Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mango Seed Powder Production
2.2. Dietary Treatments
2.3. Proximate Analysis of Experimental Diets
2.4. Biofloc (BF) Water Formation and Regulation
2.5. Study Setup
2.6. Growth Performance
2.7. Innate Immune Parameter Analyses
2.7.1. Skin Mucus and Serum Collection
2.7.2. Lysozyme and Peroxidase Activities
2.8. Relative Immune- and Antioxidant-Gene Expression Study
2.9. Histological Screening of Intestinal Samples
2.10. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Skin Mucus and Serum Immunities
3.3. Immune-Related and Antioxidant Gene Expression
3.4. Intestinal Morphology
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Caipang, C.M.A.; Mabuhay-Omar, J.; Gonzales-Plasus, M.M. Plant and fruit waste products as phytogenic feed additives in aquaculture. Aquac. Aquar. Conserv. Legis. 2019, 12, 261–268. [Google Scholar]
- Jamal, M.T.; Sumon, A.A.; Pugazhendi, A.; Al Harbi, M.; Hussain, A.; Haque, F. Use of Probiotics in Commercially Important Finfish Aquaculture. Int. J. Probiotics Prebiotics 2020, 15, 7–21. [Google Scholar] [CrossRef] [PubMed]
- Troell, M.; Costa-Pierce, B.; Stead, S.; Cottrell, R.S.; Brugere, C.; Farmery, A.K.; Little, D.C.; Strand, Å.; Pullin, R.; Soto, D. Perspectives on aquaculture’s contribution to the Sustainable Development Goals for improved human and planetary health. J. World Aquac. Soc. 2023, 54, 251–342. [Google Scholar] [CrossRef]
- Hernández-Sánchez, F.; Aguilera-Morales, M.E. Nutritional richness and importance of the consumption of tilapia in the Papaloapan Region. Rev. Electron. Vet. 2012, 13, 1–12. [Google Scholar]
- Munguti, J.M.; Nairuti, R.; Iteba, J.O.; Obiero, K.O.; Kyule, D.; Opiyo, M.A.; Abwao, J.; Kirimi, J.G.; Outa, N.; Muthoka, M. Nile tilapia (Oreochromis niloticus Linnaeus, 1758) culture in Kenya: Emerging production technologies and socio-economic impacts on local livelihoods. Aquac. Fish Fish. 2022, 2, 265–276. [Google Scholar] [CrossRef]
- Tran, N.; Chu, L.; Chan, C.Y.; Peart, J.; Nasr-Allah, A.M.; Charo-Karisa, H. Prospects of fish supply-demand and its implications for food and nutrition security in Egypt. Mar. Policy 2022, 146, 105333. [Google Scholar] [CrossRef]
- Rana, K.J.; Siriwardena, S.; Hasan, M.R. Impact of Rising Feed Ingredient Prices on Aquafeeds and Aquaculture Production; Food and Agriculture Organization of the United Nations (FAO): Québec City, QC, Canada, 2009. [Google Scholar]
- Doan, H.V.; Hoseinifar, S.H.; Elumalai, P.; Tongsiri, S.; Chitmanat, C.; Jaturasitha, S.; Doolgindachbaporn, S. Effects of orange peels derived pectin on innate immune response, disease resistance and growth performance of Nile tilapia (Oreochromis niloticus) cultured under indoor biofloc system. Fish Shellfish Immunol. 2018, 80, 56–62. [Google Scholar] [CrossRef]
- Kaur, R.; Shah, T.K. A review on role of plant waste products on fish growth, health and production. J. Entomol. Zool. Stud. 2017, 5, 583–589. [Google Scholar]
- Daud, N.M.; Putra, N.R.; Jamaludin, R.; Norodin, N.S.M.; Sarkawi, N.S.; Hamzah, M.H.S.; Nasir, H.M.; Zaidel, D.N.A.; Yunus, M.A.C.; Salleh, L.M. Valorisation of plant seed as natural bioactive compounds by various extraction methods: A review. Trends Food Sci. Technol. 2022, 119, 201–214. [Google Scholar] [CrossRef]
- Ballesteros-Vivas, D.; Álvarez-Rivera, G.; Morantes, S.J.; del Pilar Sánchez-Camargo, A.; Ibáñez, E.; Parada-Alfonso, F.; Cifuentes, A. An integrated approach for the valorization of mango seed kernel: Efficient extraction solvent selection, phytochemical profiling and antiproliferative activity assessment. Food Res. Int. 2019, 126, 108616. [Google Scholar] [CrossRef]
- Global Mango Production 2000–2022; Statista: Hamburg, Germany, 2024.
