Next Article in Journal
Plant Flavonoids—Biosynthesis, Transport and Involvement in Stress Responses
Previous Article in Journal
SnoRNA U50 Levels Are Regulated by Cell Proliferation and rRNA Transcription
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Expression Profile Analysis of Odorant Binding Proteins in the Oriental Fruit Fly Bactrocera dorsalis

1
State Key Laboratory of Agricultural Microbiology, Hubei Key Laboratory of Insect Resource Application and Sustainable Pest Control and Institute of Urban and Horticultural Pests, College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, Hubei, China
2
Department of Biological Sciences, University Federico II of Naples, Napoli 80138, Italy
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2013, 14(7), 14936-14949; https://doi.org/10.3390/ijms140714936
Submission received: 1 May 2013 / Revised: 30 June 2013 / Accepted: 4 July 2013 / Published: 17 July 2013
(This article belongs to the Section Biochemistry)

Abstract

:
Olfaction is crucial in many insects for critical behaviors, including those regulating survival and reproduction. Insect odorant-binding proteins (OBPs) function in the first step of the olfactory system and play an essential role in the perception of odorants, such as pheromones and host chemicals. The oriental fruit fly, Bactrocera dorsalis, is a destructive fruit-eating pest, due to its wide host range of up to 250 different types of fruits and vegetables, and this fly causes severe economic damage to the fruit and vegetable industry. However, OBP genes have not been largely identified in B. dorsalis. Based on our previously constructed B. dorsalis cDNA library, ten OBP genes were identified in B. dorsalis for the first time. A phylogenetic tree was generated to show the relationships among the 10 OBPs of B. dorsalis to OBP sequences of two other Dipteran species, including Drosophila melanogaster and the mosquito Anopheles gambiae. The expression profiles of the ten OBPs in different tissues (heads, thoraxes, abdomens, legs, wings, male antennae and female antenna) of the mated adults were analyzed by real-time PCR. The results showed that nine of them are highly expressed in the antenna of both sexes, except BdorOBP7. Four OBPs (BdorOBP1, BdorOBP4, BdorOBP8, and BdorOBP10) are also enriched in the abdomen, and BdorOBP7 is specifically expressed in leg, indicating that it may function in other biological processes. This work will provide insight into the roles of OBPs in chemoreception and help develop new pest-control strategies.

1. Introduction

Olfaction is essential for insects in the location of hosts and the detection of pheromones during the recognition and location of mates. The olfactory system in insects consists of three main types of proteins: odorant binding proteins (OBPs), odorant receptors (ORs) and odorant-degrading esterases (ODEs) [1]. Of these proteins, OBPs often function in the first step of odor perception.
Insect OBPs are water-soluble proteins that often consist of 120–150 amino acids present in the chemosensory organs of insects. These proteins are able to bind various hydrophobic odorant molecules in the environment and transport them through the hemolymph to the ORs at the dendrite membrane of the olfactory sensory neurons with antennae. Then the olfactory signal transduction system is induced [24]. OBPs often contain six highly conversed cysteine residues, which have been used for its genome-wide identification and annotation in a range of insect species [59]. Based on the number of cysteine residues they contain, OBPs are now classified as “Classic”, “Minus-C”, “Plus-C”, “Dimer”, and “Atypical” OBPs [7,10,11].
Substantial evidence has shown that OBPs are critical in odorant recognition, rather than merely serving as passive odorant shuttles [1218]. Response to the odorants ethanol or benzaldehyde was damaged in Drosophila that lacked the “LUSH” OBP [12,13]. Additionally, it has been reported that Drosophila lush mutants have a complete loss of sensitivity to the pheromone 11-cis vaccenyl acetate and the “LUSH” OBP is required for activity of pheromone-sensitive neurons [14]. Knock down of OBP1 in mosquitoes Culex quinquefasciatus reduced antennal response to several oviposition attractants, as measured by electrophysiological analyses [16]. A. gambiae OBP1 was demonstrated by RNAi to play an essential role in mediating indole recognition in the antennae of female mosquitoes [17]. Additionally, it has been demonstrated that different OBPs display distinct odorant-binding specificity in a single moth species [15,19,20]. All of these studies revealed that OBPs play significant roles in insect olfactory systems. Therefore, it is of great importance in the study of OBPs to understand the molecular basis of olfaction in insects and to develop environmentally friendly strategies for pest control.
Due to genome annotation and transcriptome sequencing, OBPs have been widely identified in many insect species, including the Dipteran species Drosophila melanogaster [7,10], the onion fly Delia antiqua [21], Aedes aegypti [8], Culex pipiens quinquefasciatus [22], Anopheles funestus [23], Lepidopteran Bombyx mori [24], Manduca sexta [25], Hymenopteran Solenopsis invicta [26], and Hemipteran Adelphocoris lineolatus [27]. However, OBPs have not been largely reported in Tephritid pest species that are of major economic importance in agriculture, except several partial sequences of the Mediterranean fruit fly, Ceratitis capitata [28].
The oriental fruit fly, B. dorsalis (Diptera: Tephritidae), is a highly invasive agricultural pest in Asian countries. Due to its wide host range of up to 250 different types of fruits and vegetables, this species causes severe economic losses every year. However, at present, there is only one cDNA sequence of B. dorsalis OBP in Genbank (accession number: EU564816). Therefore, it is of great importance to identify more OBPs that may be involved in host location and ovipositing in B. dorsalis.
In the present study, ten OBPs were identified from the B. dorsalis cDNA library we had previously constructed [29]. Sequence alignment and phylogenetic tree analysis was performed to characterize these molecules. A tissue distribution expression pattern of the mated adults was then inferred by quantitative RT-PCR. This work presents for the first time a study of the OBPs of the invasive agricultural pest B. dorsalis, which may provide more molecular targets for B. dorsalis control and insight into insect olfaction research, thus providing an essential foundation for the development of efficient, simple, green and sustainable pest control strategies.

