Next Article in Journal
Natural Bacterial Co-Infection in Farmed European Sea Bass Intended for Experimental Research in Sicily, Southern Italy: Pathological Findings
Next Article in Special Issue
Analysis of the Polyculture Model of the Bivalves Anadara broughtonii and Chlamys farreri in Suspension Cages in Shallow Seas
Previous Article in Journal
Dietary Effect of a Plant-Based Mixture (Phyto AquaMeric) on Growth Performance, Biochemical Analysis, Intestinal Histology, Gene Expression and Environmental Parameters of Nile Tilapia (Oreochromis niloticus)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 9
10.3390/fishes9090359
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Discovery of Methyl-End Desaturases in Razor Clam Sinonovacula constricta (Lamarck 1818) and Their Spatio-Temporal Expression

by
Xinyi Chen
1,
Xiang Fang
1,
Dongzi Yang
1,
Jilin Xu
1,2 and
Zhaoshou Ran
1,3,*
1
Key Laboratory of Aquacultural Biotechnology Ministry of Education, Ningbo University, Ningbo 315211, China
2
Fujian Dalai Seedling Technology Co., Ltd., Fuzhou 350600, China
3
Marine Biotechnology of Zhejiang Province, Ningbo 315211, China
*
Author to whom correspondence should be addressed.
Fishes 2024, 9(9), 359; https://doi.org/10.3390/fishes9090359
Submission received: 31 July 2024 / Revised: 7 September 2024 / Accepted: 11 September 2024 / Published: 13 September 2024
(This article belongs to the Special Issue Advances in Bivalve Aquaculture)
Browse Figures
Versions Notes

Abstract

:
Clarifying the biosynthetic pathway of the long-chain polyunsaturated fatty acids (LC-PUFA) of Sinonovacula constricta is essential for utilizing its LC-PUFA resources. Methyl-end (or “ωx”) desaturases are the rate-limiting enzymes in LC-PUFA biosynthesis, catalyzing the conversion of oleic acid to linoleic acid (LA) or LA to α-linolenic acid. However, their presence in S. constricta remains uncertain. Herein, we identified two ωx desaturase-like genes within the S. constricta genome, both located on the ninth chromosome possibly due to genome duplication. These genes exhibited nearly identical sequences, differing by only one amino acid, and each encodes a 354-residue peptide with typical ωx desaturase characteristics. Phylogenetic analysis grouped these putative ωx desaturases with similar enzymes from other invertebrates. However, when heterologously expressed in yeast, they exhibited no detectable desaturation activity. This suggests either non-functionality in yeast or extremely subtle desaturation abilities. Additionally, both genes displayed the highest expression in the inhalant siphon rather than in digestive tissues and exhibited relatively high expression throughout the development stages of S. constricta, except in zygotes. These findings suggest potential in vivo functional roles for these ωx desaturases in S. constricta. Collectively, these results significantly enrich our understanding of the repertoire of LC-PUFA biosynthetic enzymes in this important bivalve species.
Keywords:
methyl-end desaturases; long-chain polyunsaturated fatty acids; marine mollusks
Key Contribution: The discovery of methyl-end desaturases contributes to the knowledge of the repertoire of LC-PUFA biosynthetic enzymes in S. constricta.

1. Introduction

Long-chain polyunsaturated fatty acids (LC-PUFA, C ≥ 20, double bonds ≥ 3), such as arachidonic acid (20:4n-6, ARA), eicosapentaenoic acid (20:5n-3, EPA), and docosahexaenoic acid (22:6n-3, DHA), are crucial for cell membrane composition, energy production, and signal transduction [1,2,3]. Due to humans’ insufficient self-supply, these fatty acids (FA) are essential dietary nutrients to meet normal development and metabolism [4].
Marine mollusks are rich in LC-PUFA, serving as excellent dietary LC-PUFA resources for human consumption [5]. To efficiently utilize these LC-PUFA resources, it is essential to understand the biosynthetic pathway of LC-PUFA in marine mollusks. The biosynthesis of LC-PUFA involves a series of desaturation and elongation steps catalyzed by fatty acyl desaturase (Fads) and the elongases of very-long-chain fatty acids (Elovls), as thoroughly reviewed in reference [6]. Specifically, as illustrated in Figure 1, the methyl-end (or “ωx”) desaturases, namely ω6 desaturase (Δ12 Fad) and ω3 desaturase (Δ15 Fad), catalyze the conversion of oleic acid (OA, 18:1n-9) to linoleic acid (LA, 18:2n-6) and LA to α-linolenic acid (ALA, 18:3n-3), respectively. Following this, LA and ALA are further desaturated into 18:3n-6 and 18:4n-3 by Δ6 Fad. These are further elongated into 20:3n-6 and 20:4n-3 by Elovl2/5. With the desaturation of Δ5 Fad, 20:3n-6 is further desaturated into ARA, while 20:4n-3 is desaturated into EPA. Through two additional elongation steps catalyzed by Elovl2/5/4 (primarily by Elovl4), an additional desaturation step catalyzed by Δ6 Fad, and a final step of β-oxidation, EPA is converted into DHA. Alternatively, species with Δ8 Fad can obtain 20:3n-6 and 20:4n-3 through an initial elongation step with Elovl2/5 followed by a desaturation step with Δ8 Fad from LA and ALA, respectively. Species with Δ4 Fad can directly obtain DHA through one desaturation step with Δ4 Fad from 22:5n-3.
Over the past decades, Fad and Elovl enzymes have been characterized in several commercial marine mollusks [6]. These include ωx desaturases in Patella vulgata [7] and O. vulgaris [8]; Δ5 Fad in Haliotis discus hannai [9], Chlamys nobilis [10], and Octopus vulgaris [11]; Δ8 Fad in H. discus hannai [12]; Elovl2/5 in C. nobilis [13], Crassostrea angulata [14], and O. vulgaris [15]; and Elovl4 in H. discus hannai [12], O. vulgaris [16], and Sepia officinalis [17]. However, the LC-PUFA biosynthetic pathways of these animals are incomplete, due to the lack of ωx desaturases, Δ4 Fad, or Δ6 Fad.
The razor clam Sinonovacula constricta (Lamarck 1818) is one of the five principal marine mollusks in the global aquaculture industry that widely resides in the intertidal zones and estuarine waters along the coasts of the West Pacific Ocean [18,19], with high nutritional values, being especially rich in LC-PUFA [20]. Previously, our group demonstrated that S. constricta is the first marine mollusk known to possess the complete LC-PUFA biosynthetic pathway of the Sprecher pathway [21,22,23]. This was achieved by characterizing the Fads of Δ5 and Δ6 Fad [22], as well as the Elovls of Elovl2/5 and Elovl4 [23], which utilize LA and ALA as precursors. However, it remains unclear whether this clam has the ability to catalyze the conversion of OA to LA or LA to ALA. Therefore, the present study aimed to molecularly clone and characterize the homologs of ωx desaturases from S. constricta, as well as to assess their spatio-temporal expression. The results will significantly expand our knowledge of the repertoire of LC-PUFA biosynthetic enzymes in this important bivalve species and provide a foundation for further utilization of its LC-PUFA resources.

