Previous Article in Journal
Different Iodine Concentrations Impact Walleye (Sander vitreus) Egg Survival and the Number of Bacteria on the Chorionic Membrane
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Aquaculture Journal
Volume 5
Issue 1
10.3390/aquacj5010004
aquacj-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Glycine Betaine Levels and BADH Activity of Juvenile Shrimp Litopenaeus vannamei in Response to Vibrio Bacterial Infection and Sudden Hyperosmotic Stress

by
Silvia Gomez-Jimenez
*,
Elisa M. Valenzuela-Soto
†,
Julio C. Zamorano-Apodaca
,
Luis A. Gamez-Alejo
and
Cesar Muñoz-Bacasehua
Centro de Investigación en Alimentación y Desarrollo, AC. Carretera Gustavo Enrique Astiazaran Rosas Núm. 46, Col. La Victoria, Hermosillo C.P. 83304, Sonora, Mexico
*
Author to whom correspondence should be addressed.
†
Her contribution is greatly appreciated.
Aquac. J. 2025, 5(1), 4; https://doi.org/10.3390/aquacj5010004
Submission received: 7 December 2024 / Revised: 24 January 2025 / Accepted: 29 January 2025 / Published: 2 February 2025
Browse Figures
Versions Notes

Abstract

:
High evaporation rates due to solar intensity and low precipitation could represent a challenging culture environment in northwestern Mexico, generating osmotic stress in shrimp due to high salinity. Bacterial infections by pathogenic Vibrio strains are highly virulent in shrimp culture. This study evaluated betaine aldehyde dehydrogenase (BADH) activity and glycine betaine (GB) levels in Litopenaeus vannamei under high salinity levels plus experimental infection with virulent Vibrio parahaemolyticus. At 35 ppt (control group) and 40 ppt after infection, GB levels increased two-fold in the gills except at 45 ppt and were significantly higher at 50 ppt. The highest GB levels were in the hepatopancreas of the uninfected group at 45 ppt. In the gills, BADH activity decreased after 2 h of exposure at 40 and 45 ppt; at 50 ppt, there was a significant increase in the uninfected groups. However, upon infection, activity increased at all salinities except 50 ppt. In the hepatopancreas of the uninfected groups, the highest activity was at 40 ppt and this was lowest at 50 ppt after 8 h. In the muscles, BADH was detectable at all salinities; infection caused an increase in its activity at 45 and 50 ppt. Despite sudden exposure to high salinity plus experimental infection, our results show that Litopenaeus vannamei does not inhibit BADH activity, allowing GB synthesis, which may play a role in shrimp survival under these conditions.

1. Introduction

Shrimp aquaculture has become an important industry worldwide, providing direct and indirect job sources leading to national and regional socio-economic benefits. However, this industry confronts several challenges, such as improving its practices to meet environmental regulations and controlling disease outbreaks [1,2]. Additionally, some of these farming premises are subject to extreme weather conditions, like the shrimp farms located in Northwest Mexico, a region with very high environmental temperatures and low rain precipitation, generating high salinities in their ponds. Salinity is an important environmental variable in aquatic ecosystems that plays a key role in the growth, immunity, osmolality, and survival of crustaceans [3,4]. Recently, several published studies have shown that high salinity stress has a significant effect on antioxidant activity as the expression levels of antioxidant-related genes in gill tissues were significantly increased [4,5]. Furthermore, acute salinity stress increases the concentration of reactive oxygen species (ROS), resulting in oxidative stress in aquatic animals [6,7].
The shrimp species Litopenaeus vannamei is distributed in tropical marine environments of the Eastern Pacific coast of North, Central, and South America [8], and they are being farmed worldwide given their reasonable growth rate, some genetic lines of disease resistance, and osmoregulatory abilities, amongst other physiological performances. Litopenaeus vannamei undergo a biphasic life cycle, meaning pelagic larval stages known as nauplius, zoea, and mysis are followed by benthonic decapodid, juvenile, and adult stages. The osmoregulatory capabilities of this species have allowed their farming in a vast water salinity range from freshwater to water at 50 ppt salinity [9,10].
One of the strategies used by aquatic animals to cope with acute high salinity exposure, is the accumulation of organic solutes (polyhydric alcohols, free amino acids, and quaternary ammonium compounds). One of these types of molecules is glycine betaine (GB), that is used as a non-disturbing osmolyte by plants, bacteria, invertebrates, and vertebrates to compensate for hypertonic stress [11]. Furthermore, GB is one of the main osmolytes accumulated in the whiteleg shrimp in response to osmotic stress [12]. GB is a quaternary ammonium compound that accumulates to protect cells or tissues during osmotic stress [13]. GB has different functions in living organisms; it can act as a methyl donor for methionine synthesis [14,15] or as an osmoprotectant, protecting proteins against salt denaturalization [16,17]. In fish and marine invertebrates such as horseshoe crabs and oyster, GB synthesis takes place mostly in osmoregulatory tissues regulated by ionic concentration in the external milieu [18,19,20,21]. In several organisms, GB is synthesized by the irreversible oxidation of betaine aldehyde by the enzyme betaine aldehyde dehydrogenase (BADH EC 1.2.1.8) [22,23,24]. In Litopenaeus vannamei, under osmotic stress, the hepatopancreas and gills showed BADH activity [25,26]. However, its expression is modulated in a tissue-specific manner when salinity varies [27]. These results suggest a critical participation of BADH in the osmotic-stress response of Litopenaeus vannamei. However, despite these physiological adaptations to high salinities, the crustacean’s physiological ability to cope with high salinities within a commercial shrimp farming pond may be impaired by bacterial infections, which are relatively common within the farming ponds. Shrimp acute hepatopancreatic necrosis disease (AHPND) is considered to be a relatively new farmed-penaeid-shrimp bacterial disease [28] caused by virulent strains of Vibrio parahaemolyticus and related Vibrio species. AHPND-associated mortalities occur early in the production cycle, usually within 30 to 35 days of stocking, and because of this, AHPND was initially referred to as early mortality syndrome [29]. Since 2009, AHPND has progressively spread as an epidemic, devastating shrimp production across much of the shrimp farming region in Asia. Eventually, the disease reached the Western Hemisphere [30,31]. In the Northern states of Mexico, including Nayarit, Sinaloa, and Sonora, a Vibrio parahaemolyticus (Vp) strain caused acute hepatopancreatic necrosis disease (AHPND) and dropped the shrimp farming production by 65% when it was first detected in 2013 [30].
Therefore, the objective of this work was to evaluate some key osmoregulatory responses of the juvenile Litopenaeus vannamei at sudden high salinities under an AHPND Vibrio bacterial infection.