- Martínez-Olivo, A.O.; Carlos-Murillo, M.U.; Sáyago-Ayerdi, S.G.; Sánchez-Burgos, J.A.; Zamora-Gasga, V.M. Optimization of ultrasonic extraction for enhanced polyphenol profile and antioxidant capacity in mango seeds: A comparative study with thermal extraction. Food Chem. Adv. 2023, 3, 100480. [Google Scholar] [CrossRef]
- Lim, K.J.A.; Cabajar, A.A.; Migallos, M.K.V.; Lobarbio, C.F.Y.; Taboada, E.B. Microencapsulation of phenolic compounds from waste mango seed kernel extract by spray drying technology. Nat. Environ. Pollut. Technol. 2019, 18, 765–775. [Google Scholar]
- Shang, A.; Cao, S.-Y.; Xu, X.-Y.; Gan, R.-Y.; Tang, G.-Y.; Corke, H.; Mavumengwana, V.; Li, H.-B. Bioactive compounds and biological functions of garlic (Allium sativum L.). Foods 2019, 8, 246. [Google Scholar] [CrossRef] [PubMed]
- Granato, D.; Shahidi, F.; Wrolstad, R.; Kilmartin, P.; Melton, L.D.; Hidalgo, F.J.; Miyashita, K.; van Camp, J.; Alasalvar, C.; Ismail, A.B. Antioxidant activity, total phenolics and flavonoids contents: Should we ban in vitro screening methods? Food Chem. 2018, 264, 471–475. [Google Scholar] [CrossRef]
- Xu, X.-Y.; Meng, J.-M.; Mao, Q.-Q.; Shang, A.; Li, B.-Y.; Zhao, C.-N.; Tang, G.-Y.; Cao, S.-Y.; Wei, X.-L.; Gan, R.-Y. Effects of tannase and ultrasound treatment on the bioactive compounds and antioxidant activity of green tea extract. Antioxidants 2019, 8, 362. [Google Scholar] [CrossRef]
- Dorta, E.; González, M.; Lobo, M.G.; Sánchez-Moreno, C.; de Ancos, B. Screening of phenolic compounds in by-product extracts from mangoes (Mangifera indica L.) by HPLC-ESI-QTOF-MS and multivariate analysis for use as a food ingredient. Food Res. Int. 2014, 57, 51–60. [Google Scholar] [CrossRef]
- Mercado-Mercado, G.; Montalvo-González, E.; González-Aguilar, G.A.; Alvarez-Parrilla, E.; Sáyago-Ayerdi, S.G. Ultrasound-assisted extraction of carotenoids from mango (Mangifera indica L.‘Ataulfo’) by-products on in vitro bioaccessibility. Food Biosci. 2018, 21, 125–131. [Google Scholar] [CrossRef]
- Blancas-Benitez, F.J.; Mercado-Mercado, G.; Quirós-Sauceda, A.E.; Montalvo-González, E.; González-Aguilar, G.A.; Sáyago-Ayerdi, S.G. Bioaccessibility of polyphenols associated with dietary fiber and in vitro kinetics release of polyphenols in Mexican ‘Ataulfo’mango (Mangifera indica L.) by-products. Food Funct. 2015, 6, 859–868. [Google Scholar] [CrossRef]
- Nouri, A.; Heibati, F.; Heidarian, E. Gallic acid exerts anti-inflammatory, anti-oxidative stress, and nephroprotective effects against paraquat-induced renal injury in male rats. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2021, 394, 1–9. [Google Scholar] [CrossRef]
- Choudhary, D.K.; Chaturvedi, N.; Singh, A.; Mishra, A. Investigation of hypoglycemic effects, oxidative stress potential and xanthine-oxidase activity of polyphenols (gallic acid, catechin) derived from faba bean on 3T3-L1 cell line: Insights into molecular docking and simulation study. Toxicol. Res. 2020, 9, 308–322. [Google Scholar] [CrossRef]