2. Materials and Methods

2.1. Retrieval of Putative ωx Desaturases from the S. constricta Genome

Utilizing ωx desaturases (Δ12 and Δ15 Fads) from O. vulgaris (QBC98328.1 and QBC98329.1), P. vulgata (ATV93528.1 and ATV93529.1), and Caenorhabditis elegans (CAB05304.1 and NP_001023560.1) as queries, a search was conducted within the S. constricta genome [19] to identify potential ωx desaturases using HMMER 3.3.1 and Pfam 33.1 software (E-Value, 1 × e−10). Candidates were selected based on the presence of conserved features such as the three histidine boxes (H***H, H**HH, and H**HH) typical in ωx desaturases [24]. Subsequently, two putative S. constricta ωx desaturases, named S. constricta ωx_a and ωx_b, were obtained. Meanwhile, their chromosomal location was confirmed by aligning them with the assembled S. constricta genome [19].

2.2. Molecular Cloning of Putative S. constricta ωx Desaturases

Total RNA was isolated from freshly homogenized tissues of adult S. constricta (55.23 ± 3.31 mm × 17.82 ± 1.21 mm, shell length ×shell width, mean ± SD), including foot muscle, gill, and gonad tissue, using the MiniBEST Universal RNA Extraction Kit (Takara, Japan). The S. constricta were purchased from a local seafood market (Lulin Aquatic Market) in Ningbo, China, without acclimation. Subsequently, 1 µg of RNA was transcribed into cDNA using the PrimeScript RT-PCR Kit (Takara, Japan). Based on the assembled base sequence of the open reading frames (ORF) of putative S. constricta ωx desaturases, specific primers were designed using Primer Premier 5 software [25] (Table 1) and used for polymerase chain reaction (PCR), utilizing the synthesized cDNA as the template. The PCR was conducted on an Eppendorf PCR instrument (Mastercycler® X40, Eppendorf, Hamburg, Germany).

2.3. Sequence Alignment and Phylogenetic Analysis

The deduced amino acid (aa) sequences of the putative S. constricta ωx desaturases were aligned with those of functionally characterized ωx desaturases from invertebrates using Clustal X 2.0 software [26]. The sequences used for alignment were identical to the query sequences.
Based on the deduced aa sequences of putative S. constricta ωx desaturases, typical ωx desaturases, and front-end desaturases (Δ5, 6, and 8 Fad) from representative invertebrates, primarily marine mollusks, a phylogenetic tree was constructed using the maximum-likelihood approach (MEGA 7 package software) [27]. Confidence in the resulting phylogenetic tree’s branch topology was measured by bootstrapping through 1000 iterations.

