereas there was moderate DMC in the shoot, moderate nitrate and FAA contents in the root and shoot as well as moderate STG (Sultr1;1 and Sultr1;2) expression levels and low SO₄²⁻-uptake capacity in the plants (Figure 5).

4. Discussion

The phytotoxic gases SO₂ and H₂S are taken up by plants through foliar absorption as a source of sulfur nutrition from polluted environments [38,39]. Studies influenced by SO₂ and H₂S are excellent resources for obtaining a better understanding of the metabolic regulation of plant SO₄²⁻ uptake and assimilation. Hence, to observe the effects of the relationship between atmospheric hydrogen sulfide (H₂S) deposition and soil sulfur nutrition, Brassica pekinensis was utilized as a model plant in this study. The aim of this investigation was to understand the regulation of uptake of SO₄²⁻ and assimilation in plants by studying the modulation of transcription levels of STGs (Sultr1;1 and Sultr1;2), changes in growth physiology, and SO₄²⁻-uptake capacity of roots when grown in the absence or presence of SO₄²⁻ in a hydroponic nutrient solution. Furthermore, changes in growth, physico-chemical parameters, and gene expression levels of STGs were observed when sulfur-treated and non-treated plants were exposed to phytotoxic H₂S levels in the air.

Brassica species have an extreme tolerance to H₂S in the atmosphere. Brassica seedling biomass production was only considerably reduced after extended exposure to ≥0.4 μL l⁻¹ H₂S [20,29]. Similarly, in other species, glutathione and cysteine levels were elevated in the shoot after H₂S application, but their content in the root was unaffected [20,40]. Fumigating Brassica plants deficient in sulfur with 0.06 μL l⁻¹ H₂S restored the growth rate to that of sulfate-grown plants [26,41]. The level of SO₄²⁻ in such plants was quite low. On the other hand, the water-soluble, non-protein thiol levels of the shoot was enhanced to the levels seen in SO₄²⁻-rich plants [26].

Sulfur is a necessary element for all living species. Sulfur-containing compounds play an important role in improving food quality, disease tolerance, and resistance in the plant, and they also have applications as herbal therapeutic remedies, which is why it is popular as a healing mineral [42,43]. The amount of sulfur a plant needs is determined by the plant’s species and stage of growth. Several secondary metabolites (SMs) of plants that are necessary for the physiological processes, growth, and development of the plant also contain sulfur. Sulfur is also engaged in the creation of disulfide bonds (s=s) in the monitoring of proteins and enzymes [7,44,45].

In the current study, sulfur deficiency led to a decline in biomass that was more marked in shoots than roots, ensuing in a decrease in the SRR. In sulfur-deprived plants, all symptoms of sulfur deficiency were observed, such as a decrease in biomass, yellowing of leaves due to the loss of chlorophyll content, and increases in free amino acid and nitrate contents [35,39]. In previous studies, it was suggested that sulfur-containing molecules, such as proteins containing Fe-S clusters, are necessary in a variety of biological functions, including energy generation, photosynthesis, metabolic reactions, and photoprotection. Sulfate assimilation occurs mostly in the leaves and starts with the activation of SO₄²⁻ to adenosine 5′-phosphosulfate (APS) via ATP sulfurylase (ATPS) [7,46]. Methionine and cysteine are two amino acids that contain sulfur. It is also present in glutathione, phytochelatins, vitamins (biotin and thiamine), coenzyme A, chlorophyll, and S-adenosyl-methionine [45,47,48].

A significant increase in the DMC content was noticed in sulfate-deprived plants after H₂S treatment, which may be due to higher amounts of soluble carbohydrates and the starch content [8,49,50]. Growth of Brassica pekinensis in a SO₄²⁻-containing nutrient solution was unaffected after 6 days of H₂S treatment at 0.3 μL l⁻¹ H₂S, and the amounts of several metabolites, including sulfate, were unaffected. Plants cultivated in a sulfate-deficient medium and treated with 0.1, 0.2, and 0.3 μL l⁻¹ H₂S for 6 days relieved the symptoms of sulfur deficiency [29,39,51]. Plant growth was restored, and it was comparable between plants grown in containing 0.5 mM pedospheric SO₄²⁻ and 0.5 mM pedospheric sulfate + 0.3 μL l⁻¹ atmospheric H₂S. In the present study, it was found that foliar-absorbed H₂S increased the biomass and SRR after sulfate deficiency, which was also found in various earlier studies [14,22].

It was observed that the free amino acid content in Brassica pekinensis seedlings was negatively correlated with thiol concentration. In the root, there was a positive correlation of chlorophyll content with thiol content, whereas there was a negative correlation of chlorophyll content with free amino acid and nitrate contents [20,39].

Thiol content in the root and chlorophyll content in the shoot were down-regulated after H₂S treatment, whereas free amino acid and nitrate contents were up-regulated in the shoots of sulfur-treated plants. Around 2% of the organically decreased sulfur in plants is found as the water-soluble thiol fraction, and under normal circumstances, the tripeptide glutathione makes up greater than 90% of this fraction. Plants synthesize glutathione in two stages and use it for a variety of purposes. Glutamylcysteine is created in the first stage by combining glutamate with cysteine. Glycine is linked to glutamylcysteine in the second stage; this is carried out by glutathione synthase, an enzyme that needs magnesium to be activated [7]. Expression of Group 1 STGs was affected by the thiol content in the root of Brassica pekinensis, according to Jobe et al. [52]; moderate increases and decreases in the thiol content of the root also influenced the expression of Sultr1;2. When seedlings are cultivated in sulfate-containing and SO₄²⁻ deficient media were compared, in the sulfate-deficient seedlings, the SO₄²⁻ and thiol contents decreased by about 16-fold and 2.1-fold, respectively; however, the ability of the roots to absorb sulfate increased by about 6-fold. Similarly, Ausma and De Kok [20] observed in barley plants that reduced sulfate and thiol levels are necessary for an increased sulfate-uptake capacity.