2. Materials and Methods

2.1. Animal Maintenance

Litopenaeus vannamei postlarvae (0.0065 ± 0.009 g) were obtained from a local larval production laboratory and were transported by car inside plastic bags half-filled with seawater inside rigid insulated polystyrene boxes. The total transport time was 2 h, and all postlarvae arrived at the CIAD experimental facilities in good shape with 100% survival. At CIAD, PL were transferred to eight 400 L fiberglass containers connected to a closed circulation system and were grown up until they reached the average target size of 1.3 g. The animals were fed Api Camarón® Raceway five times daily during this time. Water quality was monitored daily and kept at 28 °C, 35 ppt salinity, and 5.6 mg O2. In addition, during this time, constant monitoring of the primary pathogens that affect shrimp (white spot syndrome virus; Hepatobacter penaei; Infectious hypodermal and hematopoietic necrosis virus; Enterocytozoon Hepatopenaei; Taura syndrome virus and Acute hepatopancreatic necrosis disease) was carried out to ensure that the postlarvae population remained free of pathogens before being used.

2.2. Vibrio parahaemolyticus Strain

Vibrio parahaemolyticus (Vp) is a Gram-negative halophilic bacterium, slightly curved with a polar flagellum, that does not ferment sucrose, so on TCBS agar (citrate thiosulfate bile salts sucrose), it grows in circular, colorless colonies with a green center of 2 to 3 mm [32]. The Vibrio bacterial strain used (HP19-21) to carry out the bacterial infection was isolated from shrimp hepatopancreas during mortality events in the 2021 farming season on TCBS agar and subsequently identified by molecular testing using the primers shown in Table 1.

2.3. Vibrio Bacterial Infection

Additionally, the selected Vp strain (HP19-21) was used to perform a preliminary bioassay only at the control salinity (36 ppt) to evaluate the mortality rates in juvenile shrimps following an immersion infection protocol [35] to ensure that the selected Vp strain was a pathogenic Vibrio strain.
For the infection exposure to VpAHPND at all salinities tested, the HP19-21 pathogenic strain was cultured for 24 h in TSB at 37 °C, and the bacterial growth was followed by the OD600nm using a spectrophotometer. An adaptation of an immersion infection protocol was followed [35]. Briefly, juvenile shrimps were immersed with the Vp strain at a final cellular density of 5 × 106 CFU mL−1 for two hours at each salinity tested.

2.4. Hyperosmotic Stress (Infection Experimental Groups and Control)

According to salinity levels measured over some years at commercial shrimp farms in Northwest Mexico, we selected salinities of 40, 45, and 50 ppt as the conditions for sudden hypersalinity stress [36]. The hyperosmotic stress was added by using instant ocean salts to control seawater (35 ppt) to reach the targeted high salinities. Four experimental infection groups, including 15 healthy shrimps (1.3 ± 0.2 g) per group, were placed in 20 L polyethylene containers for each salinity treatment (35, 40, 45, and 50 ppt) in triplicate and Vp was added for 2 h immersion at the bacterial Vp density (5 × 106 CFU mL−1); these groups were named as 2 h post-infection (2H pi). After 2 h of Vp exposure, animals were transferred to salinity containers (35, 40, 45, and 50) without Vp and left for 6 h and named as 8 h post-infection (8H pi). The four uninfected experimental groups were also exposed for two hours to seawater without Vp at each salinity level tested, named as 2 h control (2H C), and then transferred into 20 L polyethylene salinity containers for 6 h and named as 8 h control (8H C).

2.5. Animal Sampling

Two sampling times were used: first, after 2 h of exposure to both Vp/high salinity (2H pi) and 2 h of exposure to high salinity (2H C); and second, after 6 h exposure to high salinities with 2 h exposure to Vp (8H pi) and after 6 h exposure to high salinities with 2 h exposure to high salinities (8H C). At each sampling time, the gills, hepatopancreas, and muscle (abdominal segment 1) tissues were collected, frozen immediately on dry ice, and stored at −80 °C for further analysis.

2.6. Crude Extract Preparation

Crude extracts of hepatopancreas, gills, and muscle abdominal segment 1 tissues were prepared to quantify glycine betaine and BADH activity using the protocol outlined in [26]. A total of 0.1 g of tissue was homogenized with 500 µL of extraction buffer (0.1 M Tris-HCl, pH 8.5, 1 mM EDTA, 10% (v/v) glycerol, 14 mM β-mercaptoethanol, 10 µL of protease inhibitor, and 100 µL of PMFS), then centrifuged at 13,000 rpm for 20 min at 4 °C and the supernatant was separated. Each value (n) represents the median of 3 animals individually analyzed per container, and each experimental group was composed of 3 containers. Therefore, the total number of experimental units analyzed per treatment was 9.