2.4. Functional Characterization of Putative S. constricta ωx Desaturases through Heterologous Expression in Yeast

PCR fragments corresponding to the ORF of putative S. constricta ωx desaturases were amplified from a cDNA template using the High-Fidelity PrimerScript RT-PCR kit (Takara, Japan) and specific primers harboring restriction sites for HindIII and EcoRI (Table 1). The resulting DNA products were purified, digested with corresponding restriction endonucleases (New England Biolabs, Hopkinton, MA, USA), and then inserted into a similarly digested pYES2 vector (Invitrogen, Carlsbad, CA, USA), utilizing a DNA ligation kit (Takara, Japan). The resulting plasmids, pY_S. constricta ωx_a and ωx_b, were subsequently transformed into Eescherichia coil DH5α competent cells to generate plasmid preparations.
Plasmid preparations with confirmed sequences were transformed into Saccharomyces cerevisiae InvSc1 competent cells. A control treatment, transformed with the empty pYES2 vector, was also included. Yeasts carrying the respective recombinants were selected using S. cerevisiae minimal medium-uracil (2% glucose, 0.67% nitrogen base, and 0.19% uracil dropout medium). Positive single clones were further confirmed through sequencing. Yeasts successfully transformed with either pY_S. constricta ωx_a or ωx_b were initially cultured in a transition medium (2% raffinose, 0.67% nitrogen base, and 0.19% uracil dropout medium, 10 mL) for 24 h. Afterwards, the cell suspensions were centrifuged at 500× g for 2 min at room temperature. The precipitated yeasts were resuspended in induction medium (2% galactose, 0.67% nitrogen base, 1% tergitol type NP-40, and 0.19% uracil dropout medium) at OD600 = 0.4. The volume of the incubation medium was kept at 10 mL. Notably, LA (0.5 mM, Cayman Chemicals, Ann Arbor, MI, USA) was added at this stage to detect Δ15 Fad activity; its absence was used to detect Δ12 Fad activity using the yeast’s endogenous OA. Each trial was conducted using three independent biological experiments, each in triplicate. Subsequently, cell cultures were incubated in a shaker at 30 °C for 2 days at 250 rpm/min. Following incubation, all amounts of yeasts were harvested (500× g for 2 min) and washed twice with 5 mL of ice-cold Hanks’s balanced salt solution (Invitrogen, USA). Finally, the obtained yeasts were freeze-dried for further FA analyses.

2.5. FA Analysis by Gas Chromatography–Mass Spectrometry (GC–MS)

Fatty acid extraction and identification followed the methods outlined in our previous publications [15]. Initially, total lipids were extracted from all freeze-dried yeasts with CHCl3/CH3OH/H2O (1:2:0.8, v/v/v) containing 0.01% butylated hydroxytoluene (BHT) as an antioxidant. Subsequently, a sequential addition of 0.2 mL of toluene, 1.5 mL of methanol, and 0.3 mL of HCl (8%, w/v) in methanol/water (85:15, v/v) was made to the extracted lipid samples. The resulting mixture (2 mL) underwent heating at 100 °C for 1 h to yield fatty acid methyl esters (FAMEs). These FAMEs were then extracted using hexane-chloroform (4:1, v/v), dried under nitrogen, and stored at −20 °C. Prior to GC–MS analyses, FAMEs were reconstituted using 1 mL of chromatography-grade hexane.
The FAMEs underwent analysis using an Agilent GC/MS (7890B/7000C) equipped with a CD-2560 capillary column (100 m × 250 μm × 0.2 μm, CNW, Düsseldorf, Germany) and a Gerstel MPS sampling system. The GC oven was temperature-programmed from 140 °C (5 min) to 240 °C (20 min) with a rate of 4 °C/min. The injector temperature was maintained at 250 °C with an initial precolumn pressure of 30.36 psi. FAMEs dissolved in hexane were filtered through a 0.22 μm ultrafiltration membrane (Millipore, Billerica, MA, USA). Subsequently, 1 μL of the sample was injected using the split-less mode. The carrier gas used was highly pure helium, flowing at a constant rate of 0.81 mL/min. The MS ion source, transmission line, and quadrupole temperatures were set at 230, 255, and 150 °C, respectively. A collision energy of 70 eV was applied, and the mass spectrometer scanned within the range of 40–600 m/z. Identification of FA was conducted through comparison with relative retention times of standards and mass spectral databases (NIST 14.L).

2.6. Spatio-Temporal Expression of Putative S. constricta ωx Desaturases

To gain insights into the physiological roles of the putative S. constricta ωx desaturases, their expression across various tissues and developmental stages was analyzed. Tissues were sourced from fresh adult S. constricta (55.23 ± 3.31 mm × 17.82 ± 1.21 mm, shell length × shell width, mean ± SD), which were purchased from a local seafood market (Lulin Aquatic Market) in Ningbo, China. After acclimation for 3 days in clean seawater (23 practical salinity units, 25 °C) to allow evacuation of the intestinal tract, nine tissues were sampled, encompassing the inhalant siphon, exhalent siphon, labial palps, digestive glands, gill, intestine, mantle, foot muscle, and gonad. Each tissue was sampled from six individuals, with each sample being in triplicate. Additionally, individuals at distinct developmental stages—zygotes, trochophore larvae, veliger larvae, umbo larvae, creeping larvae, single larvae, and juvenile clams—were collected from three independent breeding ponds (1.2 × 1.2 × 1.5 m, length × width × height) for analysis. The detailed breeding and sampling methods of these individuals were referred to in our previous publication [28].
Total RNA was extracted as described above. Then, 1 µg of RNA was reverse transcribed into cDNA using the PrimeScript™ RT Master Mix (Perfect Real Time, Takara, Japan). Specific qPCR primers targeting distinct regions of S. constricta ωx_a and ωx_b were designed using Primer Premier 5 software [25] (Table 1). The subsequent qPCR was carried out using SYBR Premix Ex Taq (Tli RNase H Plus) (Takara, Japan) on a quantitative thermal cycler (Mastercycle ep realplex, Eppendorf, Germany). The qPCR protocol included an initial denaturation step at 95 °C for 30 s, followed by 35 cycles comprising denaturation at 95 °C for 5 s, annealing at 55 °C for 15 s, and extension at 72 °C for 20 s. Finally, a melting curve was generated from 58 to 95 °C with an increment of 1.85 °C/min. The relative expression of target genes was assessed using the 2−ΔΔCT method [29], with β-actin (GenBank no. HQ693079.1) serving as the housekeeping gene for normalization.

2.7. Statistical Analysis

The comparison of relative expression levels for S. constricta ωx_a and ωx_b across various tissues and developmental stages was conducted using one-way ANOVA followed by Turkey’s honestly significant difference test (SPSS 22.0, IBM, Armonk, NY, USA). Results were presented as Means ± SD, and a significance level of p < 0.05 was considered statistically significant.