2. Results and Discussion

2.1. Identification of OBPs in B. dorsalis

Nearly 20 OBPs were identified from our previously constructed B. dorsalis transcriptome [29], but only the full-length cDNAs encoding B. dorsalis OBPs were presented in this study (Table 1). These 10 OBPs all contain one conserved PBP-GOBP domain, which is the typical characteristic of the insect OBPs [27]. Similarly, OBPs have been largely identified in the sequenced Dipteran genomes [30]. For example, there are 51 OBPs in D. melanogaster and 66 OBPs in A. gambiae, respectively.
All of the identified BdorOBPs share high sequence homology with their D. melanogaster counterparts. The relative identities of BdorOBP7, BdorOBP8, BdorOBP9, and BdorOBP10 compared to DmelOBP83g, DmelOBP83ef, DmelOBP99a, DmelOBP99c were 63%, 47%, 56%, and 54%, respectively. The identities between BdorOBP1, BdorOBP5, BdorOBP6 (cDNA sequence missing 3′ stop code but containing the complete PBP-GOBP domain) and their homologous counterparts of D. melanogaster DmelOBP8a, DmelOBP56g, DmelOBP56h, are less than 40%. Notably, BdorOBP2, BdorOBP3 and BdorOBP4 share high identities (83%), and the identities for each pair were 77% (BdorOBP2 and BdorOBP3), 79% (BdorOBP2 and BdorOBP4), 74% (BdorOBP3 and BdorOBP4) (Figure 1). The three OBPs all show the highest identity with DmelOBP56d, with identities of 45%, 47%, 44%, respectively (Table 1). Proteins in the DmelOBP56d group are highly conserved from the signal peptides in the N-terminal region to the C-terminal region, except for some substitution (Figure 1). Among them, BdorOBP2 has seven additional amino acids in the C-terminal region.
These data revealed that the sequence identity between B. dorsalis OBPs and their D. melanogaster OBPs counterparts varies from 33% to 63%. This is consistent with the level of sequence identity of the previously identified OBPs from other species. The sequence identity between most identified A. lineolatus OBPs and their counterparts in other bugs varies from 31% to 53% [27]. Notably, amino acid identity between identified Culex pipiens quinquefasciatus OBPs and their mosquito counterparts varies from 17% to 94% [22]. The wide range of amino acid identity could be attributed to the different divergence times between these species (Supplement Figure S1). All of these reports indicate that insect OBPs are divergent proteins among different species.

2.2. Homology Alignments of B. dorsalis OBPs

The analysis of the derived amino acid sequences showed that they belong to three distinct subgroups: Classical OBPs, Minus-C OBPs and “Dimer” OBPs [7]. The classical OBPs include BdorOBP1, BdorOBP2, BdorOBP3, BdorOBP4, BdorOBP5, BdorOBP7 and BdorOBP9, which have only one six-cysteine motif (Figure 2). BdorOBP10 lacks one cysteine, so belongs to Minus-C OBPs (Figure 2). The BdorOBP6 miss two cysteines due to the partial sequences in the 3′ terminus. BdorOBP8 appears to have one additional six-cysteine motif, and two conserved prolines immediately before the third and the ninth cysteine, respectively, thus belonging to the “Dimer” OBPs (Supplement Figure S2). This is rather similar to some other Dipteran OBPs, including DmelOBP83cd, DmelOBP83ef, GmorOBP3 and GmorOBP7, all of which belong to “Dimer” OBPs group.

2.3. Phylogenetic Analysis of Dipteran OBPs

A phylogenetic tree was generated to show the relationships among the 10 OBPs of B. dorsalis to 108 OBP sequences of other 2 Dipteran species, including D. melanogaster and the mosquito A. gambiae (Figure 3). These BdorOBPs belong to different groups of orthologous proteins (Figure 3). BdorOBP1, BdorOBP7 and BdorOBP9 are clustered in one group with their D. melanogaster counterparts DmelOBP8a, DmelOBP83g, DmelOBP99a, respectively. The other three classic OBPs (BdorOBP2, BdorOBP3 and BdorOBP4) are clustered in a branch with DmelOBP56d, DmelOBP56a and DmelOBP56e, which is consistent with the high amino acid identity observed among them (Table 1). In addition, this phylogenetic analysis supports the high amino acid identity (79%) among these three proteins (BdorOBP2, BdorOBP3 and BdorOBP4). Notably, BdorOBP8 is clustered with other Dipteran “Dimer” OBPs, including DmelOBP83cd and DmelOBP83ef, suggesting that they may have conserved common functions in fly species.