2.7. Glycine Betaine Quantification

A water-soluble quaternary ammonium compound (QAC) assay measured the glycine betaine concentration in crude extracts (hepatopancreas, gills, and muscle abdominal segment 1) [37]. Raw extracts (0.5 mL) were diluted with 0.5 mL of 2 N H2SO4 to evaluate the total QAC levels. After adding 0.2 mL of 1 M KI-I2 to the diluted extracts, samples were incubated for 16 h at 4 °C. This was followed by centrifugation at 10,000 rpm for 20 min, and the supernatant was separated and discarded. The periodide crystals were dissolved in 1,2-dichloroethane and incubated for 2 h at 4 °C. Additionally, the choline concentration in samples was quantified. A total of 0.5 mL of KPi buffer (0.2 M, pH 6.8) was used to dilute the sample extracts (0.5 mL). As previously described, choline periodide was precipitated and analyzed for total QAC. Total QAC and choline concentrations were measured at 365 nm. Calculations for the glycine betaine concentration used the following formula: [Glycine betaine] = [QAC] − [Choline].

2.8. BADH Activity Assay

BADH activity was measured spectrophotometrically by monitoring the reduction of NAD+ by the increase in extinction at 340 nm, following the methodology in [38]. The measurement was performed using 0.1 M Hepes-KOH, pH 8.0, 0.1 mM EDTA, 0.5 mM betaine aldehyde, and 1.0 mM NAD in a final volume of 0.4 mL. The reaction started by adding 16 µL of the extract. The enzymatic activity of BADH was expressed as mU/mg of protein. The protein concentration was quantified using Bradford’s method, using BSA as a standard [39].

2.9. Statistics

An analysis of variance (ANOVA) was performed on all data using the NCSS (2020) software. A completely randomized design was used to evaluate the effect of salinity and experimental infection on the glycine betaine concentration and BADH activity in each tissue using Tukey–Kramer with a significance level of 5%.

3. Results

Figure 1 shows PCR amplicons from the Vibrio parahaemolyticus AHPND strain isolated from shrimp hepatopancreas (HP19-21): 1A: Lane M; molecular weight; Line 1 and (+) positive amplicons (450 bp) for Vibrio parahaemolyticus; and 1B: Lane M; molecular weight; Line 1 and (+) positive amplicons (284 and 392 bp) for AHPND.
Analysis of the mortality values (Figure 2) revealed that after 42 h of exposure to VpAHPND HP19-21, juvenile shrimp reached the highest 60% cumulative mortality, maintaining a final survival rate of 40%. When exposed to all salinities tested in this study, the juvenile-shrimp cumulative mortalities were less than 15% after 2 h of exposure to VpAHPND HP19-21 and 0% during the 6 h of exposure to all salinity values tested. In the control group, the sudden salinity changes up to 2 h show that the GB content increases to about twice its levels in the gills at all salinities tested vs. 35 ppt (Figure 3A). However, when coupled with the Vp infection time (up to 2 h), GB increased to more than twice its level in the same tissue only at 50 ppt.
The highest GB level (179.16 µg mL−1) was recorded in the hepatopancreas of the uninfected group at 45 ppt and this is significantly higher than the GB levels in all of the treatments in those tissues. Regarding the muscle GB in the uninfected groups, the lowest level was found at 35 ppt and the highest at 45 ppt. In the muscles, the combination of salinity and infection illustrated that the GB content increased under all of the salinity conditions (Figure 3A).
In the uninfected groups, where shrimp were exposed to sudden high salinities and kept for 8 h total exposure (Figure 3B), there were slightly higher GB concentrations compared to those found at 2 h (Figure 3A), in the gills, hepatopancreas and muscles at 35, 40; 40, 50; and 35, 40, 45, and 50 ppt, respectively (Figure 3B). Muscle analysis showed that the GB content did not change in all of the salinities tested (Figure 3B). On the other hand, the sudden high salinity exposure plus 8 h Vp post-infection increased the GB content in the gills at 35, 45, and 50; in the hepatopancreas, GB increased under all salinity conditions except at 40 ppt; and in the muscle tissue, GB increased at all salinities except 50 ppt (Figure 3B). BADH activity data in the uninfected groups showed that 2 h exposure to sudden high salinity caused the enzyme activity in the gills to decrease at 40 and 45 ppt, while at 50 ppt there was a significant increase in the BADH activity (Figure 4A). Vibrio parahaemolyticus infection caused an increase in enzyme activity at all salinities except at 50 ppt in the gills. Hepatopancreas BADH activity was higher than BADH activity in the gills and muscle; in this tissue, the activity decreased at 45 and 50 ppt vs. the activity at 35 ppt; under Vp infection conditions, BADH activity was lower at all salinities tested and was significantly lower at 35, 40, and 50 ppt (Figure 4A). In the muscle tissue, BADH activity was very low under all conditions tested (Figure 4A). After 8 h exposure to high salinities, an increase in the BADH activity was detected in the gills in the uninfected groups at 35 and 40 ppt, whereas combined with the Vp infection, it decreased at 35, 40, and 50 ppt (Figure 4B). In the hepatopancreas, the enzyme activity significantly increased only at 40 ppt but decreased at 45 and 50 ppt. The combination of salinity and infection caused higher enzyme activity, except at 40 ppt (Figure 4B). In the muscle tissue, the activity was detectable at all salinities; however, the infection increased its activity at 45 and 50 ppt (Figure 4B).