3. Results

3.1. Sequence and Phylogenetic Characteristics of Putative S. constricta ωx Desaturase

Through genome screening, two putative ωx desaturases were found on the ninth chromosome of S. constricta, with the assembled ID evm.model.Chr9.1772 (S. constricta ωx_a) and evm.model.Chr9.1812 (S. constricta ωx_b) [19]. Upon sequencing, both S. constricta ωx_a and ωx_b were 1065 bp, encoding 354 aa each. Compared with other invertebrate ωx desaturases (Table 2), S. constricta ωx_a/b exhibited lower identities, around ~50% with O. vulgaris and P. vulgata and ~31% with C. elegans. Their aa sequence alignment (Figure 2) revealed the presence of three histidine boxes (H***H, H**HH, and H**HH) typical in ωx desaturases. Notably, there is only one amino acid difference between S. constricta ωx_a and ωx_b (Figure 2, highlighted in red). Detailed sequence information is available in the GenBank database under accession numbers OR702562 and OR702563.
The phylogenetic tree is notably segregated into two main branches (Figure 3): one encompassing the front-end desaturase and the other comprising the ωx desaturase. Within the ωx desaturase group, it is further bifurcated into two subgroups: Δ15 Fad, primarily associated with the ω3 desaturase, and Δ12 Fad, primarily linked with the ω6 desaturase. Specifically, S. constricta ωx_a and ωx_b are clustered within the Δ15 Fad subgroup, showing close alignment with an ωx-like sequence from H. discus hannai.

3.2. Functional Activities of Putative S. constricta ωx Desaturases in Yeast

As shown in Figure 4, yeasts containing the empty pYES2 (Figure 4A,D) displayed endogenous FA—16:0, 16:1n-7, 18:0, and 18:1n-9 (numbered 1–4), alongside exogenously added LA (indicated with an asterisk *). However, yeasts transformed with pY_S. constricta ωx_a (Figure 4B,E) and ωx_b (Figure 4C,F) did not exhibit any additional peaks in their FA. This lack of desaturation products remained consistent across two additional independent repetitions.

3.3. Expression Patterns of Putative S. constricta ωx Desaturases across Various Tissues and Developmental Stages

In terms of tissue expression (Figure 5A,B), both S. constricta ωx_a and ωx_b were found across all examined tissues. S. constricta ωx_a showed notably higher expression in the inhalant and exhalent siphons, followed by the labial palps and digestive glands, with lower expression in the five other tissues (Figure 5A). Similarly, S. constricta ωx_b exhibited the highest expression in the inhalant siphon, followed by the exhalent siphon and then the labial palps and gills, with lower expression in the other tissues (Figure 5B).
Regarding developmental stages (Figure 5C,D), both S. constricta ωx_a and ωx_b displayed minimal expression in zygotes, and expression gradually increased in trochophore larvae, veliger larvae, umbo larvae, and creeping larvae. However, expression obviously decreased in single pipe larvae and juvenile clams.

4. Discussion

The biosynthesis of LC-PUFA involves a series of Fads and Elovls [6]. As a commercially important marine mollusk, S. constricta is rich in LC-PUFA [20]. To efficiently utilize its LC-PUFA resources, elucidating the detailed compositions of Fads and Elovls has become a primary goal of our lab. Previously, we successfully characterized Δ5 Fad and Δ6 Fad [22], as well as Elovl2/5 and Elovl4 [23], from S. constricta. However, the existence of ωx desaturase in this bivalve remains unclear. The results of the present study will significantly enhance our understanding of the repertoire of LC-PUFA biosynthetic enzymes in S. constricta.

4.1. Two ωx Desaturase Homologs Exist in the S. constricta Genome, Likely Resulting from Genome Duplication

In the S. constricta genome, two transcripts of ωx desaturases were identified, both located on the ninth chromosome and sharing nearly identical sequences, with only one amino acid difference, indicating their likely origin from genome tandem duplication. This occurrence of multiple transcripts of the same gene is prevalent in lower animals such as marine mollusks, likely facilitating adaptation to their challenging living environments [30,31]. In our prior investigation, we also discovered two transcripts of Δ5 Fad [22] and Elovl4 [23] in S. constricta. Notably, the identity between the two newly identified ωx desaturases (99.72%) was significantly higher compared to the two S. constricta Δ5 Fad (97.93%) and Elovl4 (89.69%) transcripts. These disparities may suggest a lower evolutionary pressure on S. constricta ωx desaturases compared to Δ5 Fad and Elovl4, possibly due to the higher availability of LA and ALA compared to LC-PUFA in microalgal diets [32].

4.2. S. constricta ωx Desaturase Homologs Are Evolutionarily Conserved but May Exhibit Reduced Desaturation Activities

The identified aa sequence of S. constricta ωx desaturases demonstrated three conserved histidine boxes characteristic of typical ωx desaturases [24], suggesting a highly conserved functional profile across evolution. Considering these observations alongside the phylogenetic results, it was anticipated that S. constricta ωx desaturases might exhibit Δ12 or Δ15 Fad desaturation activities. However, heterologous expression in yeasts failed to show any desaturation activity for S. constricta ωx desaturases, which contrasts with findings in other marine mollusks [7,8]. For instance, P. vulgata Δ12 Fad (ATV93529.1) exhibited the ability to desaturate 13.62% of OA to LA, while P. vulgata Δ15 Fad (ATV93528.1) was able to desaturate 34.70% of LA to ALA [7]. Similarly, O. vulgaris Δ12 Fad (QBC98328.1) could convert 24.90% of OA to LA, and O. vulgaris Δ15 Fad (QBC98329.1) demonstrated a conversion rate of 1.90% of LA to ALA [8]. This discrepancy might indicate limitations in the yeast system for expressing the activities of S. constricta ωx desaturases or suggest potentially low activities that remained undetectable. Alternatively, it might imply a loss of desaturation activities in S. constricta ωx desaturases, possibly as an evolutionary adaptation to its habitat, which is rich in LA and ALA [32]. Further in vivo studies, particularly employing labeled FA [8], are essential to elucidate this matter.

