Next Article in Journal
Decoding the Mechanism of Action of Rapid-Acting Antidepressant Treatment Strategies: Does Gender Matter?
Next Article in Special Issue
Characterization of Stackebrandtia nassauensis GH 20 Beta-Hexosaminidase, a Versatile Biocatalyst for Chitobiose Degradation
Previous Article in Journal
HER2 Signaling Implicated in Regulating Alveolar Epithelial Permeability with Cyclic Stretch
Previous Article in Special Issue
A Computational Method to Propose Mutations in Enzymes Based on Structural Signature Variation (SSV)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 20
Issue 4
10.3390/ijms20040947
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

β-Galactosidase from Lactobacillus helveticus DSM 20075: Biochemical Characterization and Recombinant Expression for Applications in Dairy Industry

by
Suwapat Kittibunchakul
1,
Mai-Lan Pham
1,
Anh-Minh Tran
1,2 and
Thu-Ha Nguyen
1,*
1
Food Biotechnology Laboratory, BOKU University of Natural Resources and Life Sciences, Muthgasse 18, 1190 Vienna, Austria
2
Department of Biology, Faculty of Fundamental Sciences, Ho Chi Minh City University of Medicine and Pharmacy, 217 Hong Bang, Ho Chi Minh City, Vietnam
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2019, 20(4), 947; https://doi.org/10.3390/ijms20040947
Submission received: 23 January 2019 / Revised: 15 February 2019 / Accepted: 19 February 2019 / Published: 22 February 2019
(This article belongs to the Special Issue Industrial Enzymes: Structure, Function and Applications)
Browse Figures
Versions Notes

Abstract

:
β-Galactosidase encoding genes lacLM from Lactobacillus helveticus DSM 20075 were cloned and successfully overexpressed in Escherichia coli and Lactobacillus plantarum using different expression systems. The highest recombinant β-galactosidase activity of ∼26 kU per L of medium was obtained when using an expression system based on the T7 RNA polymerase promoter in E. coli, which is more than 1000-fold or 28-fold higher than the production of native β-galactosidase from L. helveticus DSM 20075 when grown on glucose or lactose, respectively. The overexpression in L. plantarum using lactobacillal food-grade gene expression system resulted in ∼2.3 kU per L of medium, which is approximately 10-fold lower compared to the expression in E. coli. The recombinant β-galactosidase from L. helveticus overexpressed in E. coli was purified to apparent homogeneity and subsequently characterized. The Km and vmax values for lactose and o-nitrophenyl-β-d-galactopyranoside (oNPG) were 15.7 ± 1.3 mM, 11.1 ± 0.2 µmol D-glucose released per min per mg protein, and 1.4 ± 0.3 mM, 476 ± 66 µmol o-nitrophenol released per min per mg protein, respectively. The enzyme was inhibited by high concentrations of oNPG with Ki,s = 3.6 ± 0.8 mM. The optimum pH for hydrolysis of both substrates, lactose and oNPG, is pH 6.5 and optimum temperatures for these reactions are 60 and 55 °C, respectively. The formation of galacto-oligosaccharides (GOS) in discontinuous mode using both crude recombinant enzyme from L. plantarum and purified recombinant enzyme from E. coli revealed high transgalactosylation activity of β-galactosidases from L. helveticus; hence, this enzyme is an interesting candidate for applications in lactose conversion and GOS formation processes.

1. Introduction

Lactic acid bacteria, particularly Lactobacillus spp., are well recognized as safe for human consumption, often referred to as probiotics conferring health-promoting properties, and are notable for their potential in food applications [1,2]. Lactobacillus helveticus, a homofermentative thermophilic lactic acid bacterium with an optimal growth temperature of 42 °C, is among the most industrially important lactobacilli and plays an important role as a starter culture in the manufacture of fermented dairy products such as cheeses, yoghurts and sour milk [3]. During its growth in milk, L. helveticus utilizes lactose as a sole carbon source. The uptake of lactose by this organism occurs through a membrane transport system followed by β-galactosidase-catalyzed intracellular hydrolysis of lactose into the monosaccharides glucose and galactose [4,5,6].
Lactic acid bacterial GH2 β-galactosidases are predominantly of the heterodimeric LacLM type, which are encoded by the two overlapping genes, lacL and lacM, for instance β-galactosidases from Lactobacillus reuteri [7], Lactobacillus acidophilus [8], Lactobacillus plantarum [9], Lactobacillus pentosus [10] and Lactobacillus sakei [11]. Di- or oligomeric GH2 β-galactosidases of the LacZ type, encoded by the single lacZ gene, are sometimes, but not often, found in lactic acid bacteria such as in Lactobacillus bulgaricus [12], Streptococcus thermophilus [13] and Streptococcus salivarius [14]. β-Galactosidases catalyze the hydrolysis and transgalactosylation of β-d-galactopyranosides (such as lactose) [15,16,17]. They catalyze the cleavage of lactose (or related compounds) in their hydrolysis mode, and are thus used in the dairy industry to remove lactose from various products, to prevent crystallization of lactose, to increase solubility of milk-based products, to improve sweetness, to remove lactose from cheese whey and for the production of lactose-free products [13,18,19]. An attractive biocatalytic application is found in the transgalactosylation potential of these enzymes, which is based on their catalytic mechanism, to yield prebiotic galacto-oligosaccharides (GOS) as catalytic products when using lactose as a substrate [15,20]. GOS serve as fermentable substrates for stimulating the growth and activity of probiotics and have been found to modulate the gut microbiota by inhibiting pathogenic bacteria [21,22]. The use of GOS in infant formula and for the development of functional foods is nowadays of significant interest [23]. GOS are also used in a wide range of products such as fermented milk products, breads, jams and beverages [23]. This broad range of food and health-related applications of GOS leads to the challenge in exploring promising β-galactosidases from food-grade sources.
In response to the profusely use in industrial applications as well as the safety issues concerning enzyme sources, we aimed to overproduce β-galactosidase from L. helveticus DSM 20075 (ATCC 15009) in L. plantarum, a food-grade host. Most of LacLM-type β-galactosidases are from mesophilic lactobacilli [7,8,9,10,11]; hence, it is of our interest in overproducing a LacLM-type β-galactosidase from a thermophilic source for applications in dairy industry. Our interest is driven by two main reasons: (1) a major drawback of using mesophilic biocatalysts in industrial processes is the threat of microbial contamination and (2) the time needed to obtain high lactose conversion or even complete lactose hydrolysis is reduced at higher process temperatures. In this paper, we describe and compare the heterologous overexpression of lacLM-genes encoded β-galactosidase from L. helveticus in Escherichia coli using an expression system based on the T7 RNA polymerase promoter and in food-grade L. plantarum using a lactobacillal expression system. Furthermore, the biochemical properties of the recombinant β-galactosidases pertaining to their ability to produce GOS in biocatalytic processes are reported.