- Ghosh, A.K.; Hasanuzzaman, A.F.M.; Sarower, M.G.; Islam, M.R.; Huq, K.A. Unveiling the biofloc culture potential: Harnessing immune functions for resilience of shrimp and resistance against AHPND-causing Vibrio parahaemolyticus infection. Fish Shellfish Immunol. 2024, 151, 109710. [Google Scholar] [CrossRef] [PubMed]
- Khanjani, M.H.; Sharifinia, M.; Emerenciano, M.G.C. Biofloc Technology (BFT) in Aquaculture: What Goes Right, What Goes Wrong? A Scientific-Based Snapshot. Aquac. Nutr. 2024, 2024, 7496572. [Google Scholar] [CrossRef] [PubMed]
- Khanjani, M.H.; Mozanzadeh, M.T.; Sharifinia, M.; Emerenciano, M.G.C. Broodstock and seed production in biofloc technology (BFT): An updated review focused on fish and penaeid shrimp. Aquaculture 2024, 579, 740278. [Google Scholar] [CrossRef]
- Khanjani, M.H.; Sharifinia, M.; Hajirezaee, S. Biofloc: A sustainable alternative for improving the production of farmed cyprinid species. Aquac. Rep. 2023, 33, 101748. [Google Scholar] [CrossRef]
- Zablon, W.O.; Ogello, E.O.; Getabu, A.; Omondi, R. Biofloc system improves protein utilization efficiency and growth performance of Nile tilapia, Oreochromis niloticus fry: Experimental evidence. Aquac. Fish Fish. 2022, 2, 94–103. [Google Scholar] [CrossRef]
- Ende, S.; Henjes, J.; Spiller, M.; Elshobary, M.; Hanelt, D.; Abomohra, A. Recent advances in recirculating aquaculture systems and role of microalgae to close system loop. Bioresour. Technol. 2024, 407, 131107. [Google Scholar] [CrossRef]
- Lin, Y.-S.; Lin, W.-S.; Tung, J.-W.; Cheng, Y.-C.; Chang, M.-Y.; Chen, C.-Y.; Huang, S.-L. Antioxidant Capacities of Jujube Fruit Seeds and Peel Pulp. Appl. Sci. 2020, 10, 6007. [Google Scholar] [CrossRef]
- Juan, M.-Y.; Chou, C.-C. Enhancement of antioxidant activity, total phenolic and flavonoid content of black soybeans by solid state fermentation with Bacillus subtilis BCRC 14715. Food Microbiol. 2010, 27, 586–591. [Google Scholar] [CrossRef]
- Wannavijit, S.; Outama, P.; Le Xuan, C.; Lumsangkul, C.; Lengkidworraphiphat, P.; Tongsiri, S.; Chitmanat, C.; Van Doan, H. Modulatory effects of longan seed powder on growth performance, immune response, and immune-antioxidant related gene expression in Nile tilapia (Oreochromis niloticus) raised under biofloc system. Fish Shellfish Immunol. 2022, 123, 460–468. [Google Scholar] [CrossRef]
- Khieokhajonkhet, A. Mango seed meal as partial replacement in diet for red hybrid tilapia (Oreochromis niloticus × O. mossambicus): Growth performance, feed utilization and economic efficiency. Int. J. Agric. Technol. 2020, 16, 831–844. [Google Scholar]
- Official Methods of Analysis, 19th ed.; AOAC: Rockville, MD, USA, 2012.