4.3. Expression Patterns of S. constricta ωx Desaturase Homologs Indicate Their Potential Functional Roles in Fatty Acid Desaturation

The observed significant expression variations across various tissues and developmental stages of S. constricta ωx desaturases suggested potential functional roles for these enzymes in this bivalve. Particularly noteworthy was their notably higher expression in siphons, particularly the inhalant siphon, contrasting with the relatively low expression in digestive tissues such as the intestine and digestive glands, which differs from S. constricta Fads [22] and Elovls [23]. This discrepancy suggested that S. constricta ωx desaturases might have a crucial role, especially in the inhalant siphon, potentially modulating the degree of unsaturation of FA to adapt to acute and challenging environmental conditions. This pattern of expression is reminiscent of O. vulgaris ωx desaturases, which also exhibit significantly higher expression levels in non-digestive tissues such as eyes and nerves [8]. Together, these findings emphasize the critical role of ωx desaturases in the physiological function of marine mollusks. Moreover, the relatively high expression of S. constricta ωx desaturases during the early developmental stages, except in zygotes, suggests their importance in the developmental processes of this bivalve. This finding is particularly intriguing considering the extremely low expression of S. constricta ωx desaturases in zygotes. In contrast, S. constricta Fads and Elovls exhibit notably high levels at this stage [28], implying a potential association with specific FA requirements, such as LC-PUFA, during zygote development. This variation in expression levels indicates distinct roles and regulatory mechanisms for these enzymes during different developmental stages in S. constricta.

5. Conclusions

In summary, this study presented a unique exploration of the ωx desaturases in S. constricta, significantly enhancing our knowledge of the repertoire of LC-PUFA biosynthetic enzymes within this important bivalve species. The newly cloned S. constricta ωx desaturases exhibited all the conserved functional domains typical of ωx desaturases, clustering together with functionally characterized ωx desaturases from other marine mollusks. Despite not displaying detectable desaturation activities when heterologously expressed in yeast, the spatio-temporal expression patterns of these enzymes suggested potential in vivo functional roles. Further studies are imperative to elucidate the exact roles of S. constricta ωx desaturases in LC-PUFA biosynthesis and their contributions to the physiological processes of this bivalve species.

Author Contributions

Conceptualization, Z.R.; methodology, X.C. and X.F.; software, D.Y.; investigation, X.C. and D.Y.; resources, Z.R. and J.X.; writing—original draft preparation, X.C. and Z.R.; writing—review and editing, J.X.; supervision, Z.R. and J.X.; funding acquisition, Z.R. and J.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32102763), Ningbo Science and Technology Research Projects, China (2024Z276, 202003N4124), and the earmarked fund for CARS-49.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Review Board of the Animal Research and Ethics Committees of Ningbo University (Approval Code: SYXK-2022-0623. Approval Date: 23 June 2022).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding authors.