2. Results and Discussion

2.1. Production of Recombinant β-Galactosidases from L. helveticus in E. coli

The yields of β-galactosidase activity of the wild-type strain of L. helveticus DSM 20075 were relatively low. The β-galactosidase yields, as measured in a cell-free extract, obtained after the cultivations of L. helveticus DSM 20075 at 37 °C for 24 h, were only ∼ 24.4 ± 0.6 UoNPG per L of medium when grown on MRS (Lactobacillus broth according to De Man, Rogosa, and Sharpe [24]) containing 2% glucose and ~913.8 ± 11.8 UoNPG per L of medium when grown on MRS containing 2% lactose with a specific activity of ~3.0 U/mg (data not shown). Thus, we attempted to overproduce this industrially attractive enzyme using different expression systems. The lacLM genes were cloned into the expression vector pET-21d(+). The resulting expression vector, pET21lacLMLh, was then transformed into E. coli BL21 Star (DE3) cells and E. coli T7 express cells carrying the plasmid pGRO7 containing the chaperones GroEL/GroES. The resulting clones were cultivated in LB medium under inducing conditions (as described in Materials and Methods) to compare the expression yields without and with chaperone co-expression and the SDS-PAGE analyses of cell-free extracts (Figure 1A,B) indicate the production of two recombinant β-galactosidases, EcoliBL21Lhβ-gal and EcoliGROLhβ-gal, respectively. The expressed proteins carry a C-terminal His-Tag encoded by the vector. The highest yield were obtained for both systems, without and with the chaperones, when 1.0 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was used for induction and these yields were 25.8 ± 0.8 kUoNPG per L of medium with a specific activity of 53.7 ± 1.8 U mg−1 for EcoliBL21Lhβ-gal and 13.0 ± 0.5 kUoNPG per L of medium with a specific activity of 17.4 ± 0.7 U mg−1 for EcoliGROLhβ-gal, respectively (Figure 2A). The β-galactosidase activities in non-induced E. coli cells were ~350 UoNPG per L of medium for EcoliBL21Lhβ-gal and negligible (0.71 U per L of medium) for EcoliGROLhβ-gal (data not shown). The expression yield of EcoliBL21Lhβ-gal is significantly lower to the expression level of LacLM-type β-galactosidase from L. reuteri expressed in E. coli, which was previously reported to be 110 kU per L of medium [7]; however, it is considerably higher than the yield obtained for β-galactosidase from L. sakei, which is also of LacLM-type, expressed in E. coli (2.8 kU per L of medium) [11].
Co-expression of the chaperones GroEL/GroES did not show an increase in β-galactosidase activity; in fact, β-galactosidase from L. helveticus expressed in E. coli cells with chaperones showed a four-fold decrease in activity compared to the activity obtained from the E. coli cells without chaperones. We previously reported the expression of two β-galactosidases from Bifidobacterium breve, β-gal I and β-gal II, in E. coli strains with chaperones, which showed remarkable increase in activity, 30-fold and 14-fold, respectively, compared to the activity obtained from the expression without chaperones [25]. The chaperone family GroEL and its co-chaperone GroES are known to play an essential role in mediating protein folding and preventing protein aggregation [26]. However, it is worth to mention that the β-galactosidases from Bifidobacterium breve, β-gal I and β-gal II, are of homodimeric LacZ-type, while β-galactosidase from L. helveticus is of heterodimeric LacLM-type; hence, different folding mechanism might explain our observation that the production of β-galactosidase from L. helveticus in E. coli was not boosted with the co-expression of the chaperones.
The enzyme EcoliBL21Lhβ-gal was purified with a single-step purification using a HisTrap HP column and the specific activity of purified enzyme was determined to be ~167.2 ± 6.4 U mg−1. The cultivation yielded approximately 25.8 kU of EcoliBl21Lhβ-gal per L of medium, corresponding to the formation of roughly 155 mg of recombinant EcoliBl21Lhβ-gal per L of medium and the recombinant β-galactosidase amounted to 32% of the total protein of the host. β-Galactosidase from L. helveticus is encoded by lacLM genes, which compose of overlapping 1,887 bp (628 amino acid residues) of lacL gene and 957 bp (318 amino acid residues) of lacM gene with a total length of 2,827 bp (GenBank accession number AJ512877). β-Galactosidase from L. helveticus is a heterodimer and the apparent molecular masses corresponding to a large subunit (lacL) and a small subunit (lacM) were ~75 and ~35 kDa, respectively, as judged by SDS-PAGE (Figure 3) in comparison to reference proteins. These values are in agreement with molecular masses of 73,480.19 and 35,895.49 Da calculated for lacL subunit and lacM subunit (~109 kDa for lacLM), respectively, based on their DNA sequences.

2.2. Production of Recombinant β-Galactosidases from L. helveticus in L. plantarum

Lactobacilli have frequently been referred to as “probiotics” because of their health promoting effects to the human gastro-intestinal (GI) tract. Some of the much appreciated effects of lactobacilli have been attributed to their ability to modulate the immune response of the host and to control pathogens by affecting the diversity of the microbial flora in the GI-tract. Several lactobacilli are commensals in the GI tract of humans and animals and are also often used in diverse protocols for fermentation and/or preservation of food and feed [27]. Due to their food-grade status and probiotic characteristics, several lactobacilli are considered as safe and effective cell-factories for food-application purposes [28,29]. Lactobacillus plantarum WCFS1 is a well-studied member of the lactobacilli for these purposes. Hence, it was our interest to set out heterologous overexpression of β-galactosidase from L. helveticus in this food-grade organism.
The SDS-PAGE analyses of cell-free extracts (Figure 1C,D) confirm the production of two recombinant β-galactosidases, Lp409Lhβ-gal and Lp609Lhβ-gal. β-Galactosidase activities of the wild-type host strain L. plantarum WCFS1 and the expression strains, L. plantarum WCFS1 and L. plantarum TGL2, carrying the plasmids p409LacLMLh and p609LacLMLh under non-induced conditions, respectively, were not detected. L. plantarum harboring p409lacLMLh, which was constructed based on an erythromycin (ery) based pSIP409 expression vector [30,31] (as described in Materials and Methods), showed the highest enzyme yield of ~2.90 ± 0.05 kUoNPG of β-galactosidase activity per L of medium and the corresponding specific activity of 24.3 ± 1.2 U mg−1 after 6 h of induction (Figure 2B). This yield is somewhat lower when compared with the yields obtained for both LacLM-type and LacZ-type β-galactosidases from lactic acid bacteria. When overexpressing β-galactosidases from L. reuteri (LacLM-type), L. bulgaricus (LacZ-type) and Streptococcus thermophilus (LacZ-type) in the host L. plantarum WCFS1 using pSIP409 expression vectors, the yields obtained were ~29 kU, ~22 kU, and ~11 kU of β-galactosidase activity per liter of culture, respectively [12,13,32]. L. plantarum harboring p609lacLMLh, which was constructed based on p409lacLMLh and pSIP609, a food-grade alanine racemase (alr) based expression vector [32] (as described in Materials and Methods), showed slightly lower expression yield, which was 2.30 kU ± 0.03 kUoNPG of β-galactosidase activity per L of medium (Figure 2B), compared to L. plantarum harboring p409lacLMLh. This obtained yield is 14-fold lower than the amounts of L. reuteri β-galactosidase produced using this alr-based system [32]. Lactobacillal pSIP expression systems are strictly regulated and have been proven to overproduce a number of enzymes in Lactobacillus hosts [30,33,34]. However, a discrepancy between the yields of expressed proteins was observed as discussed above. Despite higher expression in E. coli, the use of the food-grade expression vector (pSIP609) and host organism (L. plantarum) has the potential for the production of food-grade enzyme [32,34] and allows the use of crude β-galactosidases in food and feed applications, hence the enzyme costs can be reduced by avoiding laborious and expensive chromatographic steps for the purification of the biocatalyst.

2.3. Biochemical Characterization

2.3.1. Enzyme Kinetics

The steady-state kinetic parameters of recombinant β-galactosidase from L. helveticus (EcoliBL21Lhβ-gal) determined for the hydrolysis of o-nitrophenyl-β-d-galactopyranoside (oNPG) and lactose are presented in Table 1. The kcat values were calculated on the basis of the theoretical vmax values experimentally evaluated by nonlinear regression and using a molecular mass of 109 kDa for the catalytically active product of lacLM genes. The experiments with oNPG showed substrate inhibition, whereas it was not inhibited by its natural substrate lactose in concentrations of up to 600 mM. Apparently, the hydrolytic potential as well as the affinity of the enzyme for the substrate was found to be far greater with oNPG than with lactose. The catalytic efficiency (kcat/Km) value for oNPG is significantly higher than that of lactose, indicating that oNPG is the better substrate for this enzyme. Interestingly, the Km value of 15.7 mM determined for lactose is lower compared with the Km values reported LacLM-type β-galactosidases from L. pentosus (~38 mM) [10] and L. acidophilus (~29 mM) [8], but comparable to other LacLM-type β-galactosidases such as L. reuteri (~13 mM) [35] and L. sakei (~20 mM) [11]. The lower Km,Lac value for β-galactosidase from L. helveticus suggests the potential use of this enzyme for GOS production and lactose utilization.