- Mmanda, F.P.; Lindberg, J.E.; Norman Haldén, A.; Mtolera, M.S.P.; Kitula, R.; Lundh, T. Digestibility of Local Feed Ingredients in Tilapia Oreochromis niloticus Juveniles, Determined on Faeces Collected by Siphoning or Stripping. Fishes 2020, 5, 32. [Google Scholar] [CrossRef]
- Zhao, Z.; Xu, Q.; Luo, L.; Li, J.; Wang, L. Effect of feed C/N ratio promoted bioflocs on water quality and production performance of bottom and filter feeder carp in minimum-water exchanged pond polyculture system. Aquaculture 2014, 434, 442–448. [Google Scholar] [CrossRef]
- Li, R.; Cho, S.H.; Kim, T. Effect of replacing dietary fish meal protein with combined animal meals on the growth performance of olive flounder (Paralichthys olivaceus). Aquac. Rep. 2023, 32, 101712. [Google Scholar] [CrossRef]
- Van Doan, H.; Hoseinifar, S.H.; Sringarm, K.; Jaturasitha, S.; Khamlor, T.; Dawood, M.A.; Esteban, M.Á.; Soltani, M.; Musthafa, M.S. Effects of elephant’s foot (Elephantopus scaber) extract on growth performance, immune response, and disease resistance of Nile tilapia (Oreochromis niloticus) fingerlings. Fish Shellfish Immunol. 2019, 93, 328–335. [Google Scholar] [CrossRef]
- Parry, R.M., Jr.; Chandan, R.C.; Shahani, K.M. A rapid and sensitive assay of muramidase. Proc. Soc. Exp. Biol. Med. 1965, 119, 384–386. [Google Scholar] [CrossRef]
- Outama, P.; Le Xuan, C.; Wannavijit, S.; Lumsangkul, C.; Linh, N.V.; Montha, N.; Tongsiri, S.; Chitmanat, C.; Van Doan, H. Modulation of growth, immune response, and immune-antioxidant related gene expression of Nile tilapia (Oreochromis niloticus) reared under biofloc system using mango peel powder. Fish Shellfish Immunol. 2022, 131, 1136–1143. [Google Scholar] [CrossRef]
- Quade, M.J.; Roth, J.A. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet. Immunol. Immunopathol. 1997, 58, 239–248. [Google Scholar] [CrossRef]
- Le Xuan, C.; Linh, N.V.; Wannavijit, S.; Outama, P.; Fontana, C.M.; Meepowpan, P.; Van Doan, H. Influences of makiang (Syzygium nervosum) seed powder on growth performance, immunological response, antioxidant and immune related gene expression in juvenile Nile tilapia (Oreochromis niloticus). Aquaculture 2024, 588, 740943. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Bancroft, J.D.; Gamble, M. Theory and Practice of Histological Techniques; Elsevier Health Sciences: Amsterdam, The Netherlands, 2008. [Google Scholar]
- Yossa, R.; Verdegem, M. Misuse of multiple comparison tests and underuse of contrast procedures in aquaculture publications. Aquaculture 2015, 437, 344–350. [Google Scholar] [CrossRef]
- Ghosh, T. Recent advances in the probiotic application of the Bacillus as a potential candidate in the sustainable development of aquaculture. Aquaculture 2024, 594, 741432. [Google Scholar] [CrossRef]
- Cherian, T.; Ragavendran, C.; Vijayan, S.; Kurien, S.; Peijnenburg, W.J.G.M. A review on the fate, human health and environmental impacts, as well as regulation of antibiotics used in aquaculture. Environ. Adv. 2023, 13, 100411. [Google Scholar] [CrossRef]
- Sampathkumar, K.; Yu, H.; Loo, S.C.J. Valorisation of industrial food waste into sustainable aquaculture feeds. Future Foods 2023, 7, 100240. [Google Scholar] [CrossRef]
- Onomu, A.J.; Okuthe, G.E. The Role of Functional Feed Additives in Enhancing Aquaculture Sustainability. Fishes 2024, 9, 167. [Google Scholar] [CrossRef]