Conflicts of Interest

Author Jilin Xu was employed by the company Fujian Dalai Seedling Technology Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Stubbs, C.D.; Anthony, D.S. The modification of mammalian membrane polyunsaturated fatty acid composition in relation to membrane fluidity and function. Biochim. Biophys. Acta Rev. Biomembr. 1984, 779, 89–137. [Google Scholar] [CrossRef] [PubMed]
  2. Pisani, D.; Ailhaud, G. Involvement of polyunsaturated fatty acids in the control of energy storage and expenditure. OCL Oils. Fat. Crop. Li. 2019, 26, 37. [Google Scholar] [CrossRef]
  3. Calviello, G.; Serini, S.; Palozza, P. n-3 polyunsaturated fatty acids as signal transduction modulators and therapeutical agents in cancer. Curr. Signal Transd. T. 2006, 1, 255–271. [Google Scholar] [CrossRef]
  4. Hussein, N.; Ah-Sing, E.; Wilkinson, P.; Leach, C.; Griffin, B.A.; Millward, D.J. Long-chain conversion of [13C] linoleic acid and alpha-linolenic acid in response to marked changes in their dietary intake in men. J. Lipid Res. 2005, 46, 269–280. [Google Scholar] [CrossRef]
  5. Tan, K.; Ma, H.Y.; Li, S.K.; Zheng, H.P. Bivalves as future source of sustainable natural omega-3 polyunsaturated fatty acids. Food Chem. 2020, 311, 125907. [Google Scholar] [CrossRef]
  6. Monroig, Ó.; Shu-Chien, A.C.; Kabeya, N.; Tocher, D.R.; Castro, L.F.C. Desaturases and elongases involved in long-chain polyunsaturated fatty acid biosynthesis in aquatic animals: From genes to functions. Prog. Lipid Res. 2022, 86, 101157. [Google Scholar] [CrossRef]
  7. Kabeya, N.; Fonseca, M.M.; Ferrier, D.E.; Navarro, J.C.; Bay, L.K.; Francis, D.S.; Tocher, D.R.; Castro, L.F.P.; Monroig, Ó. Genes for de novo biosynthesis of omega-3 polyunsaturated fatty acids are widespread in animals. Sci. Adv. 2018, 4, eaar6849. [Google Scholar] [CrossRef]
  8. Garrido, D.; Kabeya, N.; Hontoria, F.; Navarro, J.C.; Reis, D.B.; Martín, M.V.; Rodríguez, C.; Almansa, E.; Monroig, Ó. Methyl-end desaturases with ∆12 and ω3 regioselectivities enable the de novo PUFA biosynthesis in the cephalopod Octopus vulgaris. BBA-Mol. Cell Biol. Lipids 2019, 1864, 1134–1144. [Google Scholar] [CrossRef]
  9. Li, M.Z.; Mai, K.S.; He, G.; Ai, Q.H.; Zhang, W.B.; Xu, W.; Wang, J.; Liufu, Z.G.; Zhang, Y.J.; Zhou, H.H. Characterization of two Δ5 fatty acyl desaturases in abalone (Haliotis discus hannai Ino). Aquaculture 2013, 416–417, 48–56. [Google Scholar] [CrossRef]
  10. Liu, H.L.; Guo, Z.C.; Zheng, H.P.; Wang, S.Q.; Wang, Y.J.; Liu, W.H.; Zhang, G.F. Functional characterization of a Δ5-like fatty acyl desaturase and its expression during early embryogenesis in the noble scallop Chlamys nobilis Reeve. Mol. Biol. Rep. 2014, 41, 7437–7445. [Google Scholar] [CrossRef]
  11. Monroig, Ó.; Navarro, J.C.; Dick, J.R.; Alemany, F.; Tocher, D.R. Identification of a Δ5-like fatty acyl desaturase from the cephalopod Octopus vulgaris (Cuvier 1797) involved in the biosynthesis of essential fatty acids. Mar. Biotech. 2012, 4, 411–422. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, H.L.; Zhang, H.K.; Zheng, H.P.; Wang, S.Q.; Guo, Z.C.; Zhang, G.F. PUFA biosynthesis pathway in marine scallop. J. Agric. Food Chem. 2014, 62, 12384–12391. [Google Scholar] [CrossRef] [PubMed]
  13. Liu, H.L.; Zheng, H.P.; Wang, S.Q.; Wang, Y.J.; Li, S.K.; Liu, W.H.; Zhang, G.F. Cloning and functional characterization of a polyunsaturated fatty acid elongase in a marine bivalve noble scallop. Aquaculture 2013, 416–417, 146–151. [Google Scholar] [CrossRef]
  14. Zhang, H.K.; Liu, H.L.; Cheng, D.; Liu, H.L.; Zheng, H.P. Molecular cloning and functional characterisation of a polyunsaturated fatty acid elongase in a marine bivalve Crassostrea angulata. J. Food Nutr. Res. 2018, 6, 89–95. [Google Scholar] [CrossRef]
  15. Monroig, Ó.; Guinot, D.; Hontoria, F.; Tocher, D.R.; Navarro, J.C. Biosynthesis of essential fatty acids in Octopus vulgaris (Cuvier, 1797): Molecular cloning, functional characterisation and tissue distribution of a fatty acyl elongase. Aquaculture 2012, 360–361, 45–53. [Google Scholar] [CrossRef]
  16. Monroig, Ó.; De Llanos, R.; Varó, I.; Hontoria, F.; Tocher, D.R.; Puig, S.; Navarro, J.C. Biosynthesis of polyunsaturated fatty acids in Octopus vulgaris: Molecular cloning and functional characterisation of a stearoyl-CoA desaturase and an elongation of very long-chain fatty acid 4 protein. Mar. Drugs 2017, 15, 82. [Google Scholar] [CrossRef]
  17. Monroig, Ó.; Hontoria, F.; Varó, I.; Tocher, D.R.; Navarro, J.C. Investigating the essential fatty acids in the common cuttlefish Sepia officinalis (Mollusca, Cephalopoda): Molecular cloning and functional characterisation of fatty acyl desaturase and elongase. Aquaculture 2016, 450, 38–47. [Google Scholar] [CrossRef]
  18. FAO. Fishery and Aquaculture Statistics. FAO Yearbook; Food and Agriculture Organization of the United Nations: Rome, Italy, 2016; p. 30. [Google Scholar]