4. Discussion

The highest GB content was detected in the hepatopancreas tissue under all salinities tested and this pattern remained after 2 and 8 h pi. The gills and hepatopancreas are the primary osmoregulatory tissues in crustaceans [40,41,42]. Therefore, high GB levels agree with the hepatopancreas function; similar results were found by the authors in [26]. Furthermore, GB levels found following sudden exposure to higher salinities, in general, evoke an increased GB content in all tissues compared with the control salinity (35 ppt). This result might be associated with the osmoprotective role that GB plays in the cells of some crustaceans when they are exposed to hyperosmotic stress [43,44]. The accumulation of osmotically active compatible solutes, such as GB, is used by some organisms to assist growth and also to stabilize macromolecules against hyperosmotic stress [20].
Moreover, with the intensification of shrimp aquaculture practices, new bacterial pathogens have been detected in the farming environments, causing high mortalities, since some Vp isolates appear to be extremely virulent [30,35,45]. The virulence of Vp is variable depending on the virulence determinants [46,47]. As with some marine pathogens, Vp strains might become virulent by acquiring a plasmid that expresses toxins causing hepatopancreatic damage to the shrimp and resulting in high mortalities [30,48]. The virulence of the Vp strain used in this study is due to the pirA and pirB genes, causing acute hepatopancreatic necrosis disease (AHPND) and mortality rates in shrimp.
The shrimp farms in Northwest Mexico are located in regions where the intense solar incidence of the dessert areas give rise to high evaporation rates of the shrimp ponds, thereby increasing the salinity and generating a challenging farming environment. In this context of high salinities plus Vp infection, it is interesting to note that despite the Vp infection in the animals, GB levels accumulated in all tissues, particularly in the gills and muscle tissue, after 2 and 8 h pi at all salinities; however, this effect was not observed in the hepatopancreas.
BADH activity was higher in the hepatopancreas than in the gills, while in general, it was very low in muscle tissue under all conditions tested. Similar results were found by the authors of [26] in shrimp subjected to different salinities. Vp infection increased BADH activity only in the gills after 2 h of exposure. However, in the hepatopancreas, the BADH activity detected allowed the synthesis and accumulation of GB at higher levels than in the gills. A longer post-infection time decreased the BADH activity in the gills but not GB accumulation. These results demonstrating an increase in muscle and gill GB levels without an increase in BADH activity may be due to the transport of GB from the hepatopancreas into the muscle and gills since the authors of [26] found GB in the hemolymph and increases in GB concentration in all tissues analyzed in response to salinities higher than 35 ppt (seawater).
Interestingly, in the gills and muscle tissue at 35 ppt (control salinity) only the Vp infection induced increases in GB concentration, especially after 8 h of exposure to the Vp pathogen.
It has been reported that BADH might be involved in the response to the effects provoked by the white spot syndrome virus (WSSV) infection [49]. In this context, our results indicate that BADH might also play a role during a bacterial (Vp) infection. BADH activity increased under the control salinity (35 ppt) after 2 h Vp infection, probably causing the high GB levels detected in the gills and muscle tissue of the infected group at the control salinity. Osmotic stress induces adverse effects on cellular ion regulation, which may disrupt protein synthesis and damage [50,51]. Furthermore, the sudden high salinity stress with a pathogenic Vp exposure that might occur in the shrimp farms in Northwest Mexico exerted an osmoregulation mechanism through the BDAH activity and GB synthesis. Thus, our results have shown that despite the sudden exposure to higher salinities and Vp infection, juvenile Litopenaeus vannamei shrimp keep their BADH activity, allowing GB synthesis. Hence, using the host–pathogen high salinity studies, further enzymatic antioxidant system and osmoregulatory studies are still needed for adequate response characterization to support the sustainable development of shrimp aquaculture.

5. Conclusions

We have described a bioassay challenge that identified BADH activity and GB synthesis in juvenile Litopenaeus vannamei shrimp regulated by osmotic stress and Vp exposure. In combination with different high salinity levels, Vp infection does not inhibit BADH activity, allowing GB synthesis, which may protect shrimp cell integrity and thus enable shrimp survival.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/aquacj5010004/s1, Figure S1: Electrophoresis pirAB. M: 100 bp DNA marker, 1: HP19-21, 2: P04-22, 3: P09-22, 4: P15-22, 5: P17-22, 6: P19-22, 7: P22-22, 8: P26-22, 9: P28-22, 10: P32-22, 11: P44B-22. (-): Negative control and (+): Positive control.; Figure S2: Cumulative mortality of strains of Vibrio parahaemolyticus and Vibrio alginolyticus.

Author Contributions

S.G.-J. and L.A.G.-A. designed the experiments; S.G.-J. and E.M.V.-S. discussed the results; S.G.-J. wrote the paper original draft; E.M.V.-S. executed data curation; J.C.Z.-A. and L.A.G.-A. conducted the experiments; C.M.-B. and J.C.Z.-A. performed all laboratory analysis and L.A.G.-A. and J.C.Z.-A. assisted with proofreading. All authors have read and agreed to the published version of the manuscript.

Funding

The authors acknowledge funding for their research on the internal project Num. 20172, which was granted to Silvia Gomez-Jimenez.

Institutional Review Board Statement

The white shrimp, Litopenaeus vannamei, is not considered to be an endangered or protected species and is widely farmed alongside coastal zones. Therefore, no specific authorization was required to work on the white shrimp used in this study.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interests.