- Falaye, E.; Shakiru Okanlawon, S.; Salimata, S.; Martha, K. Performance of Oreochromis niloticus juveniles fed autoclaved mango seed kernel diets. Aceh J. Anim. Sci. 2021, 6, 39–44. [Google Scholar] [CrossRef]
- El-Houseiny, W.; Abd-Allah, N.A.; Abd-Elhakim, Y.M.; Abdel-Warith, A.W.A.; Younis, E.M.; Davies, S.J.; Metwally, M.M.; Nasr, M.E.; Al-Sagheer, A.A.; Hassan, B.A.; et al. Dietary garden cress (Lepidium sativum) seeds mitigate the effect of aflatoxin B1 contamination on growth, antioxidant status, AFB1 residues, immune response, and tissue architecture of Oreochromis niloticus. Aquac. Rep. 2024, 36, 102040. [Google Scholar] [CrossRef]
- Abdel Rahman, A.N.; Amer, S.A.; Masoud, S.R.; El-Saber, M.M.; Osman, A.; Younis, E.M.; Abdelwarith, A.A.; Davies, S.J.; Khamis, T.; Ibrahim, R.E. Neem seed protein hydrolysate as a fishmeal substitute in Nile tilapia: Effects on antioxidant/immune pathway, growth, amino acid transporters-related gene expression, and Aeromonas veronii resistance. Aquaculture 2023, 573, 739593. [Google Scholar] [CrossRef]
- Abd El-Naby, A.S.; El Asely, A.M.; Hussein, M.N.; Fawzy, R.M.; Abdel-Tawwab, M. Stimulatory effects of dietary chia (Salvia hispanica) seeds on performance, antioxidant-immune indices, histopathological architecture, and disease resistance of Nile tilapia. Aquaculture 2023, 563, 738889. [Google Scholar] [CrossRef]
- Rashidian, G.; Zare, M.; Tabibi, H.; Stejskal, V.; Faggio, C. The synergistic effects of four medicinal plant seeds and chelated minerals on the growth, immunity, and antioxidant capacity of rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2023, 139, 108930. [Google Scholar] [CrossRef]
- Serrano, E.; Lefillanca, J.K.; Carrasco, J.; Davies, S.J.; Hernandez Arias, A.J. Evaluation of andean lupin (Lupinus mutabilis) seed meal as a dietary component on growth performance, feed utilization, nutrient digestibility, and liver histology of rainbow trout (Oncorhynchus mykiss) Juveniles. Aquac. Rep. 2024, 34, 101919. [Google Scholar] [CrossRef]
- Ashry, A.M.; Habiba, M.M.; Abdel-Wahab, A.; Younis, E.M.; Davies, S.J.; Elnakeeb, M.A.; Abdelghany, M.F.; El-Zayat, A.M.; El-Sebaey, A.M. Dietary effect of powdered herbal seeds on zootechnical performance, hemato-biochemical indices, immunological status, and intestinal microbiota of European sea bass (Dicentrarchus labrax). Aquac. Rep. 2024, 36, 102074. [Google Scholar] [CrossRef]
- Waqas, M.; Salman, M.; Sharif, M.S. Application of polyphenolic compounds in animal nutrition and their promising effects. J. Anim. Feed Sci. 2023, 32, 233–256. [Google Scholar] [CrossRef]
- Araújo, L.R.S.; Watanabe, P.H.; Fernandes, D.R.; Maia, I.R.O.; Vieira, E.H.M.; Silva, E.C.; Trevisan, M.T.S.; Pinheiro, R.R.S.; Freitas, E.R. Ethanol extract of mango seed is a suitable plant-based replacement for synthetic antioxidants in pig grower–finisher diets. Anim. Prod. Sci. 2019, 59, 1501–1509. [Google Scholar] [CrossRef]
- Gupta, A.K.; Gurjar, P.S.; Beer, K.; Pongener, A.; Ravi, S.C.; Singh, S.; Verma, A.; Singh, A.; Thakur, M.; Tripathy, S.; et al. A review on valorization of different byproducts of mango (Mangifera indica L.) for functional food and human health. Food Biosci. 2022, 48, 101783. [Google Scholar] [CrossRef]