  19. Ran, Z.S.; Li, Z.Z.; Yan, X.J.; Liao, K.; Kong, F.; Zhang, L.; Cao, J.Y.; Zhou, C.X.; Zhu, P.; He, S.; et al. Chromosome- level genome assembly of the razor clam Sinonovacula constricta (Lamarck, 1818). Mol. Ecol. Resour. 2019, 19, 1647–1658. [Google Scholar] [CrossRef]
  20. Ran, Z.S.; Chen, H.; Ran, Y.; Yu, S.S.; Li, S.; Xu, J.L.; Liao, K.; Yu, X.J.; Zhong, Y.Y.; Ye, M.W.; et al. Fatty acid and sterol changes in razor clam Sinonovacula constricta (Lamarck 1818) reared at different salinities. Aquaculture 2017, 473, 493–500. [Google Scholar] [CrossRef]
  21. Voss, A.; Reinhart, M.; Sankar, S.; Sprecher, H. The metabolism of 7,10,13,16,19-docosapentaenoic acid to 4,7,10,13,16,19-docosahexaenoic acid in rat liver is independent of a 4-desaturase. J. Biol. Chem. 1991, 266, 19995–20000. [Google Scholar] [CrossRef]
  22. Ran, Z.S.; Xu, J.L.; Liao, K.; Li, S.; Chen, S.B.; Yan, X.J. Biosynthesis of polyunsaturated fatty acids in the razor clam Sinonovacula constricta: Characterization of Δ5 and Δ6 fatty acid desaturases. J. Agric. Food Chem. 2018, 66, 4592–4601. [Google Scholar] [CrossRef] [PubMed]
  23. Ran, Z.S.; Xu, J.L.; Liao, K.; Monroig, Ó.; Navarro, J.C.; Oboh, A.; Jin, M.; Zhou, Q.C.; Zhou, C.X.; Tocher, D.R.; et al. Biosynthesis of long-chain polyunsaturated fatty acids in the razor clam Sinonovacula constricta: Characterization of four fatty acyl elongases and a novel desaturase capacity. BBA-Mol. Cell Biol. Lipids 2019, 1864, 1083–1090. [Google Scholar] [CrossRef] [PubMed]
  24. Hashimoto, K.; Yoshizawa, A.C.; Okuda, S.; Kuma, K.; Goto, S.; Kanehisa, M. The repertoire of desaturases and elongases reveals fatty acid variations in 56 eukaryotic genomes. J. Lipid Res. 2008, 49, 183–191. [Google Scholar] [CrossRef] [PubMed]
  25. Lalitha, S. Primer premier 5. Biotech Softw. Internet Rep. Comput. Softw. J. Sci. 2000, 6, 270–272. [Google Scholar] [CrossRef]
  26. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
  27. Kumar, S.; Stecher, G.; Tamura, K. MEGA 7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  28. Ran, Z.S.; Kong, F.; Xu, J.L.; Liao, K.; Xu, X.R.; Shi, P.; Chen, K.; Zhou, C.X.; Yan, X.J. Fad and Elovl expressions, fatty acid compositions, and feed effects of three representative microalgae in Sinonovacula constricta (Lamarck 1818) at early developmental stages. Aquaculture 2020, 521, 735101. [Google Scholar] [CrossRef]
  29. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  30. Takeuchi, T.; Koyanagi, R.; Gyoja, F.; Kanda, M.; Hisata, K.; Fujie, M.; Goto, M.; Yamasaki, S.; Nagai, K.; Morino, Y.; et al. Bivalve-specific gene expansion in the pearl oyster genome: Implications of adaptation to a sessile lifestyle. Zool. Lett. 2016, 2, 3. [Google Scholar] [CrossRef]
  31. Hu, Z.; Song, H.; Feng, J.; Zhou, C.; Yang, M.J.; Shi, P.; Yu, Z.L.; Li, Y.R.; Guo, Y.J.; Li, H.Z.; et al. Massive heat shock protein 70 genes expansion and transcriptional signatures uncover hard clam adaptations to heat and hypoxia. Front. Mar. Sci. 2022, 9, 898669. [Google Scholar] [CrossRef]
  32. Breuer, G.; Evers, W.A.; de Vree, J.H.; Kleinegris, D.M.; Martens, D.E.; Wijffels, R.H.; Lamers, P.P. Analysis of fatty acid content and composition in microalgae. J. Vis. Exp. 2013, 80, 50628. [Google Scholar]
Fishes 09 00359 g001
Figure 1. Fads (in red) and Elovls (in green) involved in the LC-PUFA biosynthetic pathway (refer to [6]). Note: This Figure was created by the authors of this paper.
Figure 1. Fads (in red) and Elovls (in green) involved in the LC-PUFA biosynthetic pathway (refer to [6]). Note: This Figure was created by the authors of this paper.
Fishes 09 00359 g001
Fishes 09 00359 g002
Figure 2. Multiple sequence alignment using Clustal X 2.0 [26], comparing S. constricta ωx desaturases to those from O. vulgaris, P. vulgata, and C. elegans. Highlighted within rectangles are the three conserved histidine boxes typical of ωx desaturases. Additionally, a single amino acid difference between S. constricta ωx_a and ωx_b is marked in red.
Figure 2. Multiple sequence alignment using Clustal X 2.0 [26], comparing S. constricta ωx desaturases to those from O. vulgaris, P. vulgata, and C. elegans. Highlighted within rectangles are the three conserved histidine boxes typical of ωx desaturases. Additionally, a single amino acid difference between S. constricta ωx_a and ωx_b is marked in red.
Fishes 09 00359 g002
Fishes 09 00359 g003
Figure 3. Phylogenetic analysis of S. constricta ωx desaturases alongside multiple ωx and front-end desaturases from various invertebrates. Constructed via the maximum-likelihood approach in MEGA 7 software [27], the tree’s horizontal branch length signifies amino acid substitution rates per site. The numbers indicate the frequencies of replicated tree topology after 1000 iterations. Asterisks denote genes awaiting functional confirmation.
