Impact of GAUT1 Gene Knockout on Cell Aggregation in Arabidopsis thaliana Suspension Culture
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Plasmids Carrying Cas9 and Guide RNA
2.3. Guide RNA Selection
2.4. Construction of the Genetic Construct pDGE347_GAUT1
2.5. Delivery of the Genetic Construct into Plants
2.6. Analysis of Transformants for GAUT1 Gene Deletion
2.7. Establishment of Suspension Cell Culture
2.8. Analysis of Biomass Accumulation and Aggregation in Suspension Culture
2.9. Light Microscopy
2.10. Analysis of Recombinant GFP Protein and Pectin Levels
2.11. Statistical Data Analysis
3. Results
3.1. Analysis of Obtained Plants and Phenotype of T0 Generation
3.2. Phenotypic Characteristics of Callus and Suspension Cell Culture with GAUT1 Gene Knockout
3.3. Biomass Increase and Aggregation in Suspension Cultures
3.4. Analysis of GFP Protein and Pectin Levels
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Walsh, G.; Jefferis, R. Post-translational modifications in the context of therapeutic proteins. Nat. Biotechnol. 2006, 24, 1241–1252. [Google Scholar] [CrossRef] [PubMed]
- Webster, D.E.; Thomas, M.C. Post-translational modification of plant-made foreign proteins; glycosylation and beyond. Biotechnol. Adv. 2012, 30, 410–418. [Google Scholar] [CrossRef] [PubMed]
- Santos, R.B.; Abranches, R.; Fischer, R.; Sack, M.; Holland, T. Putting the Spotlight Back on Plant Suspension Cultures. Front. Plant Sci. 2016, 7, 297. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Ge, X.; Dolan, M.C. Towards high-yield production of pharmaceutical proteins with plant cell suspension cultures. Biotechnol. Adv. 2011, 29, 278–299. [Google Scholar] [CrossRef]
- Zagorskaya, A.A.; Deineko, E.V. Suspension-cultured plant cells as a platform for obtaining recombinant proteins. Russ. J. Plant Physiol. 2017, 64, 795–807. [Google Scholar] [CrossRef]
- Lobato Gómez, M.; Huang, X.; Alvarez, D.; He, W.; Baysal, C.; Zhu, C.; Armario-Najera, V.; Blanco Perera, A.; Cerda Bennasser, P.; Saba-Mayoral, A.; et al. Contributions of the international plant science community to the fight against human infectious diseases—Part 1: Epidemic and pandemic diseases. Plant Biotechnol. J. 2021, 19, 1901–1920. [Google Scholar] [CrossRef]
- He, W.; Baysal, C.; Lobato Gómez, M.; Huang, X.; Alvarez, D.; Zhu, C.; Armario-Najera, V.; Blanco Perera, A.; Cerda Bennaser, P.; Saba-Mayoral, A.; et al. Contributions of the international plant science community to the fight against infectious diseases in humans—Part 2: Affordable drugs in edible plants for endemic and re-emerging diseases. Plant Biotechnol. J. 2021, 19, 1921–1936. [Google Scholar] [CrossRef]
- Kieran, P.M.; MacLoughlin, P.F.; Malone, D.M. Plant cell suspension cultures: Some engineering considerations. J. Biotechnol. 1997, 59, 39–52. [Google Scholar] [CrossRef]
- Parekh, S.; Srinivasan, V.; Horn, M. Bioprocessing Using Novel Cell Culture Systems. In Advances in Applied Microbiology; Springer: New York, NY, USA, 2008; Volume 63, pp. 105–143. ISBN 9780444531919. [Google Scholar]