References

  1. Aranguren Caro, L.F.; Mai, H.N.; Noble, B.; Dhar, A.K. Acute Hepatopancreatic Necrosis Disease (VPAHPND), a Chronic Disease in Shrimp (Penaeus vannamei) Population Raised in Latin America. J. Invertebr. Pathol. 2020, 174, 107424. [Google Scholar] [CrossRef]
  2. Bao, S.; Gao, S.; Zhang, M.; Wang, Y. Characterization of Toxicity and Structure of PirABvc-like Proteins That Are Structurally Almost Identical to Shrimp AHPND-causing PirAB Toxin. J. Fish Dis. 2022, 45, 315–326. [Google Scholar] [CrossRef] [PubMed]
  3. Jaffer, Y.D.; Saraswathy, R.; Ishfaq, M.; Antony, J.; Bundela, D.S.; Sharma, P.C. Effect of Low Salinity on the Growth and Survival of Juvenile Pacific White Shrimp, Penaeus vannamei: A Revival. Aquaculture 2020, 515, 734561. [Google Scholar] [CrossRef]
  4. Chen, K.; Li, E.; Xu, C.; Wang, X.; Li, H.; Qin, J.G.; Chen, L. Growth and Metabolomic Responses of Pacific White Shrimp (Litopenaeus vannamei) to Different Dietary Fatty Acid Sources and Salinity Levels. Aquaculture 2019, 499, 329–340. [Google Scholar] [CrossRef]
  5. Li, J.; Kültz, D. Proteomics of Osmoregulatory Responses in Threespine Stickleback Gills. Integr. Comp. Biol. 2020, 60, 304–317. [Google Scholar] [CrossRef] [PubMed]
  6. Paital, B.; Chainy, G.B.N. Antioxidant Defenses and Oxidative Stress Parameters in Tissues of Mud Crab (Scylla serrata) with Reference to Changing Salinity. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2010, 151, 142–151. [Google Scholar] [CrossRef] [PubMed]
  7. Bal, A.; Panda, F.; Pati, S.G.; Das, K.; Agrawal, P.K.; Paital, B. Modulation of Physiological Oxidative Stress and Antioxidant Status by Abiotic Factors Especially Salinity in Aquatic Organisms. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2021, 241, 108971. [Google Scholar] [CrossRef] [PubMed]
  8. Rojo-Arreola, L.; García-Carreño, F.; Romero, R.; Díaz Dominguez, L. Proteolytic Profile of Larval Developmental Stages of Penaeus vannamei: An Activity and mRNA Expression Approach. PLoS ONE 2020, 15, e0239413. [Google Scholar] [CrossRef]
  9. Castille, F.L.; Lawrence, A.L. The Effect of Salinity on the Osmotic, Sodium and Chloride Concentrations in the Hemolymph of Euryhaline Shrimp of the Genus Penaeus. Comp. Biochem. Physiol. A Physiol. 1981, 68, 75–80. [Google Scholar] [CrossRef]
  10. Pan, L.-Q.; Zhang, L.-J.; Liu, H.-Y. Effects of Salinity and pH on Ion-Transport Enzyme Activities, Survival and Growth of Litopenaeus vannamei Postlarvae. Aquaculture 2007, 273, 711–720. [Google Scholar] [CrossRef]
  11. Petty, C.N.; Lucero, M.T. Characterization of a Na+ -Dependent Betaine Transporter With Cl− Channel Properties in Squid Motor Neurons. J. Neurophysiol. 1999, 81, 1567–1574. [Google Scholar] [CrossRef]
  12. Schock, T.B.; Duke, J.; Goodson, A.; Weldon, D.; Brunson, J.; Leffler, J.W.; Bearden, D.W. Evaluation of Pacific White Shrimp (Litopenaeus vannamei) Health during a Superintensive Aquaculture Growout Using NMR-Based Metabolomics. PLoS ONE 2013, 8, e59521. [Google Scholar] [CrossRef]
  13. Yancey, P.H. Nitrogen Compounds as Osmolytes. In Fish Physiology; Elsevier: Amsterdam, The Netherlands, 2001; Volume 20, pp. 309–341. ISBN 978-0-12-350444-9. [Google Scholar]
  14. Du Vigneaud, V.; Simmonds, S.; Chandler, J.P.; Cohn, M. A further investigation of the rôle of betaine in transmethylation reactions in vivo. J. Biol. Chem. 1946, 165, 639–648. [Google Scholar] [CrossRef]
  15. Athamena, A.; Brichon, G.; Trajkovic-Bodennec, S.; Péqueux, A.; Chapelle, S.; Bodennec, J.; Zwingelstein, G. Salinity Regulates N-Methylation of Phosphatidylethanolamine in Euryhaline Crustaceans Hepatopancreas and Exchange of Newly-Formed Phosphatidylcholine with Hemolymph. J. Comp. Physiol. B 2011, 181, 731–740. [Google Scholar] [CrossRef]
  16. Timasheff, S.N. The Control of Protein Stability and Association by Weak Interactions with Water: How Do Solvents Affect These Processes? Annu. Rev. Biophys. Biomol. Struct. 1993, 22, 67–97. [Google Scholar] [CrossRef] [PubMed]
  17. Bolen, D.W.; Baskakov, I.V. The Osmophobic Effect: Natural Selection of a Thermodynamic Force in Protein Folding 1 1Edited by D. Draper. J. Mol. Biol. 2001, 310, 955–963. [Google Scholar] [CrossRef] [PubMed]
  18. Dragolovich, J.; Pierce, S.K. Characterization of Partially Purified Betaine Aldehyde Dehydrogenase from Horseshoe Crab (Limulus polyphemus) Cardiac Mitochondria. J. Exp. Zool. 1994, 270, 417–425. [Google Scholar] [CrossRef]
  19. Perrino, L.A.; Pierce, S.K. Choline Dehydrogenase Kinetics Contribute to Glycine Betaine Regulation Differences in Chesapeake Bay and Atlantic Oysters. J. Exp. Zool. 2000, 286, 250–261. [Google Scholar] [CrossRef]
  20. Jahn, M.P.; Cavagni, G.M.; Kaiser, D.; Kucharski, L.C. Osmotic Effect of Choline and Glycine Betaine on the Gills and Hepatopancreas of the Chasmagnathus Granulata Crab Submitted to Hyperosmotic Stress. J. Exp. Mar. Biol. Ecol. 2006, 334, 1–9. [Google Scholar] [CrossRef]
  21. Treberg, J.R.; Driedzic, W.R. The Accumulation and Synthesis of Betaine in Winter Skate (Leucoraja ocellata). Comp. Biochem. Physiol. A. Mol. Integr. Physiol. 2007, 147, 475–483. [Google Scholar] [CrossRef]
  22. Weretilnyk, E.A.; Hanson, A.D. Molecular Cloning of a Plant Betaine-Aldehyde Dehydrogenase, an Enzyme Implicated in Adaptation to Salinity and Drought. Proc. Natl. Acad. Sci. USA 1990, 87, 2745–2749. [Google Scholar] [CrossRef]