Figure 3. Phylogenetic analysis of S. constricta ωx desaturases alongside multiple ωx and front-end desaturases from various invertebrates. Constructed via the maximum-likelihood approach in MEGA 7 software [27], the tree’s horizontal branch length signifies amino acid substitution rates per site. The numbers indicate the frequencies of replicated tree topology after 1000 iterations. Asterisks denote genes awaiting functional confirmation.
Fishes 09 00359 g003
Fishes 09 00359 g004
Figure 4. Functional characterization of S. constricta ωx desaturases via heterologous expression in yeast. FAMEs were extracted from yeasts transformed with pYES2 alone (A,D), pY_S. constricta ωx_a (B,E), or pY_S. constricta ωx_b (C,F). These cultures were grown in the absence or presence of LA (18:2n-6, highlighted by *). Peaks 1–4 correspond to the primary endogenous FA of S. cerevisiae: 16:0, 16:1, 18:0, and 18:1n-9, respectively. The vertical axis depicts the flame ionization detector response, while the horizontal axis represents retention time.
Figure 4. Functional characterization of S. constricta ωx desaturases via heterologous expression in yeast. FAMEs were extracted from yeasts transformed with pYES2 alone (A,D), pY_S. constricta ωx_a (B,E), or pY_S. constricta ωx_b (C,F). These cultures were grown in the absence or presence of LA (18:2n-6, highlighted by *). Peaks 1–4 correspond to the primary endogenous FA of S. cerevisiae: 16:0, 16:1, 18:0, and 18:1n-9, respectively. The vertical axis depicts the flame ionization detector response, while the horizontal axis represents retention time.
Fishes 09 00359 g004
Fishes 09 00359 g005
Figure 5. Expression patterns of S. constricta ωx desaturase in various tissues (A,B) and developmental stages (C,D). The gene expression levels were assessed using qPCR and normalized by β-actin. Values presented as means ± SD (n = 3) with common letters indicating no significant difference (p ≥ 0.05) between them.
Figure 5. Expression patterns of S. constricta ωx desaturase in various tissues (A,B) and developmental stages (C,D). The gene expression levels were assessed using qPCR and normalized by β-actin. Values presented as means ± SD (n = 3) with common letters indicating no significant difference (p ≥ 0.05) between them.
Fishes 09 00359 g005
Table 1. Primers for S. constricta (Sc) ωx_a/b used in this study. The restriction sites for HindIII and EcoRI are underlined. Additionally, a Kozak sequence (GCCACC) was incorporated before the initiation codon (ATG) to enhance the transcription of S. constricta ωx_a/b in yeast. The primers were designed using Primer Premier 5 software [25].
Table 1. Primers for S. constricta (Sc) ωx_a/b used in this study. The restriction sites for HindIII and EcoRI are underlined. Additionally, a Kozak sequence (GCCACC) was incorporated before the initiation codon (ATG) to enhance the transcription of S. constricta ωx_a/b in yeast. The primers were designed using Primer Premier 5 software [25].
AimPrimerSequence (5′→3′)
ORF Cloningorf_Sc ωx_a/b_FATGGATAGAAAACAGCGGGAC
orf_Sc ωx_a/b_RTTATTTATAGACATGAACATCCTGATCA
Recombinant pYES2pY_Sc ωx_a/b_F
(HindIII)		CCAAGCTTGCCACCATGGATAGAAAACAGCGGGACA
pY_Sc ωx_a/b_F
(EcoRI)		CGGAATTCTTATTTATAGACATGAACATCCTGATCAT
qPCRq_Sc ωx_a_FGAGTACCTGATGCCTACAGTATCGTA
q_Sc ωx_b_FGAGTACCTGATGCCTACAGTATCGTT
q_Sc ωx_a/b_RATCGTTCAGCAGGTCATACCTG
q_Sc β-actin_FCCATCTACGAAGGTTACGCCC
q_Sc β-actin_RTCGTAGTGAAGGAGTAGCCTCTTTC
Table 2. Amino acid identity of ωx desaturase in S. constricta and other invertebrates. The percentage identity was obtained from sequence alignment using NCBI protein BLAST 2.16.0.
Table 2. Amino acid identity of ωx desaturase in S. constricta and other invertebrates. The percentage identity was obtained from sequence alignment using NCBI protein BLAST 2.16.0.
Identity (%)
S. constricta ωx_a/bO. vulgaris ω3 (QBC98328.1)49.56%/49.85%
O. vulgaris Δ12 Fad (QBC98329.1)51.97%/51.97%
P. vulgata ω3 (ATV93528.1)50.83%/50.56%
P. vulgata Δ12 Fad (ATV93529.1)51.52%/51.52%
C. elegans ω3 (NP_001023560.1)31.83%/31.21%
C. elegans Δ12 Fad (CAB05304.1)33.23%//32.29%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, X.; Fang, X.; Yang, D.; Xu, J.; Ran, Z. Discovery of Methyl-End Desaturases in Razor Clam Sinonovacula constricta (Lamarck 1818) and Their Spatio-Temporal Expression. Fishes 2024, 9, 359. https://doi.org/10.3390/fishes9090359

AMA Style

Chen X, Fang X, Yang D, Xu J, Ran Z. Discovery of Methyl-End Desaturases in Razor Clam Sinonovacula constricta (Lamarck 1818) and Their Spatio-Temporal Expression. Fishes. 2024; 9(9):359. https://doi.org/10.3390/fishes9090359

Chicago/Turabian Style

Chen, Xinyi, Xiang Fang, Dongzi Yang, Jilin Xu, and Zhaoshou Ran. 2024. "Discovery of Methyl-End Desaturases in Razor Clam Sinonovacula constricta (Lamarck 1818) and Their Spatio-Temporal Expression" Fishes 9, no. 9: 359. https://doi.org/10.3390/fishes9090359

APA Style

Chen, X., Fang, X., Yang, D., Xu, J., & Ran, Z. (2024). Discovery of Methyl-End Desaturases in Razor Clam Sinonovacula constricta (Lamarck 1818) and Their Spatio-Temporal Expression. Fishes, 9(9), 359. https://doi.org/10.3390/fishes9090359

Article Metrics

Back to TopTop