- Natnan, M.E.; Low, C.-F.; Chong, C.-M.; Bunawan, H.; Baharum, S.N. Oleic acid as potential immunostimulant in metabolism pathways of hybrid grouper fingerlings (Epinephelus fuscoguttatus × Epinephelus lanceolatus) infected with Vibrio vulnificus. Sci. Rep. 2023, 13, 12830. [Google Scholar] [CrossRef]
- Beriso, Y.; Tesfaye, E. Livestock feed potential of mango (Mangifera indica Linn) seed kernel. Cogent Food Agric. 2024, 10, 2301833. [Google Scholar] [CrossRef]
- Assan, D.; Huang, Y.; Mustapha, U.F.; Addah, M.N.; Li, G.; Chen, H. Fish Feed Intake, Feeding Behavior, and the Physiological Response of Apelin to Fasting and Refeeding. Front. Endocrinol. 2021, 12, 798903. [Google Scholar] [CrossRef]
- Hasan, M.M.; Islam, M.R.; Haque, A.R.; Kabir, M.R.; Khushe, K.J.; Hasan, S.M.K. Trends and challenges of fruit by-products utilization: Insights into safety, sensory, and benefits of the use for the development of innovative healthy food: A review. Bioresour. Bioprocess 2024, 11, 10. [Google Scholar] [CrossRef]
- Yahia, E.M.; Ornelas-Paz, J.d.J.; Brecht, J.K.; García-Solís, P.; Maldonado Celis, M.E. The contribution of mango fruit (Mangifera indica L.) to human nutrition and health. Arab. J. Chem. 2023, 16, 104860. [Google Scholar] [CrossRef]
- El-Houseiny, W.; El-Murr, A.; El-Sayed, B. Evaluation of Dietary Inclusion of Mango Kernel Meal and Oat Extract on Performance and Immunity of Oreochromis niloticus. Zagazig Vet. J. 2017, 45, 118–125. [Google Scholar] [CrossRef]
- Sahu, S.; Das, B.K.; Pradhan, J.; Mohapatra, B.; Mishra, B.; Sarangi, N. Effect of Magnifera indica kernel as a feed additive on immunity and resistance to Aeromonas hydrophila in Labeo rohita fingerlings. Fish Shellfish Immunol. 2007, 23, 109–118. [Google Scholar] [CrossRef] [PubMed]
- Lebaka, V.R.; Wee, Y.J.; Ye, W.; Korivi, M. Nutritional Composition and Bioactive Compounds in Three Different Parts of Mango Fruit. Int J Env. Res Public Health 2021, 18, 741. [Google Scholar] [CrossRef] [PubMed]
- Guebebia, S.; Espinosa-Ruiz, C.; Zourgui, L.; Cuesta, A.; Romdhane, M.; Esteban, M.Á. Effects of okra (Abelmoschus esculentus L.) leaves, fruits and seeds extracts on European sea bass (Dicentrarchus labrax) leukocytes, and their cytotoxic, bactericidal and antioxidant properties. Fish Shellfish Immunol. 2023, 138, 108799. [Google Scholar] [CrossRef] [PubMed]
- Magnoni, L.J.; Silva-Brito, F.; Cavalheri, T.; Espirito-Santo, C.; Palma, M.; Ozório, R.; Panserat, S.; Morais, S.; Viegas, I. Dietary tributyrin supplementation enhances the immune and antioxidant responses of rainbow trout (Oncorhynchus mykiss) without changes in fish performance. Aquac. Rep. 2023, 32, 101735. [Google Scholar] [CrossRef]
- Rudrapal, M.; Khairnar, S.J.; Khan, J.; Dukhyil, A.B.; Ansari, M.A.; Alomary, M.N.; Alshabrmi, F.M.; Palai, S.; Deb, P.K.; Devi, R. Dietary Polyphenols and Their Role in Oxidative Stress-Induced Human Diseases: Insights Into Protective Effects, Antioxidant Potentials and Mechanism(s) of Action. Front. Pharmacol. 2022, 13, 806470. [Google Scholar] [CrossRef]
- Wang, X.; Qi, Y.; Zheng, H. Dietary Polyphenol, Gut Microbiota, and Health Benefits. Antioxidants 2022, 11, 1212. [Google Scholar] [CrossRef]
- Castro, R.J.; Pedroza, K.; Hong, M.Y. The effects of mango consumption on vascular health and immune function. Metab. Open 2023, 20, 100260. [Google Scholar] [CrossRef]