  23. Valenzuela-Soto, E.M.; Muñoz-Clares, R.A. Purification and Properties of Betaine Aldehyde Dehydrogenase Extracted from Detached Leaves of Amaranthus hypochondriacus L. Subjected to Water Deficit. J. Plant Physiol. 1994, 143, 145–152. [Google Scholar] [CrossRef]
  24. Muñoz-Clares, R.A.; Valenzuela-Soto, E.M. Betaine aldehyde dehydrogenases: Evolution, physiological functions, mechanism, kinetics, regulation, structure, and stability. In Avance in Protein Physical Chemistry; García-Hernández, E., Fernández-Velasco, D.A., Eds.; Advances in Protein Physical Chemistry; Transworld Research Network: Trivandrum, India, 2008; pp. 279–302.25. [Google Scholar]
  25. Delgado-Gaytán, M.F.; Hernández-Palomares, M.L.E.; Soñanez-Organis, J.G.; Muhlia-Almazán, A.; Sánchez-Paz, A.; Stephens-Camacho, N.A.; Valenzuela-Soto, E.M.; Rosas-Rodríguez, J.A. Molecular Characterization and Organ-Specific Expression of the Gene That Encodes Betaine Aldehyde Dehydrogenase from the White Shrimp Litopenaeus vannamei in Response to Osmotic Stress. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2015, 189, 40–46. [Google Scholar] [CrossRef] [PubMed]
  26. Delgado-Gaytán, M.F.; Gómez-Jiménez, S.; Gámez-Alejo, L.A.; Rosas-Rodríguez, J.A.; Figueroa-Soto, C.G.; Valenzuela-Soto, E.M. Effect of Salinity on the Synthesis and Concentration of Glycine Betaine in Osmoregulatory Tissues from Juvenile Shrimps Litopenaeus vannamei. Comp. Biochem. Physiol. A. Mol. Integr. Physiol. 2020, 240, 110628. [Google Scholar] [CrossRef] [PubMed]
  27. Soñanez-Organis, J.G.; Miranda-Cruz, M.M.; Poom-Llamas, J.J.; Stephens-Camacho, N.A.; Adan-Bante, N.P.; Rosas-Rodríguez, J.A. Betaine Aldehyde Dehydrogenase Is Regulated during WSSV Infection in White Shrimp. Invertebr. Surviv. J. 2019, 16, 113–119. [Google Scholar] [CrossRef]
  28. Kumar, V.; Roy, S.; Behera, B.K.; Bossier, P.; Das, B.K. Acute Hepatopancreatic Necrosis Disease (AHPND): Virulence, Pathogenesis and Mitigation Strategies in Shrimp Aquaculture. Toxins 2021, 13, 524. [Google Scholar] [CrossRef] [PubMed]
  29. OIE Chapter 2.2.1. Acute hepatopancreatic necrosis disease. In Manual of Diagnostic Tests for Aquatic Animals; World Organisation for Animal Health (WOAH): Paris, France, 2019.
  30. Nunan, L.; Lightner, D.; Pantoja, C.; Gomez-Jimenez, S. Detection of Acute Hepatopancreatic Necrosis Disease (AHPND) in Mexico. Dis. Aquat. Organ. 2014, 111, 81–86. [Google Scholar] [CrossRef] [PubMed]
  31. Soto-Rodriguez, S.A.; Gomez-Gil, B.; Lozano-Olvera, R.; Betancourt-Lozano, M.; Morales-Covarrubias, M.S. Field and Experimental Evidence of Vibrio Parahaemolyticus as the Causative Agent of Acute Hepatopancreatic Necrosis Disease of Cultured Shrimp (Litopenaeus vannamei) in Northwestern Mexico. Appl. Environ. Microbiol. 2015, 81, 1689–1699. [Google Scholar] [CrossRef]
  32. Sakazaki, R. Parahaemolyticus. In Encyclopedia of Food Sciences and Nutrition; Elsevier: Amsterdam, The Netherlands, 2003; pp. 5988–5992. ISBN 978-0-12-227055-0. [Google Scholar]
  33. Bej, A.K.; Patterson, D.P.; Brasher, C.W.; Vickery, M.C.L.; Jones, D.D.; Kaysner, C.A. Detection of Total and Hemolysin-Producing Vibrio parahaemolyticus in Shellfish Using Multiplex PCR Amplification of Tl, Tdh and Trh. J. Microbiol. Methods 1999, 36, 215–225. [Google Scholar] [CrossRef] [PubMed]
  34. Han, J.E.; Tang, K.F.J.; Pantoja, C.R.; White, B.L.; Lightner, D.V. qPCR Assay for Detecting and Quantifying a Virulence Plasmid in Acute Hepatopancreatic Necrosis Disease (AHPND) Due to Pathogenic Vibrio parahaemolyticus. Aquaculture 2015, 442, 12–15. [Google Scholar] [CrossRef]
  35. Zhang, X.; Sun, J.; Chen, F.; Qi, H.; Chen, L.; Sung, Y.Y.; Huang, Y.; Lv, A.; Hu, X. Phenotypic and Genomic Characterization of a Vibrio parahaemolyticus Strain Causing Disease in Penaeus vannamei Provides Insights into Its Niche Adaptation and Pathogenic Mechanism. Microb. Genom. 2021, 7, 000549. [Google Scholar] [CrossRef] [PubMed]
  36. Grijalva-Chon, J.; Barraza-Guardado, R. Distribution and Abundance of Postlarvae and Juveniles of Shrimps of the Genus Penaeus in Kino Bay and La Cruz Lagoon, Sonora, Mexico. Cienc. Mar. 1992, 18, 153–169. [Google Scholar] [CrossRef]
  37. Grieve, C.M.; Grattan, S.R. Rapid Assay for Determination of Water Soluble Quaternary Ammonium Compounds. Plant Soil 1983, 70, 303–307. [Google Scholar] [CrossRef]
  38. Guzman-Partida, A.M.; Valenzuela-Soto, E.M. Porcine Kidney Betaine Aldehyde Dehydrogenase: Purification and Properties. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 1998, 119, 485–491. [Google Scholar] [CrossRef] [PubMed]
  39. Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  40. Gilles, R.; Péqueux, A. Cell Volume Regulation in Crustaceans: Relationship between Mechanisms for Controlling the Osmolality of Extracellular and Intracellular Fluids. J. Exp. Zool. 1981, 215, 351–362. [Google Scholar] [CrossRef]
  41. Bouaricha, N.; Thuet, P.; Charmantier, G.; Charmantier-Daures, M.; Trilles, J.-P. Na+-K+ ATPase and Carbonic Anhydrase Activities in Larvae, Postlarvae and Adults of the Shrimp Penaeus japonicus (Decapoda, Penaeidea). Comp. Biochem. Physiol. A Physiol. 1991, 100, 433–437. [Google Scholar] [CrossRef]
  42. Morris, S.; Edwards, T. Control of Osmoregulation via Regulation of Activity in the Amphibious Purple Shore Crab Leptograpsus variegatus. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 1995, 112, 129–136. [Google Scholar] [CrossRef]
  43. Shinagawa, A.; Suzuki, T.; Konosu, S. Preliminary Studies On the Effects of Salinity On Intracellular Nitrogenous Osmolytes in Various Tissues and Hemolymph of the Japanese Spiny lobster, Panulirus japonicus (Von Siebold, 1824). Crustaceana 1995, 68, 129–137. [Google Scholar] [CrossRef]