2.4. Tissue Expression Pattern of the OBP Genes

OBPs from Tephritid fruit flies have not been largely reported, except some partial sequences of C. capitata [28]. We report for the first time the large identification and tissue distribution of OBPs in Tephritid fruit flies. qRT-PCR revealed that each of the ten OBPs had abundant expression in antenna, except BdorOBP7, suggesting that the B. dorsalis OBP genes identified in the current study may play an important part in insect olfaction (Figure 4). Among these genes, the expression levels of five classic OBP genes (BdorOBP2, BdorOBP3, BdorOBP4, BdorOBP5, and BdorOBP9) were much higher in male antenna than female antenna, while three OBP genes (BdorOBP1, BdorOBP8, BdorOBP10) were expressed much more abundantly in female antenna. The transcript levels of BdorOBP2, BdorOBP3, BdorOBP4, BdorOBP5, BdorOBP9 were 4.4, 6, 2.8, 7.2 and 3.4 times higher in the male antennae, respectively, than in female antennae. There was no significant difference in the expression level of the other two classic OBPs (BdorOBP6 and BdorOBP7) in antenna of both sexes.
This result is consistent with previous reports indicating that many olfactory sensory neurons are located in the antennae [31], as is also reported in other insect species. Among 14 identified AlinOBPs, 9 OBP genes were expressed much higher in both male and female antenna than in other tissues [27]. The transcript levels of A. funestus OBPs were much higher in antenna than other tissues [23]. This result is also observed in Cx. quinquefasciatus, in which most of the OBPs are mainly expressed in antennae [22]. Three of the B. dorsalis OBPs (BdorOBP1, BdorOBP8, and BdorOBP10) have much higher expression in the female antenna than male antenna, revealing that these OBPs may be involved in female specific behaviors, such as host location and oviposition. Five B. dorsalis OBPs were expressed much more highly in male antenna than female antenna, suggesting that they are possibly necessary for males to be able to mate for courtship.
Additionally, BdorOBP4 and BdorOBP10 were also highly present in the heads. Take BdorOBP4 for example: there was no significant difference between the expression level in the heads and that observed in the female antenna.
Interestingly, four OBPs (BdorOBP1, BdorOBP4, BdorOBP8, and BdorOBP10) were also expressed highly in the abdomen, where the reproductive organs are located, indicating that these OBPs may have a role in both olfaction and oviposition. The abdomen transcript levels of BdorOBP8 were much higher than in other tissues. Similarly, abdomen expression was also detected in Cx. quinquefasciatus and A. funestus [22,23]. Furthermore, it has been reported in two sibling Lepidopteran species Helicoverpa armigera and H. assulta that OBP10 is highly abundant in seminal fluid, which is transferred to females during mating and eventually found on the surface of fertilized eggs, suggesting that OBP10 could be a carrier for oviposition deterrents [32]. Our finding is consistent with the fact that B. dorsalis tissues were collected during the oviposition period. Whether or not these four BdorOBPs are involved in oviposition deterrence needs further research.
Notably, BdorOBP7 was specifically expressed in leg, which is another olfactory tissue. Leg expression of OBPs has also been reported in other insects, such as Cx. quinquefasciatus [22], A. funestus [23], A. lineolatus [27], and D. antiqua [21]. These OBPs expressed in the taste sensilla on the legs may be involved in the perception of non-volatile host chemicals and warrant further study.

3. Experimental Section

3.1. Insect Rearing

The oriental fruit flies were cultured in our laboratory at 28 °C under a photoperiod of 14 h light/10 h dark. Adult flies were reared on artificial diets described previously, and hatched larvae were maintained in bananas [33].

3.2. Identification of the OBP Genes and Sequence Analysis

OBP genes were first identified using BLASTN and BLASTX results from our B. dorsalis cDNA library [29], which was established from three samples: larvae of three instars, pupae from different stages, newly emerged adults and sex matured adults before and after copulation (the sex ratio was 1:1). At least ten insects were collected for each stage. The 10 ESTs showing homology to odorant-binding protein (OBP) family genes were compared to one another and the sequences that include the complete opening reading frame, several conserved cysteines, and the signal peptides in N terminus were chosen for further study. Homology analysis was performed with BLASTX [34]. The OBP genes were translated, and the characteristics of the obtained proteins were predicted using the Expert Protein Analysis System [35]. Sequence alignment was conducted using the ClustalW and GENDOC computer programs [36,37]. The putative N-terminal signal peptides were predicted by Simple Modular Architecture Research Tool [38].