2.3.2. Effects of Temperature and pH on Enzyme Activity and Stability

The pH optimum of EcoliBL21Lhβ-gal is pH 6.5 for both oNPG and lactose hydrolysis, and the enzyme exhibits more than 65% of the maximal activity in the pH range of 5.5–8 (Figure 4A). However, the enzyme is most stable at pH 5.5–6.0 with the half-life time (τ1/2) of activity at pH 5.5 and 6.0 were 816 and 552 h, respectively (Table 2). The pH profile of β-galactosidase from L. helveticus showed that it is slightly more active than β-galactosidases from L. reuteri [35] and L. bulgaricus [12] at mildly acidic pH. The enzyme is very unstable at pH below 5 and above 8 (Table 2).
The temperature optimum of EcoliBL21Lhβ-gal are 55 °C and 60 °C for oNPG and lactose hydrolysis, respectively, under standard assay conditions (pH 6.5 for 10 min) (Figure 4B). The long-term storage of the enzyme could be achieved at 4 °C (τ1/2 ∼6 months) (Table 2). The enzyme was inactivated very rapidly at temperatures higher than 50 °C as the residual activity after 5 min of incubation at 60, 70, 80 °C was not detected (data not shown). Thermostability of EcoliBL21Lhβ-gal was significantly improved in the presence of Mg2+. Incubation of the enzyme samples in 50 mM NaPB (pH 6.5) with the presence of 1 mM MgCl2 at 40 °C and 50 °C showed approximately 15-fold and nine-fold increase in the half-life time (τ1/2) of activity, respectively, compared to the samples incubated at the same conditions but without MgCl2 (Table 2). This positive effect of Mg2+ on bacterial β-galactosidases has been demonstrated for both LacLM-type [10,35] and LacZ-type β-galactosidases [12,25,36]. The previous studies on metal-binding sites in the structure of β-galactosidase from E. coli has revealed binding sites for Mg2+, which are located in the direct vicinity of the active site and might take a part in the catalytic mechanism and stabilization of the enzyme [36,37,38]. Since whey from cheese manufacture contains around 1.5 mM Mg2+, the improvement in thermostability of β-galactosidase from L. helveticus in the presence of 1 mM MgCl2 provides an advantage for the industrial production of GOS using technical substrates such as cheese whey or whey permeates [10]. This helps to enhance the performance of the enzyme without the need of applying exogenous Mg2+.

2.3.3. Effects of Various Cations on Enzyme Activity

Various cations were tested with respect to a possible stimulating or inhibitory effect on β-galactosidase activity. These were added in final concentrations of 1–100 mM to the enzyme in Bis-Tris buffer (Table 3). The monovalent cation Na+ slightly activated β-galactosidase activity; only approximately 1.5-fold increase in activity was found in the presence of 1 mM and 10 mM Na+ compared to the enzyme sample where no cation was added. The presence of 1 mM K+ only resulted in a slight activation of the activity, and the enzyme was slightly inhibited in the presence of higher concentrations of K+. Interestingly, stimulating and synergistic effect exists in the presence of 1 mM and 10 mM K+ together with 1 mM Na+, as a two-fold increase in activity was found. The divalent cations Mn2+, Mg2+, Ca2+, Zn2+ and Cu2+ showed inhibitory effects. It might be necessary to reduce the level of free Ca2+ in solution when using lactose-rich substrate such as liquid whey in applications in the dairy industry. However, the application of this enzyme in fluid milk for the production of low-lactose and lactose-free milk should not be an issue because Ca2+ is bound to casein.

2.4. GOS Formation

Both crude enzyme Lp609Lhβ-gal and purified enzyme EcoliBL21Lhβ-gal are more stable in the presence of high lactose concentration, retaining more than 75% and 60% of initial activity, respectively, after 24 h of incubation at 50 °C (data not shown). Thermostabilty of both crude enzyme and Lp609Lhβ-gal and purified enzyme EcoliBL21Lhβ-gal shows the potential of applications of these recombinant β-galactosidases in lactose conversion processes at temperatures up to 50 °C, whereas almost all lactobacillal LacLM-type β-galactosidases can be used in the applications, where the process temperatures can only be as high as 37 °C [7,8,9,10,11]. Figure 5 shows the formation of GOS by recombinant β-galactosidases from L. helveticus, crude enzyme Lp609Lhβ-gal (Figure 5A) and purified enzyme EcoliBL21Lhβ-gal (Figure 5B), as analyzed by thin layer chromatography (TLC) in discontinuous lactose conversion processes at 50 °C using 205 g L−1 initial lactose in 50 mM sodium phosphate buffer (pH 6.5) containing 1 mM MgCl2 and 1.5 ULac mL−1 of recombinant β-galactosidase. A commercial GOS preparation, Vivinal (Friesland Foods Domo), was used for comparison (indicated by V-GOS). The conversion was slower when using crude enzyme Lp609Lhβ-gal than the conversion using purified enzyme EcoliBL21Lhβ-gal as complete hydrolysis was obtained after 7 h and 4 h, respectively (Figure 5A,B). Recombinant β-galactosidases from L. helveticus was found to be a promising candidate for the production of GOS as a spectrum of GOS was formed when compared with V-GOS on TLC. It also can be seen clearly from TLC analysis that the highest GOS yields are obtained after 2 h of conversion using purified enzyme EcoliBL21Lhβ-gal or 4 h when using crude enzyme Lp609Lhβ-gal. As the reactions progress further, GOS are also subjected to hydrolysis when the substrate lactose becomes depleted (Figure 5A,B). Detailed analysis of the GOS mixture and the identification of the individual GOS formed in lactose conversion process using recombinant β-galactosidases from L. helveticus are ongoing in our laboratory.

3. Materials and Methods

3.1. Bacterial Strains and Culture Conditions

The bacterial strains and plasmids used in this study are listed in Table 4. L. helveticus DSM 20075 (ATCC 15009) was obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ; Braunschweig, Germany). Lactobacillus plantarum WCFS1, isolated from human saliva as described by Kleerebezem et al. [39], was originally obtained from NIZO Food Research (Ede, The Netherlands) and maintained in the culture collection of the Norwegian University of Life Sciences, Ås, Norway. Lactobacillus strains were cultivated MRS medium (Roth, Karlsruhe, Germany) at 37 °C without agitation. Escherichia coli NEB5α (New England Biolabs, Ipswich, MA, USA) and E. coli MB2159 (D-alanine auxotrophe) [40] were used as cloning hosts in the transformation of DNA fragments; whereas E. coli BL21 Star DE3 (Invitrogen, Carlsbad, CA, USA) and E. coli T7 Express (Novagen, Darmstadt, Germany) were used as the expression hosts. E. coli strains were grown in Luria-Bertani (LB) medium at 37 °C with shaking at 200 rpm. The antibiotic concentrations were 100 μg/mL ampicillin for E. coli, 10 μg/mL of chloramphenicol (Cm) for both Lactobacillus and E. coli, or 5 μg/mL and 200 μg/mL of erythromycin for Lactobacillus and E. coli, respectively. E. coli MB2159 and L. plantarum TLG02 were cultivated in the respective media supplemented with D-alanine (200 μg/mL).

3.2. Chemicals and Enzymes

All chemicals and enzymes were purchased from Sigma (St. Louis, MO, USA) unless stated otherwise and were of the highest quality available. All restriction enzymes, Phusion high-fidelity DNA polymerase, T4 DNA ligase, and corresponding buffers were from New England Biolabs (Frankfurt am Main, Germany). Staining dyes, DNA and protein standard ladders were from Bio-Rad (Hercules, CA, USA). Isopropyl-β-d-thiogalactopyranoside (IPTG) was from Roth (Karlsruhe, Germany); whereas phenylmethanesulfonyl fluoride (PMSF) was obtained from Fluka (Buchs, Switzerland). Glucose (HK) Assay Kit for the determination of D-glucose was purchased from Megazyme (Bray, Ireland).

3.3. DNA Manipulation

Genomic DNA of L. helveticus DSM 20075 was isolated using GenElute Bacterial Genomic DNA Kit from Sigma (St. Louis, MO, USA) according to the manufacturer’s instructions. The lacLM genes were amplified using Phusion high-fidelity DNA polymerase with the primer pairs FwdNcoI and Rev1XhoI, or FwdNcoI and Rev2XhoI (Table 5), which were designed based on the sequence of β-galactosidase from L. helveticus DSM 20075 with a GenBank accession number AJ512877. The primers were supplied by VBC-Biotech Service (Vienna, Austria) and the appropriate endonuclease restriction sites were introduced in the forward and reverse primers as indicated. The amplified PCR products were purified by the Monarch DNA Gel Extraction Kit (New England Biolabs). When needed, the PCR fragments were subcloned into the pJET1.2 plasmid (CloneJET PCRcloning kit, Fermentas), and E. coli NEB5α was used as a host for obtaining the plasmids in sufficient amounts. The sequence of the insert was confirmed by DNA sequencing performed by a commercial provider (Microsynth, Vienna, Austria).