  44. Delgado-Gaytán, M.F.; Rosas-Rodríguez, J.A.; Yepiz-Plascencia, G.; Figueroa-Soto, C.G.; Valenzuela-Soto, E.M. Cloning and Molecular Characterization of the Betaine Aldehyde Dehydrogenase Involved in the Biosynthesis of Glycine Betaine in White Shrimp (Litopenaeus vannamei). Chem. Biol. Interact. 2017, 276, 65–74. [Google Scholar] [CrossRef] [PubMed]
  45. Tran, L.; Nunan, L.; Redman, R.; Mohney, L.; Pantoja, C.; Fitzsimmons, K.; Lightner, D. Determination of the Infectious Nature of the Agent of Acute Hepatopancreatic Necrosis Syndrome Affecting Penaeid Shrimp. Dis. Aquat. Organ. 2013, 105, 45–55. [Google Scholar] [CrossRef] [PubMed]
  46. Ghenem, L.; Elhadi, N.; Alzahrani, F.; Nishibuchi, M. Vibrio parahaemolyticus: A Review on Distribution, Pathogenesis, Virulence Determinants and Epidemiology. Saudi J. Med. Med. Sci. 2017, 5, 93. [Google Scholar] [CrossRef]
  47. Garin-Fernandez, A.; Glöckner, F.O.; Wichels, A. Genomic Characterization of Filamentous Phage vB_VpaI_VP-3218, an Inducible Prophage of Vibrio parahaemolyticus. Mar. Genom. 2020, 53, 100767. [Google Scholar] [CrossRef] [PubMed]
  48. Lee, C.-T.; Chen, I.-T.; Yang, Y.-T.; Ko, T.-P.; Huang, Y.-T.; Huang, J.-Y.; Huang, M.-F.; Lin, S.-J.; Chen, C.-Y.; Lin, S.-S.; et al. The Opportunistic Marine Pathogen Vibrio parahaemolyticus Becomes Virulent by Acquiring a Plasmid That Expresses a Deadly Toxin. Proc. Natl. Acad. Sci. USA 2015, 112, 10798–10803. [Google Scholar] [CrossRef]
  49. Stephens-Camacho, N.A.; Muhlia-Almazan, A.; Sanchez-Paz, A.; Rosas-Rodriguez, J.A. Surviving environmental stress: The role of betaine aldehyde dehydrogenase in marine crustaceans. Invertebr. Surviv. J. 2015, 12, 66–74, ISSN 1824-307X. [Google Scholar]
  50. Yancey, P.H.; Clark, M.E.; Hand, S.C.; Bowlus, R.D.; Somero, G.N. Living with Water Stress: Evolution of Osmolyte Systems. Science 1982, 217, 1214–1222. [Google Scholar] [CrossRef]
  51. Kültz, D. Molecular and evolutionary basis of the cellular stress response. Annu. Rev. Physiol. 2005, 67, 225–257. [Google Scholar] [CrossRef] [PubMed]
Aquacj 05 00004 g001
Figure 1. Electrophoresis. (A) Vibrio parahaemolyticus; (B) AHPND M: 100 bp DNA marker, 1: HP19-21; (-): negative control; and (+): positive control.
Figure 1. Electrophoresis. (A) Vibrio parahaemolyticus; (B) AHPND M: 100 bp DNA marker, 1: HP19-21; (-): negative control; and (+): positive control.
Aquacj 05 00004 g001
Aquacj 05 00004 g002
Figure 2. Cumulative mortality for juvenile Litopenaeus vannamei exposed to VpAHPND HP19-21 (5 × 106 CFU mL−1).
Figure 2. Cumulative mortality for juvenile Litopenaeus vannamei exposed to VpAHPND HP19-21 (5 × 106 CFU mL−1).
Aquacj 05 00004 g002
Aquacj 05 00004 g003
Figure 3. Glycine betaine levels in Litopenaeus vannamei gills (G), hepatopancreas (H), and muscles (M), exposed to 2 h sudden high salinities without Vp infection (2H C); sudden high salinities and 2 h Vp exposure (2H pi) (A), and 6 h exposure to high salinities: 8H C and 8 h exposure to high salinities plus Vp infection 8H pi (B). Data represent the mean ± SE. Different letters indicate significant differences between the control and experimental infection groups per salinity n = 9, p < 0.05.
Figure 3. Glycine betaine levels in Litopenaeus vannamei gills (G), hepatopancreas (H), and muscles (M), exposed to 2 h sudden high salinities without Vp infection (2H C); sudden high salinities and 2 h Vp exposure (2H pi) (A), and 6 h exposure to high salinities: 8H C and 8 h exposure to high salinities plus Vp infection 8H pi (B). Data represent the mean ± SE. Different letters indicate significant differences between the control and experimental infection groups per salinity n = 9, p < 0.05.
Aquacj 05 00004 g003
Aquacj 05 00004 g004aAquacj 05 00004 g004b
Figure 4. Effect of sudden high salinity exposure plus experimental Vibrio parahaemolyticus infection on betaine aldehyde dehydrogenase activity in L. vannamei gills, hepatopancreas, and muscle; (A) 2 h pi, (B) 8 h pi. Data represent the mean ± SE. Different letters indicate significant differences between the control and experimental infection groups per salinity n = 9, p < 0.05.
Figure 4. Effect of sudden high salinity exposure plus experimental Vibrio parahaemolyticus infection on betaine aldehyde dehydrogenase activity in L. vannamei gills, hepatopancreas, and muscle; (A) 2 h pi, (B) 8 h pi. Data represent the mean ± SE. Different letters indicate significant differences between the control and experimental infection groups per salinity n = 9, p < 0.05.
Aquacj 05 00004 g004aAquacj 05 00004 g004b
Table 1. Primer sequence for amplification of Vibrio and virulent genes.
Table 1. Primer sequence for amplification of Vibrio and virulent genes.
Primer Name Target SpeciesPrimer Sequence (5′-3′)Amplicon SizeReference
Vptl-450-FV. parahaemolyticusAAAGCGGATTATGCAGAAGCACTG450 bp[33]
Vpttl-450-RGCTACTTTCTAGCATTTTCTCTGC
PirA-FAHPND toxinTGACTATTCTCACGATTGGACTG284 bp[34]
PirA-RCACGACTAGCGCCATTGTTA
PirB-FTGATGAAGTGATGGGTGCTC392 bp
PirB-RTGTAAGCGCCGTTTAACTCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gomez-Jimenez, S.; Valenzuela-Soto, E.M.; Zamorano-Apodaca, J.C.; Gamez-Alejo, L.A.; Muñoz-Bacasehua, C. Glycine Betaine Levels and BADH Activity of Juvenile Shrimp Litopenaeus vannamei in Response to Vibrio Bacterial Infection and Sudden Hyperosmotic Stress. Aquac. J. 2025, 5, 4. https://doi.org/10.3390/aquacj5010004