- Motolinía-Alcántara, E.A.; Castillo-Araiza, C.O.; Rodríguez-Monroy, M.; Román-Guerrero, A.; Cruz-Sosa, F. Engineering Considerations to Produce Bioactive Compounds from Plant Cell Suspension Culture in Bioreactors. Plants 2021, 10, 2762. [Google Scholar] [CrossRef]
- Kolewe, M.E.; Henson, M.A.; Roberts, S.C. Characterization of aggregate size in Taxus suspension cell culture. Plant Cell Rep. 2010, 29, 485–494. [Google Scholar] [CrossRef]
- Zhao, D.; Huang, Y.; Jin, Z.; Qu, W.; Lu, D. Effect of aggregate size in cell cultures of Saussurea medusa on cell growth and jaceosidin production. Plant Cell Rep. 2003, 21, 1129–1133. [Google Scholar] [CrossRef] [PubMed]
- Pettolino, F.A.; Walsh, C.; Fincher, G.B.; Bacic, A. Determining the polysaccharide composition of plant cell walls. Nat. Protoc. 2012, 7, 1590–1607. [Google Scholar] [CrossRef] [PubMed]
- Caffall, K.H.; Mohnen, D. The structure, function, and biosynthesis of plant cell wall pectic polysaccharides. Carbohydr. Res. 2009, 344, 1879–1900. [Google Scholar] [CrossRef] [PubMed]
- Jarvis, M.C.; Briggs, S.P.H.; Knox, J.P. Intercellular adhesion and cell separation in plants. Plant Cell Environ. 2003, 26, 977–989. [Google Scholar] [CrossRef]
- Atmodjo, M.A.; Hao, Z.; Mohnen, D. Evolving Views of Pectin Biosynthesis. Annu. Rev. Plant Biol. 2013, 29, 747–779. [Google Scholar] [CrossRef]
- Sterling, J.D.; Atmodjo, M.A.; Inwood, S.E.; Kumar Kolli, V.S.; Quigley, H.F.; Hahn, M.G.; Mohnen, D. Functional identification of an Arabidopsis pectin biosynthetic homogalacturonan galacturonosyltransferase. Proc. Natl. Acad. Sci. USA 2006, 103, 5236–5241. [Google Scholar] [CrossRef]
- Atmodjo, M.A.; Sakuragi, Y.; Zhu, X.; Burrell, A.J.; Mohanty, S.S.; Atwood, J.A.; Orlando, R.; Scheller, H.V.; Mohnen, D. Galacturonosyltransferase (GAUT)1 and GAUT7 are the core of a plant cell wall pectin biosynthetic homogalacturonan:galacturonosyltransferase complex. Proc. Natl. Acad. Sci. USA 2011, 108, 20225–20230. [Google Scholar] [CrossRef]
- Engle, K.A.; Amos, R.A.; Yang, J.Y.; Glushka, J.; Atmodjo, M.A.; Tan, L.; Huang, C.; Moremen, K.W.; Mohnen, D. Multiple Arabidopsis galacturonosyltransferases synthesize polymeric homogalacturonan by oligosaccharide acceptor-dependent or de novo synthesis. Plant J. 2022, 109, 1441–1456. [Google Scholar] [CrossRef]
- Bouton, S.; Leboeuf, E.; Mouille, G.; Leydecker, M.T.; Talbotec, J.; Granier, F.; Lahaye, M.; Höfte, H.; Truong, H.N. QUASIMODO 1 encodes a putative membrane-bound glycosyltransferase required for normal pectin synthesis and cell adhesion in Arabidopsis. Plant Cell 2002, 14, 2577–2590. [Google Scholar] [CrossRef]
- Leboeuf, E.; Guillon, F.; Thoiron, S.; Lahaye, M. Biochemical and immunohistochemical analysis of pectic polysaccharides in the cell walls of Arabidopsis mutant QUASIMODO 1 suspension-cultured cells: Implications for cell adhesion. J. Exp. Bot. 2005, 56, 3171–3182. [Google Scholar] [CrossRef]