3.4. Construction of Plasmids and Expression in E. coli

The fragment of lacLM genes, which was amplified with the primer pair FwdNcoI and Rev1XhoI (Table 5), was cloned into the expression vector pET-21d(+) (Novagen, Darmstadt, Germany) using the NcoI and XhoI cloning sites, resulting in the plasmid pET21lacLMLh. The constructed plasmid was transformed into electrocompetent cells of two different hosts, E. coli BL21 Star (DE3) and E. coli T7 Express harboring the plasmid pGRO7, which encodes the chaperones GroEL and GroES (Takara, Shiga, Japan), to compare the expression levels.
The expression levels of β-gal without and with co-expression of the chaperones GroEL and GroES were compared. To this end, E. coli BL21 Star (DE3) harboring the plasmid pET21lacLMLh was grown in 100 mL of LB broth containing 100 μg/mL ampicillin at 37 °C to an OD600 of 0.6. Isopropyl-β-d-thiogalactopyranoside (IPTG) was then added to the culture medium and the cultures were incubated further at 25 °C for 12 h. Different induction conditions were compared by varying the concentrations of isopropyl-β-d-thiogalactopyranoside (IPTG) (0.1, 0.5 and 1 mM) in LB medium. E. coli T7 express GRO cells carrying the plasmid pET21lacLMLh was grown as described previously [25]. E. coli T7 express GRO cells carrying the plasmid pET21lacLMLh were grown at 37 °C in 100 mL LB medium containing 100 µg mL−1 ampicillin, 20 µg mL−1 chloramphenicol and 1 mg mL−1 L-arabinose until OD600nm of 0.8 was reached. IPTG (1 mM) was then added into the culture, and the culture was incubated further at 18 °C. The cultures were harvested by centrifugation (4000 g, 4 °C for 15 min), washed twice and resuspended in 0.5 mL of 50 mM sodium phosphate buffer (NaPB), pH 6.5. Cells were disrupted on ice by sonication (Bandelin Sonopuls HD60, Berlin, Germany). The crude recombinant enzymes from E. coli BL21 Star (DE3) (EcoliBL21Lhβ-gal) and E. coli T7 Express GRO (EcoliGROLhβ-gal) were obtained after centrifugation (10,000× g for 15 min at 4 °C) and tested for β-galactosidase activity using the standard enzyme assays and protein concentrations.

3.5. Construction of Plasmids and Expression in L. plantarum

The fragment of lacLM genes, which was amplified with the primer pair FwdNcoI and Rev2XhoI (Table 5), was cloned into the lactobacillal expression vector pSIP409 using the NcoI and XhoI cloning sites, resulting in the plasmid p409lacLMLh. The ~3.0 kb of BglII-XhoI fragment of p409LacLMLh containing the fragment of lacLM genes was ligated into the ~5.8 BglII-XhoI digested fragment of pSIP609 yielding the plasmid p609lacLMLh (Figure 6). The plasmids p409lacLMLh and p609lacLMLh were constructed in E. coli NEB5α and MB2159, respectively, before being transformed into the expression hosts, L. plantarum WCFS1 and the D-alanine auxotroph L. plantarum TLG02, respectively. The overexpression of β-gal was performed as described previously [12]. Overnight cultures of L. plantarum carrying the plasmids p409LacLMLh and p609LacLMLh, respectively, were inoculated into 500 mL of MRS broth (for erm-based vector p409LacLMLh 5 μg/mL erythromycin was added) to an OD600 of ~0.1. The cultures were incubated at 30 °C to an OD600 of 0.3 prior to induction with an inducing peptide pheromone IP-673 to a final concentration of 25 ng/mL. Cells were harvested at OD600nm of 1.8 to 2.0. The cells were harvested by centrifugation (4000 g, 4 °C for 15 min), washed twice and resuspended in 0.5 mL of 50 mM sodium phosphate buffer (NaPB), pH 6.5. Cells were disrupted on ice by sonication (Bandelin Sonopuls HD60, Berlin, Germany). The crude recombinant enzymes from L. plantarum WCFS1, Lp409Lhβ-gal, and L. plantarum TLG02, Lp609Lhβ-gal, were obtained after centrifugation (10,000× g for 15 min at 4 °C) and tested for β-galactosidase activity using the standard enzyme assays and protein concentrations.

3.6. Fermentation and Purification of Recombinant β-Galactosidase

To obtain sufficient amount of enzyme for further characterization, E. coli BL21 Star (DE3) carrying the plasmid pET21lacLMLh was cultivated in 300 mL LB medium containing 100 µg mL−1 ampicillin at 37 °C in HT-Multifors fermentor (Infors HT, Bottmingen, Switzerland). The cultivation conditions and the induction protocol were identical to those described above for small-scale cultivations. Expression of lacLM was induced at OD600 of 0.6, the cells were harvested at OD600 ~6 and washed twice with 50 mM NaPB (pH 6.5), resuspended in the same buffer containing 1 mM PMSF and disrupted using a French press (Aminco, Silver Spring, MD, USA). Cell debris was removed by centrifugation (250,000× g for 30 min at 4 °C).
EcoliBL21Lhβ-gal was purified using a prepacked 1 mL HisTrap HP Ni-immobilized metal ion affinity chromatography (IMAC) column (GE Healthcare, Uppsala, Sweden). Crude enzyme was loaded on the column that was pre-equilibrated with buffer A (20 mM NaPB, 20 mM imidazole, 500 mM NaCl, pH 6.5). The His-tagged protein was eluted at a rate of 1 mL min−1 with a 15 mL linear gradient from 0 to 100% buffer B (20 mM NaPB, 500 mM imidazole, 500 mM NaCl, pH 6.5). Active fractions were collected, desalted and concentrated by ultrafiltration using an Amicon Ultra Centrifugal Filter Unit with a 30 kDa cut-off membrane (Millipore, MA, USA). The purified EcoliBL21Lhβ-gal was stored in 50 mM NaPB (pH 6.5) at 4 °C for further characterization.

3.7. Gel electrophoresis Analysis

The purity and the molecular masses of recombinant β-galactosidase EcoliBL21Lhβ-gal was determined by SDS-PAGE, in which the enzyme (~1 mgprotein mL−1) was incubated with Laemmli buffer at 90 °C for 5 min. Protein bands were visualized by staining with Bio-safe Coomassie (Bio-Rad). The determination of protein mass was carried out using Unstained Precision plus Protein Standard (Bio-Rad).

3.8. β-Galactosidase Assays

β-Galactosidase activity was determined using o-nitrophenyl-β-d-galactopyranoside (oNPG) or lactose as the substrates as previously described [7]. When chromogenic substrate oNPG was used, the reaction was started by adding 20 μL of enzyme solution to 480 μL of 22 mM oNPG in 50 mM NaBP (pH 6.5) and stopped by adding 750 μL of 0.4 M Na2CO3 after 10 min of incubation at 30 °C. The release of o-nitrophenol (oNP) was measured by determining the absorbance at 420 nm. One unit of oNPG activity referred to the amount of β-galactosidase liberating 1 μmol of oNP per minute under the defined conditions.
When the natural substrate lactose was used, 20 μL of enzyme solution was added to 480 μL of 600 mM lactose solution in 50 mM NaBP (pH 6.5). The reaction was stopped after 10 min of incubation at 30 °C by heating the reaction mixture at 99 °C for 5 min. After being cooled to room temperature, the release of D-glucose in the reaction mixture was determined using Glucose (HK) Assay Kit (Megazyme) according to the manufacturer’s instructions. One unit of lactase activity referred to the amount of β-galactosidase liberating 1 μmol of D-glucose per minute under the defined condition.

3.9. Determination of Protein Concentration

Protein concentrations were determined using the method of Bradford [41] with bovine serum albumin (BSA) as a standard.