- Pourahad Anzabi, M.; Sarvi Moghanlou, K.; Imani, A.; Tahmasebi, R. Effects of dietary vitamin E and C co-supplementation on growth performance, hemato-immunological indices, digestive enzymes activity, and intestinal histology of rainbow trout fed diet contained spoiled fish meal and oil. Aquac. Rep. 2023, 33, 101842. [Google Scholar] [CrossRef]
- Li, T.; Zhang, Z.-L.; Zheng, P.-H.; Li, J.-T.; Zhang, X.-X.; Li, J.-J.; Lu, Y.-N.; Xian, J.-A.; Guo, H.; Lu, Y.-P. Effects of dietary vitamin C on the growth performance, muscle composition, non-specific immunity, and resistance of juvenile ivory shell (Babylonia areolata) to ammonia. Aquac. Rep. 2024, 36, 102188. [Google Scholar] [CrossRef]
- Diwan, A.D.; Harke, S.N.; Panche, A.N. Studies on exploring the potentials of gut microbiomes to mitigate the bacterial and viral diseases of fish and shellfish in aquaculture farming. Microbe 2024, 2, 100031. [Google Scholar] [CrossRef]
- Qin, H.; Long, Z.; Ma, J.; Kong, L.; Lin, H.; Zhou, S.; Lin, Y.; Huang, Z.; Liu, L.; Li, Z. Growth performance, digestive capacity and intestinal health of juvenile spotted seabass (Lateolabrax maculatus) fed dietary laminarin supplement. Front. Mar. Sci. 2023, 10, 1242175. [Google Scholar] [CrossRef]
- Li, Q.; Fu, B.; Huang, L.; Wang, F.; Zhou, D.; Yang, Q.; Zou, Y.; Xiao, Y.; Liao, S.; Xing, D. Effects of silkworm pupae powder on growth performance, muscle fatty acid composition, and intestinal function in mandarin fish (Siniperca chuatsi). Aquac. Rep. 2024, 39, 102435. [Google Scholar] [CrossRef]
- Su, X.; Ji, D.; Yao, J.; Zou, Y.; Yan, M. Comparative analysis of intestinal characteristics of largemouth bass (Micropterus salmoides) and intestinal flora with different growth rates. Fishes 2022, 7, 65. [Google Scholar] [CrossRef]
Test Items | Results |
---|---|
Dry matter | 95.30 |
Ash | 2.28 |
Crude fiber | 5.48 |
Crude protein | 5.5 |
Ether extract | 6.84 |
Nitrogen-free extract | 75.2 |
Test Items | Results | Methods |
---|---|---|
DPPH (IC50) (mg/mL) | 0.21 ± 0.00 | [29] |
ABTS+ (mg TE/g) | 5.38 ± 2.47 | [29] |
FRAP (mg TE/g) | 64.98 ± 0.41 | [29] |
Total flavonoid content (mg CE/g) | 4.40 ± 0.18 | [30] |
Total phenolic content (mg GAE/g) | 36.97 ± 0.54 | [30] |
Ingredients | Experimental Diets (g kg−1) | ||||
---|---|---|---|---|---|
MS0 | MS10 | MS20 | MS40 | MS80 | |
Fish meal | 200 | 200 | 200 | 200 | 200 |
Soybean meal | 390 | 390 | 390 | 390 | 390 |
Corn meal | 150 | 150 | 150 | 150 | 150 |
Rice bran | 150 | 145 | 140 | 125 | 90 |
Wheat flour | 70 | 70 | 70 | 70 | 70 |
Binder | 20 | 15 | 10 | 5 | 0 |
Soybean oil | 2 | 2 | 2 | 2 | 2 |
MS a | 0 | 10 | 20 | 40 | 80 |
Premix b | 10 | 10 | 10 | 10 | 10 |
Vitamin C98% | 8 | 8 | 8 | 8 | 8 |
Proximate composition of the experimental diets (g kg−1) | |||||
Dry matter | 98.87 | 98.13 | 98.21 | 98.18 | 98.31 |
GE (Kcal/kg) | 4231.5 | 4224.6 | 4218.9 | 4227.4 | 4224.6 |
Crude protein | 32.14 | 32.27 | 32.09 | 32.33 | 32.18 |
Ash | 8.04 | 7.98 | 7.99 | 8.1 | 8.08 |
Fiber | 3.98 | 3.78 | 3.86 | 3.91 | 3.79 |
Crude lipid | 3.01 | 3.11 | 3.09 | 2.98 | 3.00 |
Target Gene | Sequence (5′–3′) | Tm (°C) | Product Size (bp) | Reference |
---|---|---|---|---|
18S rRNA | F: GTGCATGGCCGTTCTTAGTT R: CTCAATCTCGTGTGGCTGAA | 60 | 150 | XR_003216134 |
IL-1 | F: GTCTGTCAAGGATAAGCGCTG R: ACTCTGGAGCTGGATGTTGA | 59 | 200 | XM_019365844 |