AMA Style

Gomez-Jimenez S, Valenzuela-Soto EM, Zamorano-Apodaca JC, Gamez-Alejo LA, Muñoz-Bacasehua C. Glycine Betaine Levels and BADH Activity of Juvenile Shrimp Litopenaeus vannamei in Response to Vibrio Bacterial Infection and Sudden Hyperosmotic Stress. Aquaculture Journal. 2025; 5(1):4. https://doi.org/10.3390/aquacj5010004

Chicago/Turabian Style

Gomez-Jimenez, Silvia, Elisa M. Valenzuela-Soto, Julio C. Zamorano-Apodaca, Luis A. Gamez-Alejo, and Cesar Muñoz-Bacasehua. 2025. "Glycine Betaine Levels and BADH Activity of Juvenile Shrimp Litopenaeus vannamei in Response to Vibrio Bacterial Infection and Sudden Hyperosmotic Stress" Aquaculture Journal 5, no. 1: 4. https://doi.org/10.3390/aquacj5010004

APA Style

Gomez-Jimenez, S., Valenzuela-Soto, E. M., Zamorano-Apodaca, J. C., Gamez-Alejo, L. A., & Muñoz-Bacasehua, C. (2025). Glycine Betaine Levels and BADH Activity of Juvenile Shrimp Litopenaeus vannamei in Response to Vibrio Bacterial Infection and Sudden Hyperosmotic Stress. Aquaculture Journal, 5(1), 4. https://doi.org/10.3390/aquacj5010004

Article Metrics

Back to TopTop