3.10. Biochemical Characterization of Recombinant β-Galactosidases

All steady-state kinetic measurements using oNPG and lactose as the substrates were conducted in 50 mM NaPB (pH 6.5) at 30 °C, with concentrations ranging from 0.5 to 22 mM for oNPG and from 1 to 600 mM for lactose, respectively. The kinetic parameters were calculated by nonlinear regression, in which the observed data were fit to the Henri-Michaelis-Menten equation using data analysis software (SigmaPlot, SPSS, Chicago, IL, USA).
The dependence of enzyme activity on pH and temperature was evaluated by performing the enzyme assays using oNPG and lactose as the substrates under the specified conditions. The pH dependency test was conducted in Britton-Robinson buffer (mixture of 20 mM each of acetic, phosphoric and boric acids adjusted with 1 M NaOH to the desired pH) with the pH range of 4–9 at 30 °C, while the temperature dependency test was conducted in 50 mM NaPB (pH 6.5) at the temperature range of 20–80 °C. The pH stability was determined by incubating the enzyme at various pH values (pH 4–9) using Britton-Robinson buffer at 30 °C. At certain time intervals, samples were withdrawn. The residual oNPG activity was measured, and the half-life (τ1/2) value of pH inactivation was obtained when the residual oNPG activity decreases to 50% of its initial value. The thermostability was determined by incubating the recombinant enzyme in 50 mM NaPB (pH 6.5) at various temperatures ranging from 4–80 °C. The effect of magnesium ion (Mg2+) on thermostability of the enzyme was investigated by incubating the enzyme in the presence of 1 mM MgCl2 at 40 and 50 °C. The residual oNPG activity was measured at certain time intervals, and τ1/2 value was determined.
To study the effect of various cations on the release of oNP from oNPG, the enzyme samples were assayed with 22 mM oNPG in 10 mM Bis-Tris (pH 6.5) in the presence of various cations with final concentrations of 1.0, 10, and 100 mM (chloride or sulfate form), at 30 °C for 10 min. The measured activities were compared with the activity of the enzyme solution without added cations under the same conditions.

3.11. Formation of Galacto-Oligosaccharides (GOS)

The formation of GOS was carried out in discontinuous mode using recombinant β-galactosidases from L. helveticus, crude enzyme Lp609Lhβ-gal and purified enzyme EcoliBL21Lhβ-gal. Reaction conditions were 205 g L−1 initial lactose concentration in 50 mM phosphate buffer (pH 6.5) at 50 °C, 1.5 ULac per mL of reaction mixture and constant agitation (300 rpm). Samples were withdrawn at intervals and the GOS mixtures formed were analyzed by thin layer chromatography (TLC). TLC was carried out using high-performance TLC silica plates (Kieselgel 60 F245, Merck). An appropriately diluted sample containing ~20 g L−1 sugar was applied to the plate (1.0 µL) and eluted twice in ascending mode with an n-butanol/n-propanol/ethanol/water mixture (2/3/3/2). Thymol reagent was used for detection.

3.12. Statistical Analysis

All experiments and measurements were conducted at least in duplicate, and the percentage error was always less than 5%.

4. Conclusions

β-Galactosidase encoding genes lacLM from an industrially important organism L. helveticus DSM 20075 were cloned and successfully overexpressed in E. coli and L. plantarum using different expression systems. Although the co-expression of the chaperones GroEL/GroES did not show an increase in expression levels, the expression of this LacLM-type β-galactosidase was greatly enhanced through recombinant production in E. coli. The expression in the L. plantarum using food-grade expression vector shows the potential for the production of food-grade enzyme for applications in the dairy industry. The detailed information on the properties of recombinant β-galactosidase from L. helveticus provided in the present study can serve as the basis for the applications of this biotechnologically attractive enzyme. This enzyme exhibited high transgalactosylation activity and revealed interesting properties for applications in lactose conversion and GOS formation processes. Currently, we are working on the synthesis of GOS using β-galactosidase from L. helveticus and the identification of the GOS formed.

Author Contributions

Conceptualization, T.-H.N.; Data curation, T.-H.N. and S.K.; Formal analysis, S.K.; Investigation, S.K., M.-L.P. and A.-M.T.; Methodology, T.-H.N.; Supervision, T.-H.N.; Writing—original draft, S.K.; Writing—review & editing, T.-H.N.

Funding

S.K. and A.M.T. are thankful for the Ernst Mach—ASEA Uninet scholarships granted by the OeAD—Austrian Agency for International Cooperation in Education & Research and financed by the Austrian Federal Ministry of Science, Research and Economy. M.L.P. thanks the European Commission for the Erasmus Mundus scholarship under the ALFABET project. T.H.N. acknowledges the support from Austrian Science Fund (FWF Project V457-B22).