IL-8 | F: CTGTGAAGGCATGGGTGTG R: GATCACTTTCTTCACCCAGGG | 59 | 196 | NM_001279704 |
LBP | F: ACCAGAAACTGCGAGAAGGA R: GATTGGTGGTCGGAGGTTTG | 59 | 200 | XM_013271147 |
GST-α | F: ACTGCACACTCATGGGAACA R: TTAAAAGCCAGCGGATTGAC | 60 | 190 | NM_001279635 |
GPX | F: GGTGGATGTGAATGGAAAGG R: CTTGTAAGGTTCCCCGTCAG | 60 | 190 | NM_001279711 |
GSR | F: CTGCACCAAAGAACTGCAAAR: CCAGAGAAGGCAGTCCACTC | 60 | 172 | XM_005467348 |
MS0 | MS10 | MS20 | MS40 | MS80 | p-Value | |
---|---|---|---|---|---|---|
IW (g) | 15.32 ± 0.05 a | 15.23 ± 0.03 a | 15.33 ± 0.03 a | 15.30 ± 0.05 a | 15.28 ± 0.03 a | 0.9785 |
FW (g) | ||||||
4 weeks | 39.61 ± 1.67 b | 42.77 ± 1.33 a | 41.86 ± 1.15 a | 41.37 ± 0.86 ab | 40.81 ± 0.07 ab | 0.0224 |
8 weeks | 86.54 ± 5.86 a | 91.70 ± 3.95 a | 91.72 ± 0.56 a | 91.87 ± 3.3 a | 87.99 ± 3.14 a | 0.675 |
WG (g) | ||||||
4 weeks | 24.29 ± 1.64 b | 27.53 ± 1.33 a | 26.53 ± 1.12 a | 26.07 ± 0.88 ab | 25.53 ± 0.06 ab | 0.0312 |
8 weeks | 71.47 ± 0.89 a | 76.47 ± 3.84 a | 76.38 ± 0.53 a | 76.57 ± 3.35 a | 72.07 ± 3.12 a | 0.747 |
SGR (%/day) | ||||||
4 weeks | 3.16 ± 0.13 b | 3.44 ± 0.10 a | 3.35 ± 0.09 a | 3.32 ± 0.08 ab | 3.27 ± 0.00 ab | 0.0412 |
8 weeks | 2.88 ± 0.12 a | 2.99 ± 0.07 a | 2.98 ± 0.01 a | 2.99 ± 0.07 a | 2.90 ± 0.06 a | 0.8210 |
FCR | ||||||
4 weeks | 0.78 ± 0.05 b | 0.89 ± 0.04 a | 0.85 ± 0.06 ab | 0.83 ± 0.01 ab | 0.82 ± 0.05 ab | 0.0156 |
8 weeks | 0.73 ± 0.06 a | 0.82 ± 0.12 a | 0.71 ± 0.03 a | 0.70 ± 0.02 a | 0.78± 0.02 a | 0.1456 |
SR (%) | ||||||
4 weeks | 96.67 ± 2.89 a | 100.0 ± 0.00 a | 98.33 ± 2.89 a | 96.33 ± 2.89 a | 96.67 ± 2.89 a | 0.2143 |
8 weeks | 96.67 ± 2.89 ab | 95.00 ± 5.00 ab | 96.67 ± 3.21 a | 96.33 ± 2.75 a | 91.67 ± 7.64 b | 0.0297 |
MS0 | MS10 | MS20 | MS40 | MS80 | SEM | p-Value | |
---|---|---|---|---|---|---|---|
Villus height (VH) | 3417.39 c | 4087.06 ab | 4224.12 a | 4230.45 a | 3943.28 b | 32.94 | <0.001 |
Villus width (VW) | 631.48 ab | 612.06 b | 657.87 a | 659.89 a | 602.35 b | 5.14 | <0.001 |
Crypt depth (CD) | 207.11 a | 129.78 b | 113.12 b | 99.25 bc | 96.10 c | 3.86 | <0.001 |
Villus: Crypt ratio (VH: CD) | 17.57 d | 33.93 c | 39.36 b | 44.50 a | 42.72 ab | 0.98 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fontana, C.M.; Sumon, M.A.A.; Wannavijit, S.; Lubis, A.R.; Khongdee, N.; Linh, N.V.; Phimolsiripol, Y.; Hoseinifar, S.H.; Van Doan, H. Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus). Fishes 2024, 9, 514. https://doi.org/10.3390/fishes9120514
Fontana CM, Sumon MAA, Wannavijit S, Lubis AR, Khongdee N, Linh NV, Phimolsiripol Y, Hoseinifar SH, Van Doan H. Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus). Fishes. 2024; 9(12):514. https://doi.org/10.3390/fishes9120514
Chicago/Turabian StyleFontana, Camilla Maria, Md Afsar Ahmed Sumon, Supreya Wannavijit, Anisa Rilla Lubis, Nuttapon Khongdee, Nguyen Vu Linh, Yuthana Phimolsiripol, Seyed Hossein Hoseinifar, and Hien Van Doan. 2024. "Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus)" Fishes 9, no. 12: 514. https://doi.org/10.3390/fishes9120514
APA StyleFontana, C. M., Sumon, M. A. A., Wannavijit, S., Lubis, A. R., Khongdee, N., Linh, N. V., Phimolsiripol, Y., Hoseinifar, S. H., & Van Doan, H. (2024). Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus). Fishes, 9(12), 514. https://doi.org/10.3390/fishes9120514