- Barnes, W.J.; Zelinsky, E.; Anderson, C.T. Polygalacturonase activity promotes aberrant cell separation in the quasimodo2 mutant of Arabidopsis thaliana. Cell Surf. 2022, 8, 100069. [Google Scholar] [CrossRef] [PubMed]
- Dash, L.; Swaminathan, S.; Šimura, J.; Gonzales, C.L.P.; Montes, C.; Solanki, N.; Mejia, L.; Ljung, K.; Zabotina, O.A.; Kelly, D.R. Changes in cell wall composition due to a pectin biosynthesis enzyme GAUT10 impact root growth. Plant Physiol. 2023, 193, 2480–2497. [Google Scholar] [CrossRef] [PubMed]
- Jiang, F.; Doudna, J.A. CRISPR–Cas9 Structures and Mechanisms. Annu. Rev. Biophys. 2017, 46, 505–529. [Google Scholar] [CrossRef] [PubMed]
- Bortesi, L.; Zhu, C.; Zischewski, J.; Perez, L.; Bassié, L.; Nadi, R.; Forni, G.; Lade, S.B.; Soto, E.; Jin, X.; et al. Patterns of CRISPR/Cas9 activity in plants, animals and microbes. Plant Biotechnol. J. 2016, 14, 2203–2216. [Google Scholar] [CrossRef]
- Lowder, L.G.; Zhang, D.; Baltes, N.J.; Paul, J.W.; Tang, X.; Zheng, X.; Voytas, D.F.; Hsieh, T.-F.; Zhang, Y.; Qi, Y. A CRISPR/Cas9 Toolbox for Multiplexed Plant Genome Editing and Transcriptional Regulation. Plant Physiol. 2015, 169, 971–985. [Google Scholar] [CrossRef]
- Khatodia, S.; Bhatotia, K.; Passricha, N.; Khurana, S.M.P.; Tuteja, N. The CRISPR/Cas Genome-Editing Tool: Application in Improvement of Crops. Front. Plant Sci. 2016, 7, 1–13. [Google Scholar] [CrossRef]
- Arora, L.; Narula, A. Gene Editing and Crop Improvement Using CRISPR-Cas9 System. Front. Plant Sci. 2017, 8, 1932. [Google Scholar] [CrossRef]
- Demirci, Y.; Zhang, B.; Unver, T. CRISPR/Cas9: An RNA-guided highly precise synthetic tool for plant genome editing. J. Cell. Physiol. 2018, 233, 1844–1859. [Google Scholar] [CrossRef]
- Schiml, S.; Puchta, H. Revolutionizing plant biology: Multiple ways of genome engineering by CRISPR/Cas. Plant Methods 2016, 12, 8. [Google Scholar] [CrossRef]
- Stuttmann, J.; Barthel, K.; Martin, P.; Ordon, J.; Erickson, J.L.; Herr, R.; Ferik, F.; Kretschmer, C.; Berner, T.; Keilwagen, J.; et al. Highly efficient multiplex editing: One-shot generation of 8× Nicotiana benthamiana and 12× Arabidopsis mutants. Plant J. 2021, 106, 8–22. [Google Scholar] [CrossRef]
- Concordet, J.P.; Haeussler, M. CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res. 2018, 46, W242–W245. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Ding, Y.; Zhou, Y.; Jin, W.; Xie, K.; Chen, L.L. CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants. Mol. Plant 2017, 10, 530–532. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Henriques, R.; Lin, S.S.; Niu, Q.W.; Chua, N.H. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 2006, 1, 641–646. [Google Scholar] [CrossRef] [PubMed]
- Murashige, T.; Skoog, F. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Kasajima, I.; Ide, Y.; Ohkama-Ohtsu, N.; Hayashi, H.; Yoneyama, T.; Fujiwara, T. A protocol for rapid DNA extraction from Arabidopsis thaliana for PCR analysis. Plant Mol. Biol. Report. 2004, 22, 49–52. [Google Scholar] [CrossRef]