Acknowledgments

The authors thank Apinun Kanpiengjai (Chiang Mai University, Thailand) and Chatthaphisuth Sanchart (Prince of Songkla University, Thailand) for their assistance to S.K. in some experimental work of this research.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ljungh, A.; Wadström, T. Lactic acid bacteria as probiotics. Curr. Issues Intest. Microbiol. 2006, 7, 73–89. [Google Scholar] [PubMed]
  2. Nagpal, R.; Kumar, A.; Kumar, M.; Behare, P.V.; Jain, S.; Yadav, H. Probiotics, their health benefits and applications for developing healthier foods: A review. FEMS Microbiol. Lett. 2012, 334, 1–15. [Google Scholar] [CrossRef]
  3. Gatti, M.; Trivisano, C.; Fabrizi, E.; Neviani, E.; Gardini, F. Biodiversity among Lactobacillus helveticus strains isolated from different natural whey starter cultures as revealed by classification trees. Appl. Environ. Microbiol. 2004, 70, 182–190. [Google Scholar] [CrossRef] [PubMed]
  4. Fortina, M.G.; Ricci, G.; Mora, D.; Guglielmetti, S.; Manachini, P.L. Unusual organization for lactose and galactose gene clusters in Lactobacillus helveticus. Appl. Environ. Microbiol. 2003, 69, 3238–3243. [Google Scholar] [CrossRef] [PubMed]
  5. de Macías, M.E.; Manca de Nadra, M.C.; Strasser de Saad, A.M.; Pesce de Ruiz Holgado, A.A.; Oliver, G. Isolation and properties of β-galactosidase of a strain of Lactobacillus helveticus isolated from natural whey starter. J. Appl. Biochem. 1983, 5, 275–281. [Google Scholar]
  6. Mollet, B.; Pilloud, N. Galactose utilization in Lactobacillus helveticus: Isolation and characterization of the galactokinase (galK) and galactose-1-phosphate uridyl transferase (galT) genes. J. Bacteriol. 1991, 173, 4464–4473. [Google Scholar] [CrossRef] [PubMed]
  7. Nguyen, T.H.; Splechtna, B.; Yamabhai, M.; Haltrich, D.; Peterbauer, C. Cloning and expression of the β-galactosidase genes from Lactobacillus reuteri in Escherichia coli. J. Biotechnol. 2007, 129, 581–591. [Google Scholar] [CrossRef]
  8. Nguyen, T.H.; Splechtna, B.; Krasteva, S.; Kneifel, W.; Kulbe, K.D.; Divne, C.; Haltrich, D. Characterization and molecular cloning of a heterodimeric β-galactosidase from the probiotic strain Lactobacillus acidophilus R22. FEMS Microbiol. Lett. 2007, 269, 136–144. [Google Scholar] [CrossRef]
  9. Iqbal, S.; Nguyen, T.H.; Nguyen, T.T.; Maischberger, T.; Haltrich, D. β-galactosidase from Lactobacillus plantarum WCFS1: Biochemical characterization and formation of prebiotic galacto-oligosaccharides. Carbohydr. Res. 2010, 345, 1408–1416. [Google Scholar] [CrossRef]
  10. Maischberger, T.; Leitner, E.; Nitisinprasert, S.; Juajun, O.; Yamabhai, M.; Nguyen, T.H.; Haltrich, D. β-Galactosidase from Lactobacillus pentosus: Purification, characterization and formation of galacto-oligosaccharides. Biotechnol. J. 2010, 5, 838–847. [Google Scholar] [CrossRef]
  11. Iqbal, S.; Nguyen, T.H.; Nguyen, H.A.; Nguyen, T.T.; Maischberger, T.; Kittl, R.; Haltrich, D. Characterization of a heterodimeric GH2 β-galactosidase from Lactobacillus sakei Lb790 and formation of prebiotic galacto-oligosaccharides. J. Agric. Food Chem. 2011, 59, 3803–3811. [Google Scholar] [CrossRef] [PubMed]
  12. Nguyen, T.T.; Nguyen, H.A.; Arreola, S.L.; Mlynek, G.; Djinović-Carugo, K.; Mathiesen, G.; Nguyen, T.H.; Haltrich, D. Homodimeric β-galactosidase from Lactobacillus delbrueckii subsp. bulgaricus DSM 20081: Expression in Lactobacillus plantarum and biochemical characterization. J. Agric. Food Chem. 2012, 60, 1713–1721. [Google Scholar] [CrossRef] [PubMed]
  13. Geiger, B.; Nguyen, H.M.; Wenig, S.; Nguyen, H.A.; Lorenz, C.; Kittl, R.; Mathiesen, G.; Eijsink, V.G.H.; Haltrich, D.; Nguyen, T.H. From by-product to valuable components: Efficient enzymatic conversion of lactose in whey using β-galactosidase from Streptococcus thermophilus. Biochem. Eng. J. 2016, 116, 45–53. [Google Scholar] [CrossRef] [PubMed]
  14. Vaillancourt, K.; Moineau, S.; Frenette, M.; Lessard, C.; Vadeboncoeur, C. Galactose and lactose genes from the galactose-positive bacterium Streptococcus salivarius and the phylogenetically related galactose-negative bacterium Streptococcus thermophilus: Organization, sequence, transcription, and activity of the gal gene products. J. Bacteriol. 2002, 184, 785–793. [Google Scholar] [PubMed]
  15. Nakayama, T.; Amachi, T. β-Galactosidase, enzymology. In Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis, and Bioseparation; Flickinger, M.C., Drew, S.W., Eds.; John Willey and Sons: New York, NY, USA, 1999; Volume 3, pp. 1291–1305. [Google Scholar]
  16. Pivarnik, L.F.; Senegal, A.G.; Rand, A.G. Hydrolytic and transgalactosylic activities of commercial β-galactosidase (lactase) in food processing. Adv. Food Nutr. Res. 1995, 38, 1–102. [Google Scholar] [PubMed]
  17. Prenosil, J.E.; Stuker, E.; Bourne, J.R. Formation of oligosaccharises during enzymatic lactose hydrolysis: Part I: State of art. Biotechnol. Bioeng. 1987, 30, 1019–1025. [Google Scholar] [CrossRef] [PubMed]
  18. Nath, A.; Mondal, S.; Chakraborty, S.; Bhattacharjee, C.; Chowdhury, R. Production, purification, characterization, immobilization, and application of β-galactosidase: A review. Asia-Pac. J. Chem. Eng 2014, 9, 330–348. [Google Scholar] [CrossRef]
  19. Husain, Q. β-Galactosidases and their potential applications: A review. Crit. Rev. Biotechnol. 2010, 30, 41–62. [Google Scholar] [CrossRef]
  20. Petzelbauer, I.; Zeleny, R.; Reiter, A.; Kulbe, K.D.; Nidetzky, B. Development of an ultra-high-temperature process for the enzymatic hydrolysis of lactose: II. Oligosaccharide formation by two thermostable β-glycosidases. Biotechnol. Bioeng. 2000, 69, 140–149. [Google Scholar] [CrossRef]
  21. Roberfroid, M.; Gibson, G.R.; Hoyles, L.; McCartney, A.L.; Rastall, R.; Rowland, I.; Wolvers, D.; Watzl, B.; Szajewska, H.; Stahl, B.; et al. Prebiotic effects: Metabolic and health benefits. Br. J. Nutr. 2010, 104, S1–S63. [Google Scholar] [CrossRef]
  22. Gibson, G.R.; Probert, H.M.; Loo, J.V.; Rastall, R.A.; Roberfroid, M.B. Dietary modulation of the human colonic microbiota: Updating the concept of prebiotics. Nutr. Res. Rev. 2004, 17, 259–275. [Google Scholar] [CrossRef] [PubMed]
  23. Sangwan, V.; Tomar, S.K.; Singh, R.R.B.; Singh, A.K.; Ali, B. Galactooligosaccharides: Novel components of designer foods. J. Food Sci. 2011, 76, R103–R111. [Google Scholar] [CrossRef] [PubMed]
  24. De Man, J.C.; Rogosa, M.; Sharpe, M.E. A medium for the cultivation of lactobacilli. J. Appl. Bacteriol. 1960, 23, 130–135. [Google Scholar] [CrossRef]
  25. Arreola, S.L.; Intanon, M.; Suljic, J.; Kittl, R.; Pham, N.H.; Kosma, P.; Haltrich, D.; Nguyen, T.H. Two β-galactosidases from the human isolate Bifidobacterium breve DSM 20213: Molecular cloning and expression, biochemical characterization and synthesis of galacto-oligosaccharides. PLoS ONE 2014, 9, e104056. [Google Scholar] [CrossRef] [PubMed]
  26. Wang, L.; Watzlawick, H.; Fridjonsson, O.; Hreggvidsson, G.; Altenbuchner, J. Improved soluble expression of the gene encoding amylolytic enzyme Amo45 by fusion with the mobile-loop-region of co-chaperonin GroES in Escherichia coli. Biocatal. Biotransfor. 2013, 31, 335–342. [Google Scholar] [CrossRef]
  27. Klaenhammer, T.R. Functional activities of Lactobacillus probiotics: Genetic mandate. Int. Dairy. J. 1998, 8, 497–505. [Google Scholar] [CrossRef]
  28. De Vos, W.M. Gene expression systems for lactic acid bacteria. Curr. Opin. Microbiol. 1999, 2, 289–295. [Google Scholar] [CrossRef]
  29. Kuipers, O.P.; De Ruyter, P.G.G.A.; Kleerebezem, M.; De Vos, W.M. Controlled overproduction of proteins by lactic acid bacteria. Trends Biotechnol. 1997, 15, 135–140. [Google Scholar] [CrossRef]
  30. Sørvig, E.; Mathiesen, G.; Naterstad, K.; Eijsink, V.G.H.; Axelsson, L. High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors. Microbiology 2005, 151, 2439–2449. [Google Scholar] [CrossRef]
  31. Halbmayr, E.; Mathiesen, G.; Nguyen, T.H.; Maischberger, T.; Peterbauer, C.K.; Eijsink, V.G.H.; Haltrich, D. High-level expression of recombinant β-galactosidases in Lactobacillus plantarum and Lactobacillus sakei using a sakacin p-based expression system. J. Agric. Food Chem. 2008, 56, 4710–4719. [Google Scholar] [CrossRef]
  32. Nguyen, T.T.; Mathiesen, G.; Fredriksen, L.; Kittl, R.; Nguyen, T.H.; Eijsink, V.G.H.; Haltrich, D.; Peterbauer, C.K. A food-grade system for inducible gene expression in Lactobacillus plantarum using an alanine racemase-encoding selection marker. J. Agric. Food Chem. 2011, 59, 5617–5624. [Google Scholar] [CrossRef] [PubMed]
  33. Sørvig, E.; Grönqvist, S.; Naterstad, K.; Mathiesen, G.; Eijsink, V.G.H.; Axelsson, L. Construction of vectors for inducible gene expression in Lactobacillus sakei and L. plantarum. FEMS Microbiol. Lett. 2003, 229, 119–126. [Google Scholar] [CrossRef]
  34. Staudigl, P.; Haltrich, D.; Peterbauer, C.K. L-Arabinose isomerase and D-xylose isomerase from Lactobacillus reuteri: Characterization, coexpression in the food grade host Lactobacillus plantarum, and application in the conversion of D-galactose and D-glucose. J. Agric. Food Chem. 2014, 62, 1617–1624. [Google Scholar] [CrossRef] [PubMed]
  35. Nguyen, T.H.; Splechtna, B.; Steinböck, M.; Kneifel, W.; Lettner, H.P.; Kulbe, K.D.; Haltrich, D. Purification and characterization of two novel β-galactosidases from Lactobacillus reuteri. J. Agric. Food Chem. 2006, 54, 4989–4998. [Google Scholar] [CrossRef] [PubMed]
  36. Juers, D.H.; Rob, B.; Dugdale, M.L.; Rahimzadeh, N.; Giang, C.; Lee, M.; Matthews, B.W.; Huber, R.E. Direct and indirect roles of His-418 in metal binding and in the activity of β-galactosidase (E. coli). Protein Sci. 2009, 18, 1281–1292. [Google Scholar] [CrossRef] [PubMed]
  37. Juers, D.H.; Jacobson, R.H.; Wigley, D.; Zhang, X.J.; Huber, R.E.; Tronrud, D.E.; Matthews, B.W. High resolution refinement of β-galactosidase in a new crystal form reveals multiple metal-binding sites and provides a structural basis for alpha-complementation. Protein Sci. 2000, 9, 1685–1699. [Google Scholar] [CrossRef] [PubMed]
  38. Edwards, R.A.; Jacobson, A.L.; Huber, R.E. Thermal denaturation of β-galactosidase and of two site-specific mutants. Biochemistry 1990, 29, 11001–11008. [Google Scholar] [CrossRef] [PubMed]
  39. Kleerebezem, M.; Boekhorst, J.; van Kranenburg, R.; Molenaar, D.; Kuipers, O.P.; Leer, R.; Tarchini, R.; Peters, S.A.; Sandbrink, H.M.; Fiers, M.W.; et al. Complete genome sequence of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sci. USA 2003, 100, 1990–1995. [Google Scholar] [CrossRef]
  40. Strych, U.; Penland, R.L.; Jimenez, M.; Krause, K.L.; Benedik, M.J. Characterization of the alanine racemases from two Mycobacteria. FEMS Microbiol. Lett. 2001, 196, 93–98. [Google Scholar] [CrossRef] [Green Version]
  41. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
Ijms 20 00947 g001a 550Ijms 20 00947 g001b 550
Figure 1. SDS-PAGE analysis of cell-free extract of crude Escherichia coli BL21 Star (DE3) (A), E. coli T7 Express containing the plasmid pGRO7 (B), Lactobacillus plantarum WCFS1 (C) and L. plantarum TLG02 (D) overexpressing β-galactosidase from Lactobacillus helveticus DSM 20075. E. coli BL21 Star (DE3) and T7 Express GRO carrying the plasmid pET21lacLMLh were cultivated in 300 mL LB medium; whereas L. plantarum WCFS1 and L. plantarum TLG02 harboring the plasmids p409lacLMLh and p609lacLMLh, respectively, were cultivated in 500 mL MRS at 30 °C. The cultivation and induction conditions are as described in Materials and Methods and samples were taken at different time points during cultivations (non-induced cultures) and after induction during cultivations (induced cultures). The arrows indicate the LacL and LacM subunits of the recombinant β-galactosidase. M denotes the Precision protein ladder (Biorad, CA, USA).