3.3. Phylogenetic Analysis

Amino acid sequences of ten putative OBP genes identified in this study along with the OBPs from two other Dipteran species (D. melanogaster and A. gambiae) were used to construct a phylogenetic tree using MEGA4.0 (Molecular Evolutionary Genetics Analysis, Version 4.0, Sudhir Kumar, AZ, USA) with the pair-wise deletion option under the JTT empirical amino acid substitution model [30]. The highly divergent signal peptides in the N terminal were removed. Branch support was assessed by bootstrap analysis with 1000 replicates. A species phylogenetic tree was also generated using Interactive Tree Of Life (iTOL) web tool [39] ( http://itol.embl.de) to show the relationships between B. dorsalis and other mentioned species, including C. capitata, D. melanogaster, Glossina morsitans morsitans, D. antiqua, A. gambiae, A. funestus, Aedes albopictus, and Cx. quinquefasciatus.

3.4. Total RNA Isolation and cDNA Synthesis

Total RNA was extracted from different tissues of the mature adult during the oviposition period, including head, thorax, abdomen, leg, wing, male antennae, and female antennae, according to methods previously described by Zheng et al. [40]. Matings were obtained by placing 100 mature males and 100 mature females (two weeks old) into 60 cm × 60 cm × 60 cm boxes (20 flies for each sex per box) 2 h before dusk. The boxes were then checked 1 h later under dim light, and mating pairs were gently coaxed into another new boxes. The following morning, all unmated oriental fruit flies were discarded. The tissue samples were dissected from 40 individuals of each sex. Two micrograms of total RNA was reverse transcribed into cDNA using M-MLV Reverse Transcriptase (FirstStrand cDNA Synthesis Kit, Takara, Japan) with the primer oligo-anchor R (5′-GACCACGCGTATCGATGTCGACT16 (A/C/G)-3′). The integrity of the total RNA was examined using 1% agarose electrophoresis, and the purity was determined by the ratio of A260/A280 measured by a spectrophotometer. To eliminate contamination from genomic DNA, a genomic DNA elimination column that could efficiently remove genomic DNA was used after total RNA extraction.

3.5. Expression Pattern Analysis of OBPs by Quantitative Real-time PCR

The gene-specific primers (Table 2) were used to conduct qRT-PCR to detect the tissue distribution of OBPs using a SYBR Premix ExTaq kit (Takara, Dalian, China) following the manufacturer’s instructions with a real-time thermal cycler (Bio-Rad, Hercules, CA, USA). β-Actin was amplified for internal standardization. The PCR efficiency of the genes was validated before gene expression analysis. The qRT-PCR was performed in a volume of 20 μL containing 10 μL of 2× SYBR Premix ExTaq™, 2 μL cDNA (1:100 diluted), 2 μL each of forward and reverse primers (1 μmol/L), and 2 μL nuclease free H2O. The qRT-PCR program was as follows: 94 °C for 3 min followed by 40 cycles at 94 °C for 15 s, 60 °C for 30 s, and 72 °C for 20 s. At the end of each PCR reaction, the melting curve was analyzed for the PCR products to confirm the presence of a single fragment of amplification. The expression level of each OBP was then calculated by 2−ΔCT using the comparative CT method in which the discrepancy between the CT for the OBP and β-actin (ΔCT) was calculated to normalize the variation in the amount of cDNA in each reaction. Three biological replicates were performed.

3.6. Statistical Analysis

All the results from experimental replicates were analyzed by one-way analysis of variance (ANOVA) and Duncan’s test using SPSS 16.0 (IBM Corporation, Somers, NY, USA).

4. Conclusions

This work presents for the first time a study on the OBPs in Tephritid fruit flies, which are of major economic importance in agriculture. Despite some advances during the past few decades, no new approaches to Tephritid fruit flies control have been widely and effectively used. Transcriptome sequencing has provided insights into an approach to identify functional genes in important biological processes, such as development and reproduction [29,41]. In our study, 10 OBP genes were identified from B. dorsalis for the first time. Tissue distribution of the OBP genes showed that most of them are highly expressed in the antenna of both sexes. BdorOBP7 is specifically expressed in leg, and four OBPs (BdorOBP1, BdorOBP4, BdorOBP8, and BdorOBP10) are also enriched in the abdomen, indicating that they may function in other biological processes. Large-scale functional and structural characterization of these OBPs will be the objectives of our further research.

Supplementary Information

ijms-14-14936-s001.pdf

Acknowledgments

This research was supported by Special Fund for Agro-Scientific Research in the Public Interest (No. 200903047), the China Postdoctoral Science Foundation (No. 20100480913), the International Foundation for Science (No. C/5149-1), the Fundamental Research Funds for the Central Universities (No. 2012ZYTS042), the Ph.D. Programs Foundation of Ministry of Education of China (No. 20110146120034), National Natural Science Foundation of China (No. 31201516) and the earmarked fund for Modern Agro-industry Technology Research System (No. CARS-27).

Conflict of Interest

The authors declare no conflict of interest.

References

  1. Justice, R.W.; Biessmann, H.; Walter, M.F.; Dimitratos, S.D.; Woods, D.F. Genomics spawns novel approaches to mosquito control. Bioessays 2003, 25, 1011–1020. [Google Scholar]
  2. Vogt, R.G.; Callahan, F.E.; Rogers, M.E.; Dickens, J.C. Odorant binding protein diversity and distribution among the insect orders, as indicated by LAP, an OBP-related protein of the true bug Lygus lineolaris (Hemiptera, Heteroptera). Chem. Senses 1999, 24, 481–495. [Google Scholar]
  3. Pelosi, P.; Maida, R. Odorant-binding proteins in insects. Comp. Biochem. Physiol. B Biochem. Mol. Biol 1995, 111, 503–514. [Google Scholar]
  4. Nakagawa, T.; Sakurai, T.; Nishioka, T.; Touhara, K. Insect sex-pheromone signals mediated by specific combinations of olfactory receptors. Science 2005, 307, 1638–1642. [Google Scholar]
  5. Liu, R.; Lehane, S.; He, X.; Lehane, M.; Hertz-Fowler, C.; Berriman, M.; Pickett, J.A.; Field, L.M.; Zhou, J.J. Characterisations of odorant-binding proteins in the tsetse fly Glossina morsitans morsitans. Cell. Mol. Life Sci 2010, 67, 919–929. [Google Scholar]
  6. Xu, Y.L.; He, P.; Zhang, L.; Fang, S.Q.; Dong, S.L.; Zhang, Y.J.; Li, F. Large-scale identification of odorant-binding proteins and chemosensory proteins from expressed sequence tags in insects. BMC Genomics 2009, 10, 632. [Google Scholar]
  7. Zhou, J.J.; Huang, W.; Zhang, G.A.; Pickett, J.A.; Field, L.M. “Plus-C” odorant-binding protein genes in two Drosophila species and the malaria mosquito Anopheles gambiae.”. Gene 2004, 327, 117–129. [Google Scholar]
  8. Zhou, J.J.; He, X.L.; Pickett, J.A.; Field, L.M. Identification of odorant-binding proteins of the yellow fever mosquito Aedes aegypti: Genome annotation and comparative analyses. Insect Mol. Biol 2008, 17, 147–163. [Google Scholar]
  9. Zhou, J.J.; Vieira, F.G.; He, X.L.; Smadja, C.; Liu, R.; Rozas, J.; Field, L.M. Genome annotation and comparative analyses of the odorant-binding proteins and chemosensory proteins in the pea aphid Acyrthosiphon pisum. Insect Mol. Biol 2010, 19, 113–122. [Google Scholar]
  10. Hekmat-Scafe, D.S.; Scafe, C.R.; McKinney, A.J.; Tanouye, M.A. Genome-wide analysis of the odorant-binding protein gene family in Drosophila melanogaster. Genome Res 2002, 12, 1357–1369. [Google Scholar]
  11. Xu, P.X.; Zwiebel, L.J.; Smith, D.P. Identification of a distinct family of genes encoding atypical odorant-binding proteins in the malaria vector mosquito, Anopheles gambiae. Insect Mol. Biol 2003, 12, 549–560. [Google Scholar]
  12. Wang, Y.; Wright, N.J.; Guo, H.; Xie, Z.; Svoboda, K.; Malinow, R.; Smith, D.P.; Zhong, Y. Genetic manipulation of the odor-evoked distributed neural activity in the Drosophila mushroom body. Neuron 2001, 29, 267–276. [Google Scholar]
  13. Kim, M.S.; Repp, A.; Smith, D.P. LUSH odorant-binding protein mediates chemosensory responses to alcohols in Drosophila melanogaster. Genetics 1998, 150, 711–721. [Google Scholar]
  14. Xu, P.X.; Atkinson, R.; Jones, N.M.D.; Smith, D.P. Drosophila OBP LUSH is required for activity of pheromone-sensitive neurons. Neurons 2005, 45, 193–200. [Google Scholar]
  15. Plettner, E.; Lazar, J.; Prestwich, E.G.; Prestwich, G.D. Discrimination of pheromone enantiomers by two pheromone binding proteins from the gypsy moth Lymantria dispar. Biochemistry 2000, 39, 8953–8962. [Google Scholar]
  16. Pelletier, J.; Guidolin, A.; Syed, Z.; Cornel, A.J.; Leal, W.S. Knockdown of a mosquito odorant-binding protein involved in the sensitive detection of oviposition attractants. J. Chem. Ecol 2010, 36, 245–248. [Google Scholar]
  17. Biessmann, H.; Andronopoulou, E.; Biessmann, M.R.; Douris, V.; Dimitratos, S.D.; Eliopoulos, E.; Guerin, P.M.; Iatrou, K.; Justice, R.W.; Krober, T.; et al. The Anopheles gambiae odorant binding protein 1 (AgamOBP1) mediates indole recognition in the antennae of female mosquitoes. PLoS One 2010, 5, e9471. [Google Scholar]
  18. Zhong, T.; Yin, J.; Deng, S.; Li, K.; Cao, Y. Fluorescence competition assay for the assessment of green leaf volatiles and trans-beta-farnesene bound to three odorant-binding proteins in the wheat aphid Sitobion avenae (Fabricius). J. Insect Physiol 2012, 58, 771–781. [Google Scholar]
  19. Prestwich, G.D.; Du, G.; LaForest, S. How is pheromone specificity encoded in proteins? Chem. Senses 1995, 20, 461–469. [Google Scholar]
  20. Maibeche-Coisne, M.; Jacquin-Joly, E.; Francois, M.C.; Nagnan-Le Meillour, P. Molecular cloning of two pheromone binding proteins in the cabbage armyworm Mamestra brassicae. Insect Biochem. Mol. Biol 1998, 28, 815–818. [Google Scholar]
  21. Mitaka, H.; Matsuo, T.; Miura, N.; Ishikawa, Y. Identification of odorant-binding protein genes from antennal expressed sequence tags of the onion fly, Delia antiqua. Mol. Biol. Rep 2011, 38, 1787–1792. [Google Scholar]