- Schenk, R.U.; Hildebrandt, A.C. Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Can. J. Bot. 1972, 50, 199–204. [Google Scholar] [CrossRef]
- Wu, J.-J.; Liu, Y.-W.; Sun, M.-X. Improved and high throughput quantitative measurements of weak GFP expression in transgenic plant materials. Plant Cell Rep. 2011, 30, 1253–1260. [Google Scholar] [CrossRef]
- Bradford, M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Mustafa, N.R.; De Winter, W.; Van Iren, F.; Verpoorte, R. Initiation, growth and cryopreservation of plant cell suspension cultures. Nat. Protoc. 2011, 6, 715–742. [Google Scholar] [CrossRef]
- Caffall, K.H.; Pattathil, S.; Phillips, S.E.; Hahn, M.G.; Mohnen, D. Arabidopsis thaliana T-DNA Mutants Implicate GAUT Genes in the Biosynthesis of Pectin and Xylan in Cell Walls and Seed Testa. Mol. Plant 2009, 2, 1000–1014. [Google Scholar] [CrossRef]
- Xie, J.; Qi, B.; Mou, C.; Wang, L.; Jiao, Y.; Dou, Y.; Zheng, H. BREVIPEDICELLUS and ERECTA control the expression of AtPRX17 to prevent Arabidopsis callus browning. J. Exp. Bot. 2022, 73, 1516–1532. [Google Scholar] [CrossRef]
- Qiu, L.; Su, J.; Fu, Y.; Zhang, K. Genetic and Transcriptome Analyses of Callus Browning in Chaling Common Wild Rice (Oryza rufipogon Griff.). Genes 2023, 14, 2138. [Google Scholar] [CrossRef]
Oligonucleotide Name | Nucleotide Sequence (5′-3′) |
---|---|
GAUT1_gRNA1_Forward | ATTGTCTAAAGGAGGGGTCTACTC |
GAUT1_gRNA1_Reverse | AAACGAGTAGACCCCTCCTTTAGA |
GAUT1_gRNA2_Forward | ATTGGACATTGCCAACTCCAACCA |
GAUT1_gRNA2_Reverse | AAACTGGTTGGAGTTGGCAATGTC |
GAUT1_deltest_Up2 | TTTTTTGGCAGAATCTTGACTGGAG |
GAUT1_deltest_Lo2 | CAATGGAATGGGAACAACAGAACAT |
pDGEtest up | ATAGCAATGACCAGTGCAAACAGTG |
pDGEtest lo | CTCTTTTCTCTTAGGTTTACCCGCC |
GAUT1_gRNA1_Forward | ATTGTCTAAAGGAGGGGTCTACTC |
GAUT1_gRNA1_Reverse | AAACGAGTAGACCCCTCCTTTAGA |
Suspension Cell Culture Line | Pectin Level, OE | Total Soluble Protein (TSP), mg/µL | GFP Protein, mg/µL | GFP as % of TSP |
---|---|---|---|---|
Col-0 GFP | 0.005 | 0.40 | 0.063 | 16 |
GAUT1 | 0.002 | 1.05 | 0.06 | 5.7 * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Frankevich, T.A.; Permyakova, N.V.; Sidorchuk, Y.V.; Deineko, E.V. Impact of GAUT1 Gene Knockout on Cell Aggregation in Arabidopsis thaliana Suspension Culture. BioTech 2025, 14, 2. https://doi.org/10.3390/biotech14010002
Frankevich TA, Permyakova NV, Sidorchuk YV, Deineko EV. Impact of GAUT1 Gene Knockout on Cell Aggregation in Arabidopsis thaliana Suspension Culture. BioTech. 2025; 14(1):2. https://doi.org/10.3390/biotech14010002
Chicago/Turabian StyleFrankevich, Tatyana A., Natalya V. Permyakova, Yury V. Sidorchuk, and Elena V. Deineko. 2025. "Impact of GAUT1 Gene Knockout on Cell Aggregation in Arabidopsis thaliana Suspension Culture" BioTech 14, no. 1: 2. https://doi.org/10.3390/biotech14010002
APA StyleFrankevich, T. A., Permyakova, N. V., Sidorchuk, Y. V., & Deineko, E. V. (2025). Impact of GAUT1 Gene Knockout on Cell Aggregation in Arabidopsis thaliana Suspension Culture. BioTech, 14(1), 2. https://doi.org/10.3390/biotech14010002