Figure 1. SDS-PAGE analysis of cell-free extract of crude Escherichia coli BL21 Star (DE3) (A), E. coli T7 Express containing the plasmid pGRO7 (B), Lactobacillus plantarum WCFS1 (C) and L. plantarum TLG02 (D) overexpressing β-galactosidase from Lactobacillus helveticus DSM 20075. E. coli BL21 Star (DE3) and T7 Express GRO carrying the plasmid pET21lacLMLh were cultivated in 300 mL LB medium; whereas L. plantarum WCFS1 and L. plantarum TLG02 harboring the plasmids p409lacLMLh and p609lacLMLh, respectively, were cultivated in 500 mL MRS at 30 °C. The cultivation and induction conditions are as described in Materials and Methods and samples were taken at different time points during cultivations (non-induced cultures) and after induction during cultivations (induced cultures). The arrows indicate the LacL and LacM subunits of the recombinant β-galactosidase. M denotes the Precision protein ladder (Biorad, CA, USA).
Ijms 20 00947 g001aIjms 20 00947 g001b
Ijms 20 00947 g002 550
Figure 2. Time course of the cultivations of (A) E. coli BL21 Star (DE3) and E. coli T7 Express containing the plasmid pGRO7 and (B) L. plantarum WCFS1 and L. plantarum TLG02 overexpressing β-galactosidase from L. helveticus DSM 20075, resulting in the recombinant β-galactosidases EcoliBL21Lhβ-gal, EcoliGROLhβ-gal, Lp409Lhβ-gal and Lp609Lhβ-gal, respectively. All data points represent the average value from two independent experiments, and the percentage error was always less than 5%.
Figure 2. Time course of the cultivations of (A) E. coli BL21 Star (DE3) and E. coli T7 Express containing the plasmid pGRO7 and (B) L. plantarum WCFS1 and L. plantarum TLG02 overexpressing β-galactosidase from L. helveticus DSM 20075, resulting in the recombinant β-galactosidases EcoliBL21Lhβ-gal, EcoliGROLhβ-gal, Lp409Lhβ-gal and Lp609Lhβ-gal, respectively. All data points represent the average value from two independent experiments, and the percentage error was always less than 5%.
Ijms 20 00947 g002
Ijms 20 00947 g003 550
Figure 3. SDS-PAGE analysis of crude and purified β-galactosidase (lacLM) from L. helveticus DSM 20075 overexpressed in E. coli BL21 Star (DE3) and L. plantarum WCFS1. Lane 1, whole-cell lysates of E. coli BL21 Star (DE3) carrying the plasmid pET21lacLMLh with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) induction at 25 °C for 18 h; lane 2, whole-cell lysates of L. plantarum WCFS1 containing p409lacLMLh with 25 ng/mL inducing peptide pheromone IP-673 at 30 °C for 8 h; lane 3, purified recombinant β-galactosidase EcoliBL21Lhβ-gal. The arrows indicate the LacL and LacM subunits of the recombinant β-galactosidase. M denotes the Precision protein ladder (Biorad, CA, USA).
Figure 3. SDS-PAGE analysis of crude and purified β-galactosidase (lacLM) from L. helveticus DSM 20075 overexpressed in E. coli BL21 Star (DE3) and L. plantarum WCFS1. Lane 1, whole-cell lysates of E. coli BL21 Star (DE3) carrying the plasmid pET21lacLMLh with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) induction at 25 °C for 18 h; lane 2, whole-cell lysates of L. plantarum WCFS1 containing p409lacLMLh with 25 ng/mL inducing peptide pheromone IP-673 at 30 °C for 8 h; lane 3, purified recombinant β-galactosidase EcoliBL21Lhβ-gal. The arrows indicate the LacL and LacM subunits of the recombinant β-galactosidase. M denotes the Precision protein ladder (Biorad, CA, USA).
Ijms 20 00947 g003
Ijms 20 00947 g004a 550Ijms 20 00947 g004b 550
Figure 4. pH optimum (A) and temperature optimum (B) of recombinant β-galactosidase EcoliBL21Lhβ-gal using oNPG and lactose as the substrates. Relative activities are given in comparison to the maximum activities measured under optimal conditions (100%). All data points represent the average value from two independent experiments, and the percentage error was always less than 5%.
Figure 4. pH optimum (A) and temperature optimum (B) of recombinant β-galactosidase EcoliBL21Lhβ-gal using oNPG and lactose as the substrates. Relative activities are given in comparison to the maximum activities measured under optimal conditions (100%). All data points represent the average value from two independent experiments, and the percentage error was always less than 5%.
Ijms 20 00947 g004aIjms 20 00947 g004b
Ijms 20 00947 g005 550
Figure 5. Hydrolysis of lactose catalyzed by recombinant β-galactosidases from L. helveticus, (A) crude enzyme Lp609Lhβ-gal and (B) purified EcoliBL21Lhβ-gal, as analyzed by thin layer chromatography (TLC) on pre-activated silica plates (eluent n-butanol/n-propanol/ethanol/water mixture: 2/3/3/2). The reactions were carried out at 50 °C with an initial lactose concentration of 205 g L−1 in 50 mM sodium phosphate buffer (pH 6.5) containing 1 mM MgCl2 and 1.5 ULac mL−1 of recombinant β-galactosidase. The samples were taken at regular time intervals during the reactions. A commercially available GOS preparation, Vivinal (Friesland Foods Domo), was added for comparison (indicated by V-GOS). A standard mixture of lactose (Lac), glucose (Glc) and galactose (Gal) was used as standards.
Figure 5. Hydrolysis of lactose catalyzed by recombinant β-galactosidases from L. helveticus, (A) crude enzyme Lp609Lhβ-gal and (B) purified EcoliBL21Lhβ-gal, as analyzed by thin layer chromatography (TLC) on pre-activated silica plates (eluent n-butanol/n-propanol/ethanol/water mixture: 2/3/3/2). The reactions were carried out at 50 °C with an initial lactose concentration of 205 g L−1 in 50 mM sodium phosphate buffer (pH 6.5) containing 1 mM MgCl2 and 1.5 ULac mL−1 of recombinant β-galactosidase. The samples were taken at regular time intervals during the reactions. A commercially available GOS preparation, Vivinal (Friesland Foods Domo), was added for comparison (indicated by V-GOS). A standard mixture of lactose (Lac), glucose (Glc) and galactose (Gal) was used as standards.
Ijms 20 00947 g005
Ijms 20 00947 g006 550
Figure 6. Expression vectors for lacLM from L. helveticus DSM 20075 in L. plantarum based on the erythromycin resistance gene (erm) [31] (A) and the alanine racemase gene (alr) [32] (B) as selection markers. sppK and sppR, denoting a histidine kinase and a response regulator, respectively, are regulated by PsppIP. Overlapping genes lacLM from L. helveticus are controlled by the inducible promoter PsppQ (pSIP409 derivatives).
Figure 6. Expression vectors for lacLM from L. helveticus DSM 20075 in L. plantarum based on the erythromycin resistance gene (erm) [31] (A) and the alanine racemase gene (alr) [32] (B) as selection markers. sppK and sppR, denoting a histidine kinase and a response regulator, respectively, are regulated by PsppIP. Overlapping genes lacLM from L. helveticus are controlled by the inducible promoter PsppQ (pSIP409 derivatives).
Ijms 20 00947 g006
Table
Table 1. Kinetic parameters of recombinant β-galactosidase from L. helveticus (EcoliBL21Lhβ-gal) for the hydrolysis of o-nitrophenyl-β-d-galactopyranoside (oNPG) and lactose.
Table 1. Kinetic parameters of recombinant β-galactosidase from L. helveticus (EcoliBL21Lhβ-gal) for the hydrolysis of o-nitrophenyl-β-d-galactopyranoside (oNPG) and lactose.
SubstrateMethod for Determination of β-Galactosidase ActivityKinetic ParameterEcoliBL21Lhβ-Gal
oNPGRelease of oNPvmax,oNP (μmol min−1 mg−1)476 ± 66
Km,oNPG (mM)1.40 ± 0.30
kcat (s−1)865 ± 120
kcat/Km (mM−1 s−1)618
Ki,s (mM)3.6 ± 0.8
LactoseRelease of D-glucosevmax,Glucose (μmol min−1 mg−1)11.1 ± 0.2
Km,Lactose (mM)15.7 ± 1.3
kcat (s−1)20.2 ± 0.3
kcat/Km (mM−1 s−1)1.29
Table
Table 2. Effect of pH (A) a and temperature (B) b on catalytic stability of recombinant β-galactosidase from L. helveticus expressed in E. coli (EcoliBL21Lhβ-gal).
Table 2. Effect of pH (A) a and temperature (B) b on catalytic stability of recombinant β-galactosidase from L. helveticus expressed in E. coli (EcoliBL21Lhβ-gal).
(A)pHτ1/2c (h)(B)Temperature (°C)τ1/2 (h)
4.01 46 months
5.08 202 months
5.5816 30216
6.0552 405
6.5144 500.33
7.048 40 (+1 mM MgCl2)72
8.01 50 (+1 mM MgCl2)3
9.00.5
a The pH stability was determined by incubating the enzyme at various pH values (pH 4–9) using Britton-Robinson buffer at 30 °C. b Temperature stability was determined by incubating the recombinant enzyme in 50 mM NaPB (pH 6.5) at various temperatures ranging from 4–80 °C. c The values for half-life time of activity (τ1/2) were calculated as the mean of two independent experiments, and the percentage error was always less than 5%.
Table
Table 3. Effect of various cations on activity of recombinant β-galactosidase from L. helveticus expressed in E. coli (EcoliBL21Lhβ-gal).
Table 3. Effect of various cations on activity of recombinant β-galactosidase from L. helveticus expressed in E. coli (EcoliBL21Lhβ-gal).
CationRelative Activity (%)
1 mM10 mM100 mM
None100100100
Na+160142109
K+1189668
K+ a,c204204nd
Mn2+ a,c143105nd
Mg2+ a,c152117nd
Ca2+ a,c14080nd
Cu2+ b,c177nd
Zn2+ a,c12078nd
a added as chloride salt; b added as sulfate salt; c the reaction was performed in the presence of 1 mM Na+; nd, not determined.
Table
Table 4. Strains and plasmids used for cloning and overexpression of β-galactosidase encoding genes lacLM from L. helveticus a.
Table 4. Strains and plasmids used for cloning and overexpression of β-galactosidase encoding genes lacLM from L. helveticus a.
Strain or PlasmidRelevant CharacteristicsReference
Strains
L. helveticus DSM 20075source of lacLM genesDSMZ (Braunschweig, Germany)
L. plantarum WCFS1wild-type, expression host[39]
L. plantarum TLG02Δalr, D-alanine auxotroph, expression host[32]
E. coli NEB5αcloning hostNew England Biolabs (Ipswich, MA)
E. coli MB2159D-alanine auxotroph, cloning host[40]
E. coli BL21 Star DE3expression hostInvitrogen (Carlsbad, CA)
E. coli T7 Expressexpression hostNovagen (Darmstadt, Germany)
Plasmids
pET-21d(+)T7 Promoter, Ampr, C-terminal His-TagNovagen (Darmstadt, Germany)
pGRO7plasmid encoding chaperones GroES and GroEL, CmrTakara (Shiga, Japan)
pSIP409spp-based expression vector, Ermr, gusA controlled by PsppQ[30]
pSIP609derivative of pSIP409, erm replaced by alr[32]
pET21lacLMLhlacLM from L. helveticus in pET-21d(+)current study
p409lacLMLhpSIP409 derivative, containing lacLM from L. helveticuscurrent study
P609lacLMLhpSIP609 derivative, containing lacLM from L. helveticuscurrent study
a lacLM, β-galactosidase genes; Δalr, D-alanine auxotroph; Ampr, ampicillin resistance; Ermr, erythromycin resistance; Cmr, chloramphenicol resistance; alr, alanine racemase encoding gene; erm, erythromycin resistance gene; spp, sakacin P gene cluster; gusA, β-glucuronidase reporter gene.
Table
Table 5. Oligonucleotide primers used for amplification of β-galactosidase encoding genes lacLM from L. helveticus a.
Table 5. Oligonucleotide primers used for amplification of β-galactosidase encoding genes lacLM from L. helveticus a.
PrimerSequence (5’-3’)Reference Accession Number
FwdNcoIGGCCCCATGGAAGCAAATATCAATTGGenBank: AJ512877
Rev1XhoIGGCCCTCGAGTGAATTTAGAATAAATGAAAATTCGenBank: AJ512877
Rev2XhoIGGCCCTCGAGTTAATTTAGAATAAATGAAAATTCGenBank: AJ512877
a Restriction sites are underlined.