  22. Pelletier, J.; Leal, W.S. Genome analysis and expression patterns of odorant-binding proteins from the Southern House mosquito Culex pipiens quinquefasciatus. PLoS One 2009, 4, e6237. [Google Scholar]
  23. Xu, W.; Cornel, A.J.; Leal, W.S. Odorant-binding proteins of the malaria mosquito Anopheles funestus sensu stricto. PLoS One 2010, 5, e15403. [Google Scholar]
  24. Gong, D.P.; Zhang, H.J.; Zhao, P.; Xia, Q.Y.; Xiang, Z.H. The odorant binding protein gene family from the genome of silkworm, Bombyx mori. BMC Genomics 2009, 10, 332. [Google Scholar]
  25. Grosse-Wilde, E.; Kuebler, L.S.; Bucks, S.; Vogel, H.; Wicher, D.; Hansson, B.S. Antennal transcriptome of Manduca sexta. Proc. Natl. Acad. Sci. USA 2011, 108, 7449–7454. [Google Scholar]
  26. Gotzek, D.; Robertson, H.M.; Wurm, Y.; Shoemaker, D. Odorant binding proteins of the red imported fire ant, Solenopsis invicta: An example of the problems facing the analysis of widely divergent proteins. PLoS One 2011, 6, e16289. [Google Scholar]
  27. Gu, S.H.; Wang, S.P.; Zhang, X.Y.; Wu, K.M.; Guo, Y.Y.; Zhou, J.J.; Zhang, Y.J. Identification and tissue distribution of odorant binding protein genes in the lucerne plant bug Adelphocoris lineolatus (Goeze). Insect Biochem. Mol. Biol 2011, 41, 254–263. [Google Scholar]
  28. Gomulski, L.M.; Dimopoulos, G.; Xi, Z.; Soares, M.B.; Bonaldo, M.F.; Malacrida, A.R.; Gasperi, G. Gene discovery in an invasive tephritid model pest species, the Mediterranean fruit fly, Ceratitis capitata. BMC Genomics 2008, 9, 243. [Google Scholar]
  29. Zheng, W.; Peng, T.; He, W.; Zhang, H. High-throughput sequencing to reveal genes involved in reproduction and development in Bactrocera dorsalis (Diptera: Tephritidae). PLoS One 2012, 7, e36463. [Google Scholar]
  30. Vieira, F.G.; Sanchez-Gracia, A.; Rozas, J. Comparative genomic analysis of the odorant-binding protein family in 12 Drosophila genomes: Purifying selection and birth-and-death evolution. Genome Biol. 2007, 8. [Google Scholar] [CrossRef]
  31. Shanbhag, S.R.; Muller, B.; Steinbrecht, R.A. Atlas of olfactory organs of Drosophila melanogaster 2. Internal organization and cellular architecture of olfactory sensilla. Arthropod Struct. Dev 2000, 29, 211–229. [Google Scholar]
  32. Sun, Y.L.; Huang, L.Q.; Pelosi, P.; Wang, C.Z. Expression in antennae and reproductive organs suggests a dual role of an odorant-binding protein in two sibling Helicoverpa species. PLoS One 2012, 7, e30040. [Google Scholar]
  33. Li, X.; Zhang, M.; Zhang, H. RNA interference of four genes in adult Bactrocera dorsalis by feeding their dsRNAs. PLoS One 2011, 6, e17788. [Google Scholar]
  34. Altschul, S.F.; Madden, T.L.; Schaffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res 1997, 25, 3389–3402. [Google Scholar]
  35. Artimo, P.; Jonnalagedda, M.; Arnold, K.; Baratin, D.; Csardi, G.; de Castro, E.; Duvaud, S.; Flegel, V.; Fortier, A.; Gasteiger, E.; et al. ExPASy: SIB bioinformatics resource portal. Nucleic Acids Res 2012, 40, W597–W603. [Google Scholar]
  36. Oliver, T.; Schmidt, B.; Nathan, D.; Clemens, R.; Maskell, D. Using reconfigurable hardware to accelerate multiple sequence alignment with ClustalW. Bioinformatics 2005, 21, 3431–3432. [Google Scholar]
  37. Nicholas, K.B.; Nicholas, H.B., Jr; Deerfield, D.W., II. GeneDoc: Analysis and visualization of genetic variation. Embnew. News 1997, 4, 14. [Google Scholar]
  38. Letunic, I.; Doerks, T.; Bork, P. SMART 7: Recent updates to the protein domain annotation resource. Nucleic Acids Res 2012, 40, D302–D305. [Google Scholar]
  39. Letunic, I.; Bork, P. Interactive Tree Of Life v2: Online annotation and display of phylogenetic trees made easy. Nucleic Acids Res 2011, 39, W475–W478. [Google Scholar]
  40. Zheng, W.; Zhu, C.; Peng, T.; Zhang, H. Odorant receptor co-receptor Orco is upregulated by methyl eugenol in male Bactrocera dorsalis (Diptera: Tephritidae). J. Insect Physiol 2012, 58, 1122–1127. [Google Scholar]
  41. Shen, G.M.; Dou, W.; Niu, J.Z.; Jiang, H.B.; Yang, W.J.; Jia, F.X.; Hu, F.; Cong, L.; Wang, J.J. Transcriptome analysis of the oriental fruit fly (Bactrocera dorsalis). PLoS One 2011, 6, e29127. [Google Scholar]
Figure 1. Alignments of the OBP56d group of B. dorsalis odorant-binding proteins (OBPs). Amino acid numbering is provided on the right of the alignment. The numbers above the alignment indicate amino acid position in the alignment. All identical and similar amino acid residues are shaded. Yellow boxes show conserved cysteine residues. The letters below the alignment indicate identical residues.
Figure 1. Alignments of the OBP56d group of B. dorsalis odorant-binding proteins (OBPs). Amino acid numbering is provided on the right of the alignment. The numbers above the alignment indicate amino acid position in the alignment. All identical and similar amino acid residues are shaded. Yellow boxes show conserved cysteine residues. The letters below the alignment indicate identical residues.
Ijms 14 14936f1
Figure 2. Alignment of the identified B. dorsalis OBPs. The classical OBPs: BdorOBP1, BdorOBP2, BdorOBP3, BdorOBP4, BdorOBP5, BdorOBP7, BdorOBP9. “Dimer” OBP: BdorOBP8. The Minus-C OBPs: BdorOBP10. Full-length amino acid sequences of BdorOBPs are aligned by ClustalX 1.83 (Multiple sequence alignment program, Thompson JD, IllkirchCedex, France) and edited using GeneDoc (Sequence analysis program, Karl Nicholas, San Francisco, CA, USA). Accession numbers of the 10 OBPs are listed in Table 1.
Figure 2. Alignment of the identified B. dorsalis OBPs. The classical OBPs: BdorOBP1, BdorOBP2, BdorOBP3, BdorOBP4, BdorOBP5, BdorOBP7, BdorOBP9. “Dimer” OBP: BdorOBP8. The Minus-C OBPs: BdorOBP10. Full-length amino acid sequences of BdorOBPs are aligned by ClustalX 1.83 (Multiple sequence alignment program, Thompson JD, IllkirchCedex, France) and edited using GeneDoc (Sequence analysis program, Karl Nicholas, San Francisco, CA, USA). Accession numbers of the 10 OBPs are listed in Table 1.
Ijms 14 14936f2
Figure 3. Phylogenetic analysis of BdorOBPs. The sequences used for the analysis included B. dorsalis and two other Dipteran species with full genome sequenced: D. melanogaster and A. gambiae. The highly divergent signal peptide sequences at the N-terminus were removed and the neighbor-joining tree was constructed using MEGA 4 with the pair-wise deletion option under the JTT empirical amino acid substitution model. Only bootstrap values above 50 were set to be shown.
Figure 3. Phylogenetic analysis of BdorOBPs. The sequences used for the analysis included B. dorsalis and two other Dipteran species with full genome sequenced: D. melanogaster and A. gambiae. The highly divergent signal peptide sequences at the N-terminus were removed and the neighbor-joining tree was constructed using MEGA 4 with the pair-wise deletion option under the JTT empirical amino acid substitution model. Only bootstrap values above 50 were set to be shown.
Ijms 14 14936f3
Figure 4. Tissue distribution of the ten identified OBPs. qRT-PCR to analyze OBP transcript levels in different tissues of mature adults during the oviposition period, including head, thorax, abdomen, leg, wing, male antennae, and female antennae. Relative transcript levels are calculated using β-actin as the standard. Different letters indicate significant differences in the expression level of OBPs (p < 0.05, Duncan’s test). Three biological replicates were performed.
Figure 4. Tissue distribution of the ten identified OBPs. qRT-PCR to analyze OBP transcript levels in different tissues of mature adults during the oviposition period, including head, thorax, abdomen, leg, wing, male antennae, and female antennae. Relative transcript levels are calculated using β-actin as the standard. Different letters indicate significant differences in the expression level of OBPs (p < 0.05, Duncan’s test). Three biological replicates were performed.
Ijms 14 14936f4
Table 1. Oriental fruit fly assembled sequences with best-hit matches to D. melanogaster odorant binding protein genes.
Table 1. Oriental fruit fly assembled sequences with best-hit matches to D. melanogaster odorant binding protein genes.
Gene nameAccession numberLengthDrosophila geneSubject IDE-valueIdentity (%)
BdorOBP1KC559112159OBP8aACY927831 × 10−1433
BdorOBP2KC559113138OBP56dNP_6114442 × 10−2145
BdorOBP3KC559114146OBP56dNP_6114448 × 10−2247
BdorOBP4KC559115136OBP56dNP_6114441 ×10−1944
BdorOBP5KC559116130OBP56gNP_6114473 ×10−1434
BdorOBP6KC559117104 *OBP56hABW780791 × 10−1136
BdorOBP7KC559118142OBP83gAAN132322 × 10−5463
BdorOBP8KC559119274OBP83efAAF519181 × 10−6947
BdorOBP9KC559120148OBP99aACT221432 × 10−5656
BdorOBP10KC559121149OBP99cACT222813 × 10−4654
Length, number of amino acids including signal peptide region;
*partial sequence in the 3′ terminal.
Table 2. Primers used for gene expression detection of BdorOBPs by qRT-PCR.
Table 2. Primers used for gene expression detection of BdorOBPs by qRT-PCR.
Primer name(5′→3′) Nucleotide sequence
BdorOBP1RTFGGCGAGCGTTGTTTCCAG
BdorOBP1RTRATCGGCACCAGCACTTCC
BdorOBP2RTFTTCTTCGCTGTTGCTGTTTTGC
BdorOBP2RTRAGAAGCATTTGACTTTGCCATC
BdorOBP3RTFTTGACCGAGGAGCAGAAAC
BdorOBP3RTRTTGACTTTGCCATCGACTT
BdorOBP4RTFGAACTTCTTCGCTGTTGCTG
BdorOBP4RTRCTTGACTGTCATCGCCTTTG
BdorOBP5RTFCCACGACTTCATTGAGGGTA
BdorOBP5RTRCCACAGCAGCAACTAATTTATC
BdorOBP6RTFACGAAGCCAAAGTCACGG
BdorOBP6RTRGCATCAAAGACGCCATCC
BdorOBP7RTFGTTGCAGGCAAATTCCAGAT
BdorOBP7RTRAGAGTCCCATTCGCTCCACA
BdorOBP8RTFCGAAGTCGGCAGCAAAGA
BdorOBP8RTRTCGTCCGCATCGAACCAG
BdorOBP9RTFGCGATGCCGACCATGATGAC
BdorOBP9RTRACCACCACGATAAGCCCACT
BdorOBP10RTFGTGTCTTCTGCGAACATGAGG
BdorOBP10RTRCACTTGTGACCACGATAGGC
β-actinRTFCTCGTCCAACCGTTCATACC
β-actinRTRCTGACCTGCCCACTGAAGTT

Share and Cite

MDPI and ACS Style

Zheng, W.; Peng, W.; Zhu, C.; Zhang, Q.; Saccone, G.; Zhang, H. Identification and Expression Profile Analysis of Odorant Binding Proteins in the Oriental Fruit Fly Bactrocera dorsalis. Int. J. Mol. Sci. 2013, 14, 14936-14949. https://doi.org/10.3390/ijms140714936

AMA Style

Zheng W, Peng W, Zhu C, Zhang Q, Saccone G, Zhang H. Identification and Expression Profile Analysis of Odorant Binding Proteins in the Oriental Fruit Fly Bactrocera dorsalis. International Journal of Molecular Sciences. 2013; 14(7):14936-14949. https://doi.org/10.3390/ijms140714936

Chicago/Turabian Style

Zheng, Weiwei, Wei Peng, Chipan Zhu, Qun Zhang, Giuseppe Saccone, and Hongyu Zhang. 2013. "Identification and Expression Profile Analysis of Odorant Binding Proteins in the Oriental Fruit Fly Bactrocera dorsalis" International Journal of Molecular Sciences 14, no. 7: 14936-14949. https://doi.org/10.3390/ijms140714936

APA Style

Zheng, W., Peng, W., Zhu, C., Zhang, Q., Saccone, G., & Zhang, H. (2013). Identification and Expression Profile Analysis of Odorant Binding Proteins in the Oriental Fruit Fly Bactrocera dorsalis. International Journal of Molecular Sciences, 14(7), 14936-14949. https://doi.org/10.3390/ijms140714936

Article Metrics

Back to TopTop