The results indicate that when plants were grown in sulfate-containing media in a climate-controlled environment and different concentrations of H₂S were applied, the transcription level of the Group 1 STGs Sultr1;1 and Sultr1;2 as well as the SO₄²⁻ and thiol levels were altered at a minor level. Sultr1;1 was strongly up-regulated in sulfate-deprived seedlings, but Sultr1;2 was minimally affected; sulfate and thiol levels were significantly reduced. When sulfate-adequate plants were exposed to different concentrations of H₂S in this investigation, the thiol content gradually increased; however, according to Ausma and De Kok [20], thiol contents strongly increased when plants were exposed to H₂S. Sultr1;1 and Sultr1;2 expression was simultaneously up-regulated 10-fold and 2-fold, respectively, in the sulfate-deprived seedlings compared with sulfate-sufficient seedlings. Related results were also found by Etienne et al. [41] while studying how Brassica oleracea regulates SO₄²⁻ intake and the expression of STGs. This suggests that SO₄²⁻-transporter proteins use proton–sulfate co-transport to help plants absorb and transport SO₄²⁻ through their roots [53]. As reported by Miyoshi and Stappenbeck [54] and Sacchi and Noscito [55], it is believed that G1STs are primarily accountable for the root’s uptake of SO₄²⁻ from the growth media. By increasing the H₂S exposure concentration into the roots of sulfate-free plants, Sultr1;1 and Sultr1;2 expression was reduced by around 1.8-fold and 0.5-fold, respectively. When comparing between seedlings that received enough SO₄²⁻ and those that did not, the expression of Sultr1;1 and Sultr1;2 increased 35-fold and 3.2-fold, respectively. According to previous studies [14,15,55,56], the two genes of the Group 1 transporters, Sultr1;1 and Sultr1;2, have dissimilar regulatory patterns in the roots of Chinese cabbage. Sultr1;1 was exclusively expressed when SO₄²⁻ was not present in the root environment, but Sultr1;2 was expressed in both adequate and deficient circumstances. The expression of the SO₄²⁻ transporters was enhanced along with their capacity to absorb SO₄²⁻ during SO₄²⁻ deficiency [41]. The sulfate-uptake capacity in Brassica pekinensis was gradually up-regulated in sulfate-deprived developing seedlings and down-regulated with increasing H₂S concentrations up to 0.3 μL l⁻¹. In contrast, the expression level of Sultr1;2 was up-regulated in SO₄²⁻-deprived conditions, but it was hardly impacted in developing seedlings or with increasing H₂S concentrations. While SO₄²⁻ deprivation in growing seedlings gradually up-regulated the Sultr1;1 expression level, it was down-regulated with rising H₂S concentrations, similar to the SO₄²⁻-uptake capacity. The correlations between root SO₄²⁻, thiol content, and SO₄²⁻-uptake potential of climate-controlled, sulfate-sufficient seedlings were little affected, whereas in sulfate-deprived seedlings, the SO₄²⁻ content and the thiol content were significantly down-regulated 2.8-fold and 1.5-fold, respectively, at the same time. Reduced SO₄²⁻ and thiol contents had a considerable, around 5-fold, up-regulated impact on SO₄²⁻-uptake capacity. It was observed that SO₄²⁻ and thiol contents were down-regulated by 4.5 and 2.3-fold, respectively, while the SO₄²⁻-uptake capacity was up-regulated by 4-fold, according to a comparison of the correlation of SO₄²⁻, thiols, and root SO₄²⁻-uptake potential between SO₄²⁻-adequate and SO₄²⁻-deficient seedlings. When seedlings were exposed to various concentrations of ambient H₂S, SO₄²⁻, thiols, and SO₄²⁻-uptake capacity were unaffected in sulfate-sufficient seedlings but were down-regulated by around 12-fold with increasing H₂S exposure up to 0.3 μL l⁻¹ in SO₄²⁻-deprived seedlings. This suggests that the regulation of sulfur uptake in plants through the roots is regulated by sulfur transporter genes in the response to SO₄²⁻ and thiol contents in the plant. Similarly, in previous studies, sulfate transporters have been discovered to enhance SO₄²⁻ uptake and dispersion in plants [9,28,56].

5. Conclusions

The current study found that Brassica pekinensis can flourish with simply ambient H₂S as a sulfur supply source. According to the current study, when plants are deficient in sulfur, there is a significant increase in free amino acid and nitrate contents, while there is a decline in the biomass, SRR, chlorophyll content, and thiol content, which increases the sulfur-uptake capacity of plants from the atmosphere via foliar absorption. The transcription levels of the Group 1 STGs, Sultr1;1 and Sultr1;2, as well as the SO₄²⁻ and thiol levels, were altered at a diminutive level when plants were grown in sulfate-containing medium in a climate-controlled room and given different concentrations of H₂S. When the sulfate-uptake capacity of plants increases, there is a significant enhancement in the expression level of Group 1 STGs (Sultr1;1 and Sultr1;2), which regulate sulfur transportation through roots. Excess sulfur in the environment or media has less influence on seedling growth, physico-chemical parameters, or gene expression of Group 1 STGs.