Share and Cite

MDPI and ACS Style

Kittibunchakul, S.; Pham, M.-L.; Tran, A.-M.; Nguyen, T.-H. β-Galactosidase from Lactobacillus helveticus DSM 20075: Biochemical Characterization and Recombinant Expression for Applications in Dairy Industry. Int. J. Mol. Sci. 2019, 20, 947. https://doi.org/10.3390/ijms20040947

AMA Style

Kittibunchakul S, Pham M-L, Tran A-M, Nguyen T-H. β-Galactosidase from Lactobacillus helveticus DSM 20075: Biochemical Characterization and Recombinant Expression for Applications in Dairy Industry. International Journal of Molecular Sciences. 2019; 20(4):947. https://doi.org/10.3390/ijms20040947

Chicago/Turabian Style

Kittibunchakul, Suwapat, Mai-Lan Pham, Anh-Minh Tran, and Thu-Ha Nguyen. 2019. "β-Galactosidase from Lactobacillus helveticus DSM 20075: Biochemical Characterization and Recombinant Expression for Applications in Dairy Industry" International Journal of Molecular Sciences 20, no. 4: 947. https://doi.org/10.3390/ijms20040947

APA Style

Kittibunchakul, S., Pham, M. -L., Tran, A. -M., & Nguyen, T. -H. (2019). β-Galactosidase from Lactobacillus helveticus DSM 20075: Biochemical Characterization and Recombinant Expression for Applications in Dairy Industry. International Journal of Molecular Sciences, 20(4), 947. https://doi.org/10.3390/ijms20040947

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop