Next Article in Journal
An Integrative Synthetic Biology Approach to Interrogating Cellular Ubiquitin and Ufm Signaling
Next Article in Special Issue
Molecular Mechanisms, Epidemiology, and Clinical Importance of β-Lactam Resistance in Enterobacteriaceae
Previous Article in Journal
Molecular Effects of FDA-Approved Multiple Sclerosis Drugs on Glial Cells and Neurons of the Central Nervous System
Previous Article in Special Issue
Antibiotic Susceptibility Profiles of Lactic Acid Bacteria from the Human Vagina and Genetic Basis of Acquired Resistances
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 21
Issue 12
10.3390/ijms21124230
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

New Determinants of Aminoglycoside Resistance and Their Association with the Class 1 Integron Gene Cassettes in Trueperella pyogenes

by
Ewelina Kwiecień
,
Ilona Stefańska
,
Dorota Chrobak-Chmiel
,
Agnieszka Sałamaszyńska-Guz
and
Magdalena Rzewuska
*
Department of Preclinical Sciences, Institute of Veterinary Medicine, Warsaw University of Life Sciences, Ciszewskiego 8 St., 02-786 Warsaw, Poland
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2020, 21(12), 4230; https://doi.org/10.3390/ijms21124230
Submission received: 26 May 2020 / Revised: 7 June 2020 / Accepted: 11 June 2020 / Published: 13 June 2020
(This article belongs to the Special Issue Drug Resistance Mechanisms in Bacteria)
Browse Figures
Versions Notes

Abstract

:
Trueperella pyogenes is an important opportunistic animal pathogen. Different antimicrobials, including aminoglycosides, are used to treat T. pyogenes infections. The aim of the present study was to evaluate aminoglycoside susceptibility and to detect aminoglycoside resistance determinants in 86 T. pyogenes isolates of different origin. Minimum inhibitory concentration of gentamicin, streptomycin, and kanamycin was determined using a standard broth microdilution method. Genetic elements associated with aminoglycoside resistance were investigated by PCR and DNA sequencing. All studied isolates were susceptible to gentamicin, but 32.6% and 11.6% of them were classified as resistant to streptomycin and kanamycin, respectively. A total of 30 (34.9%) isolates contained class 1 integrons. Class 1 integron gene cassettes carrying aminoglycoside resistance genes, aadA11 and aadA9, were found in seven and two isolates, respectively. Additionally, the aadA9 gene found in six isolates was not associated with mobile genetic elements. Moreover, other, not carried by gene cassettes, aminoglycoside resistance genes, strA-strB and aph(3’)-IIIa, were also detected. Most importantly, this is the first description of all reported genes in T. pyogenes. Nevertheless, the relevance of the resistance phenotype to genotype was not perfectly matched in 14 isolates. Therefore, further investigations are needed to fully explain aminoglycoside resistance mechanisms in T. pyogenes.

1. Introduction

Trueperella pyogenes (formerly Arcanobacterium pyogenes) is a Gram-positive, nonmotile, nonspore-forming, irregular rod. This bacterium is a common inhabitant of mucous membranes of the upper respiratory, gastrointestinal, and urogenital tracts of animals [1,2,3]. However, T. pyogenes can be pathogenic for both domestic and wild animals and causes different diseases, including mastitis, metritis, balanoposthitis, pneumonia, and abscesses in various organs and tissues [1,3,4,5]. Those infections are especially important in swine, cattle, and small ruminants, since they lead to serious economic losses [4,5,6,7,8]. In humans T. pyogenes infections are rare, but may occur especially in immunocompromised individuals and those who have contact with infected animals [9,10].
Aminoglycosides, β-lactam antibiotics, tetracyclines, macrolides, and fluoroquinolones are antimicrobials commonly used to treat infections caused by different Actinomycetales, including T. pyogenes. However, extensive antibiotic use may be the reason for increasing drug resistance in T. pyogenes [4,5,6,7,11]. Although T. pyogenes has been known for a long time, its mechanisms of antimicrobial resistance are still poorly understood. It was previously reported that different mobile genetic elements may play an important role in the acquisition of antimicrobial resistance in this bacterium. The tetW gene, which determines the tetracycline resistance in T. pyogenes, is located on transposons [12]. Two genes associated with the macrolide resistance, ermB and ermX, are carried by variable genetic elements in T. pyogenes, such as plasmids or transposons [13,14]. Additionally, it was found that in the T. pyogenes resistance to trimethoprim, chloramphenicol, aminoglycosides, and β-lactam antibiotics, integrons may also play an essential role [5,7,15].
Integrons are genetic elements that are composed of three main structural components, including the integrase gene (intI), the recombination site (attI), and two promoters (Pc and Pint) [16]. Until now, several classes of integrons have been recognized based on a class-specific amino acid sequence of the integrase [16]. Integrons are able to capture and express antimicrobial resistance genes located in mobile gene cassettes. Gene cassettes’ integration and excision occur by site-specific recombination between the attI site of an integron and the attC site of a gene cassette. Integrons containing gene cassettes may be located in chromosomes or in mobile genetic elements, such as plasmids and transposons. Therefore, integrons play an important role in distribution of antimicrobial resistance genes among bacteria often belonging to different genera and species [17,18,19,20,21]. The role of integrons in the spread of antimicrobial resistance genes is especially well described in Gram-negative bacteria [22]. Some Gram-positive bacteria may also be reservoirs of integrons, including Staphylococcus spp. [23], Enterococcus spp. [24], Corynebacterium spp. [25], Streptococcus spp. [26], and T. pyogenes [5,7,15]. However, issues concerning transfer and dissemination of integrons between T. pyogenes and other bacteria, Gram-positive and Gram-negative, are still unclear and require further investigation.
The enzymatic modification is a common mechanism of the aminoglycoside resistance in various bacteria. There are three main types of aminoglycoside-modifying enzymes: N-acetyltransferases (ACCs), O-nucleotidyltransferases (ANTs), and O-phosphotransferases (ADHs). Genes encoding those enzymes in various bacteria are usually related to mobile genetic elements such as plasmids or transposons [27]. However, to date, little is known about mechanisms of the aminoglycoside resistance in T. pyogenes.
The aim of this study was to determine a minimum inhibitory concentration (MIC) of selected aminoglycosides and to detect aminoglycoside resistance determinants in 86 T. pyogenes isolates of different origin, including unique isolates from European bison (Bison bonasus). In our study various sources of tested isolates allowed us to compare the aminoglycoside resistance among livestock (cattle, swine, goats, sheep) and wild animal (European bison, antelope) T. pyogenes isolates.

2. Results

2.1. Aminoglycoside Susceptibility

Susceptibility to three aminoglycosides was tested for 86 T. pyogenes isolates from various animal species. MICs of tested aminoglycosides for all T. pyogenes isolates are presented in Table S1 of Supplementary Materials. Distribution of MIC values of gentamicin, streptomycin, and kanamycin are shown in Table 1. The susceptibility testing results showed that all isolates were susceptible to gentamicin (100%). However, 28 (32.6%) and 10 (11.6%) isolates were resistant to streptomycin and kanamycin, respectively. The MIC50 and MIC90 (concentrations that inhibited growth of 50% and 90% of isolates, respectively) values of tested antibiotics are presented in Table 1. The prevalence of aminoglycoside resistance, regarding the origin of T. pyogenes isolates, is shown in Table 2. Generally, bovine and swine isolates were resistant to tested aminoglycosides, except gentamycin, at a higher percentage than other isolates. The isolates from small ruminants (2/13) were resistant only to streptomycin. Interestingly, two T. pyogenes isolates from European bison were resistant to kanamycin, while the majority of them were susceptible to all tested aminoglycosides. Moreover, European bison isolates were characterized by lower aminoglycoside MIC50 and MIC90 values (0.5 µg/mL and 1 µg/mL for gentamicin, 2 µg/mL and 4 µg/mL for streptomycin, and 1 µg/mL and 4 µg/mL for kanamycin) than that noted for isolates from livestock (0.5 µg/mL and 2 µg/mL for gentamicin, 4 µg/mL and 64 µg/mL for streptomycin, and 2 µg/mL and 8 µg/mL for kanamycin). With regard to resistance phenotype, only seven (8.1%) isolates were resistant to both streptomycin and kanamycin. In general, 55 (64%) T. pyogenes isolates were susceptible to all tested aminoglycosides.

2.2. Distribution of Integrons and Gene Cassettes in Studied T. pyogenes Isolates

All 86 T. pyogenes isolates were studied with regard to finding potential genetic determinants of aminoglycoside resistance. The class 1 intI gene associated with the class 1 integrons was detected in 30 (34.9%) T. pyogenes isolates. That confirmed a presence of those mobile elements in the genome of studied bacteria. However, the class 2 intI gene associated with the class 2 integrons was not found. Interestingly, the class 1 integrons were present in all isolates from small ruminants (goats and sheep) and in 43% of swine isolates, but only in two (7.7%) bovine isolates (Table S1). Importantly, the class 1 integrons were also found in six (24%) isolates from European bison; however, no gene cassettes were detected in those mobile elements (Table S1). The class 1 integron gene cassettes were present only in nine T. pyogenes isolates, including seven isolates from swine, one from cattle, and one from goat (Table S1). In all nine cases, PCR products specific for gene cassette, with a size approximately 850 bp, were sequenced. The analysis of the obtained sequences showed a presence of two aminoglycoside resistance genes, aadA9 and aadA11, which were not previously reported in T. pyogenes. Thus, generally the class 1 integron gene cassettes associated with the aminoglycoside resistance were identified in 10.5% (9/86) of isolates.

2.3. Structure of the Class 1 Integron Gene Cassettes Associated with Aminoglycoside Resistance

The sequence analysis of the class 1 integron gene cassettes found in T. pyogenes isolates revealed that they contained the aadA9 (837 bp) or aadA11 (846 bp) genes, encoding two adenyltransferases, AadA9 and AadA11, respectively, which may determine the streptomycin and spectinomycin resistance (Figure 1). Both those adenyltransferases belong to the ANT(3’’)-Ia family of aminoglycoside nucleotidyltransferases. The gene cassette containing the aadA9 gene was present in one caprine and one bovine isolate, but the gene cassette with the aadA11 gene was the most prevalent and occurred in seven swine isolates (Table S1). Importantly, this is the first description of the aminoglycoside adenyltransferase gene cassettes aadA9 and aadA11 in T. pyogenes. Moreover, the sequences of both genes, aadA9 and aadA11, were deposited in the GenBank.
Each class 1 integron always contains qacE∆1 (the quaternary ammonium compounds resistance gene), sul1 (the sulfonamide resistance gene), and orf5 (a gene of unknown function) in the 5’ conserved segment and the intI gene in the 3’ conserved segment [16]. In addition, the attI recombination site is located at the end of the 5’ conserved segment. Sequences of attI and attC, sites related to the gene cassette, may vary between different strains [28,29]. Figure 1 presents a schematic organization of the class 1 integron gene cassettes aadA11 and aadA9 detected in T. pyogenes in this study.
In the investigated class 1 integron gene cassettes, both attI sites were 58 bp sequences, with the difference in one nucleotide, a cytosine in addA9 and guanine in aadA11 (Figure 2A). The attC site sequences, length 60 bp, were the same for both studied genes, and were composed of an inverse core site (GTCTAAC) and a core site (GTTAGAT) downstream of the genes (Figure 2B).

2.4. Prevalence of the Aminoglycoside Resistance Genes in Studied T. pyogenes Isolates

The prevalence of selected aminoglycoside resistance genes among studied T. pyogenes isolates was investigated by PCR. The results are presented in Table S1 and distribution of the tested resistance genes depending on an isolate origin is shown in Table 3. The aadA9 and aadA11 genes were present in eight (9.3%) and seven (8.1%) studied isolates, respectively (Figure S1 of Supplementary Materials). The aadA11 gene was detected only in T. pyogenes swine isolates (7/21), and in all cases was carried on the class 1 integron gene cassettes. However, the aadA9 gene only in two isolates, one bovine and one caprine, was located on the class 1 integron gene cassettes. In the remaining six isolates of bovine origin, aadA9 was not associated with gene cassettes. The linked strA-strB genes were detected in a single bovine isolate (Figure S2 of Supplementary Materials), while the aph(3’)-IIIa gene was present in five isolates, one caprine and four swine (Figure S2). It should be highlighted that the strA-strB and aph(3’)-IIIa genes are reported in T. pyogenes for the first time. The remaining tested genes, aadA1, aacC, and aac(6’)-aph(2’’), were not found in the studied isolates. Interestingly, any of the tested resistance genes were detected in the isolates from European bison, although two of them displayed the phenotypic resistance to kanamycin. Moreover, in the other 12 T. pyogenes isolates of various origin, also classified as phenotypically resistant to streptomycin or kanamycin, none of the tested resistance genes were detected.

3. Discussion

Aminoglycosides are antimicrobials commonly used to treat infections in various animals. Furthermore, gentamicin, spectinomycin, dihydrostreptomycin, and neomycin occur in veterinary formulations used in food-producing animals [30]. Nowadays, the treatment of bacterial infections becomes increasingly complicated due to the emergence and spread of resistant pathogens, including aminoglycoside-resistant T. pyogenes strains. Different mechanisms, often related to mobile genetic elements, contribute to dissemination of antimicrobial resistance. The significance of integrons and gene cassettes in spreading of drug resistance among bacteria has been a well-known fact. Class 1 integrons are one of the most important mobile genetic elements because they can capture and express diverse resistance genes in Gram-negative and Gram-positive bacteria [17,18].
T. pyogenes resistance to aminoglycosides was previously reported in limited publications. In this study, as shown in Table 1, all tested T. pyogenes isolates were susceptible to gentamicin, but 32.6% and 11.6% were resistant to streptomycin and kanamycin, respectively. In particular, a high frequency of resistant isolates was noted in cattle and swine. Similarly, in Iran, the majority of T. pyogenes bovine isolates was susceptible to gentamicin (98.5%) while 33.8% were streptomycin-resistant [31]. Pohl et al. [32] also observed a significant level of susceptibility to gentamicin (MIC50 = 1 µg/mL and MIC90 = 4 µg/mL) in T. pyogenes isolated from dairy cattle in Germany. On the other hand, a high percentage (84.4%) of streptomycin-resistant bovine T. pyogenes isolates was recorded in the study of Liu et al. in China [5]. Moreover, 40.6% and 18.8% of those isolates were resistant to amikacin and gentamicin, respectively [5]. Other studies also showed a higher level of resistance to gentamicin in T. pyogenes bovine isolates [33,34,35]. Interestingly, a significantly high percentage of strains resistant to aminoglycosides, such as gentamicin (77.8%), kanamycin (77.8%), amikacin (74.1%), streptomycin (77.8%), and spectinomycin (63%), was reported in case of T. pyogenes isolated from pigs in China [15,36]. The similar observation was reported by Galán-Relaño et al. for T. pyogenes swine isolates in Spain, characterized by high MICs of neomycin and streptomycin but low MICs of gentamicin and apramycin [37]. Moreover, Yoshimura et al. [4] reported that resistance to dihydrostreptomycin appeared more frequently among porcine isolates (85.7%) than among bovine isolates (52.4%). Resistance to gentamicin was noted only in 7.3% of bovine isolates [4]. On the other hand, all T. pyogenes swine isolates studied in Brazil were susceptible to gentamicin and streptomycin, whereas 13.3% of them were resistant to neomycin [38]. In contrast, the prevalence of aminoglycoside resistance in T. pyogenes strains isolated from wild animals seems to be significantly lower than in livestock isolates. Zhao et al. [7] noted a relatively low prevalence of resistance to streptomycin (21.4%), gentamicin (17.9%), amikacin (25.0%), apramycin (17.9%), and kanamycin (25%) among T. pyogenes strains isolated from forest musk deer in China. Similarly, T. pyogenes obtained from white-tailed deer in the United States were susceptible to gentamicin (86.2%) and spectinomycin (100%) [39]. Our results confirmed those observations as the MIC50 and MIC90 values of tested aminoglycosides determined for the isolates from European bison were clearly lower than that for the livestock isolates, and were 0.5 µg/mL and 1 µg/mL for gentamicin, 2 µg/mL and 4 µg/mL for streptomycin, and 1 µg/mL and 4 µg/mL for kanamycin, respectively.
An interpretation of antimicrobial susceptibility testing results in case of T. pyogenes is problematic, because currently there are no species-specific breakpoints established for this bacterium [40]. Moreover, limited data is available on MICs of different antimicrobials and on resistance mechanisms in that species. Generally, there is a lack of data that is essential for establishment of epidemiological cut-off values and clinical breakpoints for antimicrobials commonly used to treat T. pyogenes infections, including aminoglycosides. Thus, an appropriate classification of T. pyogenes isolates as susceptible or resistant is usually difficult. In this study, MIC breakpoints approved for Corynebacterium spp. and coryneforms [40] as well as the criteria previously used by Dong et al. [15] were applied to interpret susceptibility testing results for gentamicin, streptomycin, and kanamycin, respectively. Our study provided new important data on MIC value ranges of gentamicin, streptomycin, and kanamycin determined for T. pyogenes isolates from livestock and wild animals. The obtained results may be helpful for development of T. pyogenes specific breakpoints for aminoglycosides used in veterinary medicine. However, further investigations are required to approve new interpretive criteria for antimicrobial susceptibility testing in T. pyogenes.
In the present study, the screening for integrons in the genome of T. pyogenes isolates revealed that 30 (34.9%) of them carried the class 1 integrons. Importantly, in most cases the integron-positive isolates were from small ruminant and swine origin. Similarly, a high prevalence (approximately 60%) of the class 1 integron was noted in strains isolated from pigs [15] and forest musk deer [7] in China. In contrast, Liu et al. [5] reported a higher prevalence (50%) of the class 1 integrons among T. pyogenes bovine isolates also in China. In our study, the class 2 intI gene was not detected, indicating that the class 2 integrons were not present in tested T. pyogenes isolates. Those data are in agreement with previous reports from China [5,7,15], that also showed the lack of the class 2 integrons in the bacterium.
Interestingly, 17 out of 30 studied isolates containing the class 1 integrons were susceptible to all tested aminoglycosides. The sequence analysis of the integron variable region revealed that the class 1 integrons carried gene cassettes harboring aminoglycoside resistance genes only in nine out of 30 isolates. Thus, these findings indicated a high prevalence (70%) of the empty class 1 integrons among tested T. pyogenes isolates. Several other reports also showed a low frequency of gene cassettes’ occurrence in T. pyogenes isolates containing the class 1 integrons [5,7,15]. The class 1 integron gene cassettes may contain different aminoglycoside resistance genes, often depending on an origin of strains. In China, bovine T. pyogenes strains from endometritis, resistant to aminoglycosides, contained the aadA1, aadA5, aadA24, and aadB genes in the class 1 integron gene cassettes [5]. However, aminoglycoside resistance genes, such as aadA1, aadA2, aadA4, aadA5, aac(6’)-Ib, and aac(6’)-IIc, were found in the class 1 gene cassettes of swine isolates also from China [15]. Moreover, the aadA1, aadA2, and aacC genes associated with gene cassettes were also prevalent among T. pyogenes strains isolated from captive forest musk deer [7]. The same genes, aadA1, aadA2, and aacC, carried on gene cassettes were the most frequent among T. pyogenes mastitis and metritis bovine isolates in Iran [35]. All these findings suggest that T. pyogenes has a relatively high ability to acquire antimicrobial resistance genes carried by mobile elements such as gene cassettes. Our results confirm that suggestion, showing the presence of two aminoglycoside resistance genes, aadA9 and aadA11, carried by the class 1 integron gene cassettes, which may occur in various bacteria but were not previously described in the species.
One of the aminoglycoside resistance mechanisms found in T. pyogenes, based on an antibiotic inactivation, is associated with the presence of aadA genes that encode ANT(3’’)-Ia family of aminoglycoside nucleotidyltransferases, determining resistance to streptomycin and spectinomycin. Interestingly, in our study we detected two novel aminoglycoside resistance determinants, aadA9 and aadA11, belonging to the aadA gene group, that were not previously reported in T. pyogenes. Although it should be highlighted that aadA11 was carried by the class 1 integron gene cassette in all cases, aadA9 was associated with that mobile element only in 2/8 cases. Both those genes were present in the streptomycin-resistant T. pyogenes isolates from livestock animals. However, aadA11 was prevalent in swine isolates, and aadA9 was found in bovine and goat isolates. The nucleotide sequences of the aadA9 genes found in T. pyogenes showed 100% identity to the aadA9 gene in the integron structure of pTET3 from Corynebacterium glutamicum (GenBank No. NG_047368.1) [25]. The aadA9 gene was also reported in other Gram-positive bacterium, Arthrobacter arilaitensis, isolated from agricultural soil in the United Kingdom (GenBank No. FJ457611.1) [41]. On the other hand, the aadA11 gene detected in our T. pyogenes swine isolates presented 100% identity to the aadA11 gene of the Pseudomonas aeruginosa human isolate from France (GenBank No. NG_047330.1) [42]. The aadA11 gene was also identified in P. aeruginosa and Alcaligenes faecalis strains collected from swine environments on three Danish pig farms [43], as well as in Escherichia coli clinical strains isolated from humans in France [44]. Those data show a possibility of the aadA9 and aadA11 genes’ transmission between T. pyogenes and other Gram-positive bacteria as well as some Gram-negative species. However, further investigations must be performed to confirm the phenomenon.
A prevalence of the remaining resistance determinants tested in our research was significantly low. The strA-strB genes, encoding the streptomycin kinases APH(3’’)-Ib and APH(6’)-Id, respectively, were detected in a single bovine isolate, for which the streptomycin MIC value was 64 μg/mL. To the best of our knowledge, in this study the linked strA-strB genes were described in T. pyogenes for the first time. However, Dong et al. tested the presence of strB in T. pyogenes, but that gene was not detected in any of the isolates [15]. It is worth noting that the strA and strB genes are most often linked [45]. The primer set used in our study was designed to detect both those genes, since a primer forward is complementary to the final fragment of the strA gene. Thus, only the partial sequence of strB is a main PCR product. However, the presence of the strA gene in the studied isolate should be confirmed by sequencing of longer than a 33-nt fragment of that gene. The strB partial nucleotide sequence of T. pyogenes, reported in this study, showed 100% identity to the strB gene sequence of many bacterial species, such as Salmonella enterica subsp. enterica (Gen Bank No. CP019649.1), E. coli (GenBank No. JF916464.1), Klebsiella pneumoniae (GenBank No. JX442976.1), and other. Interestingly, the strB gene (also known as aph(6)-Id) is mainly distributed among Gram-negative bacteria [46,47,48,49,50,51]. In case of Gram-positive bacteria, that gene was only reported in human opportunistic pathogen Corynebacterium striatum [52] and Streptococcus thermophilus isolated from food [53]. The strB gene is usually carried by the transposon Tn5393, plasmids, or chromosomal genomic islands [49,50,51]. Additionally, in our study, the aph(3’)-IIIa gene, encoding the kinase APH(3’)-IIIa determining kanamycin resistance, was detected in four kanamycin-resistant isolates (MIC 8 µg/mL) and, surprisingly, in one isolate classified as kanamycin susceptible (MIC 4 µg/mL). Thus, that observation suggests that results of kanamycin susceptibility testing should be interpreted carefully and perhaps lower kanamycin MIC breakpoints for T. pyogenes should be considered. The aph(3’)-IIIa gene was also detected in Lactobacillus bulgaricus [53], Enterococcus spp., and Staphylococcus aureus [54]. To the best of our knowledge, the aph(3’)-IIIa gene was not previously reported in T. pyogenes.
In the current study, the relevance of the streptomycin and kanamycin resistance phenotype and genotype was not perfectly matched. In case of 14 (16.3%) T. pyogenes isolates demonstrating phenotypic resistance to streptomycin or kanamycin, we did not detect any of the tested aminoglycoside resistance genes, which could account for the phenotype. It is noteworthy that four of those resistant isolates and 17 other susceptible isolates harbored the empty class 1 integrons, which potentially may capture resistance gene cassettes. Such empty integrons were also found in other bacteria, for example in E. coli and Enterococcus spp. [55,56]. All those findings indicate a need of further investigations to assess other determinants and mechanisms of aminoglycoside resistance in T. pyogenes.
Concluding, the aminoglycoside resistance in T. pyogenes may be determined by the resistance mechanisms associated with production of aminoglycoside-modifying enzymes, such as ANTs and APHs, encoded by the genes aad9, aad11, and strA-strB, aph(3’)-IIIa, respectively. Those genes, described for the first time in T. pyogenes in our study, should be considered as significant genetic determinants involved in aminoglycoside resistance in the bacterium. The aforementioned genes were found mainly in T. pyogenes isolated from cattle and swine; therefore, both those animal species appear to be the most important reservoir of aminoglycoside-resistant strains. It seems especially interesting that some of the genes detected in T. pyogenes can be carried by the class 1 integron gene cassettes, indicating a high probability of their acquisition from other bacterial species, including Gram-negative bacteria. On the other hand, T. pyogenes has to be perceived as an important reservoir of aminoglycoside resistance genes. Moreover, it should be noted that our study provided the first data on the occurrence and prevalence of integrons and gene cassettes, as well as their sequences, among T. pyogenes strains isolated in Poland.

4. Materials and Methods

4.1. Bacterial Strains and Culture Conditions

A total of 86 T. pyogenes isolates from livestock and wild animals in Poland were studied (cattle = 26, pigs = 21, European bison = 25, goats = 8, sheep = 5, antelope = 1). Clinical specimens were collected from animals with different types of infection (mastitis, metritis, balanoposthitis, pneumonia, abscesses in various tissues). Isolates were cultured on Columbia Agar supplemented with 5% sheep blood (CA; Graso Biotech, Starogard Gdański, Poland) at 37 °C in 5% CO2 conditions for 48 h. All isolates were identified based on their phenotypic properties, as described in the previous studies [11,57].
Reference strains T. pyogenes ATCC®19411, T. pyogenes ATCC®49698, E. coli ATCC®25922, and S. aureus ATCC®25923 were used as quality controls of antimicrobial susceptibility testing.

4.2. Antimicrobial Susceptibility Testing

The MIC values of gentamicin (Sigma, Steinheim, Germany), streptomycin (Sigma, Steinheim, Germany), and kanamycin (Sigma, Steinheim, Germany) were determined using the standard broth microdilution method, according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI) [40]. Briefly, the bacterial inoculum (approximately 4 × 105 CFU/mL) was prepared in a sterile Müeller-Hinton broth (Difco, Franklin Lakes, NJ, USA) supplemented with 5% (v/v) fetal calf serum (Graso Biotech, Starogard Gdański, Poland), and 100 µL was added into 96 wells of microtiter plates. Serial double dilutions of tested antibiotics were performed in the same medium, then were added into the wells (100 µL/well) to receive a final antibiotic concentration over the range 0.125 to 128 µg/mL, respectively. Plates were incubated at 37 °C with 5% CO2 for 24 h. A MIC value was defined visually as the lowest antibiotic concentration in which bacterial growth was not observed. Currently, there are no aminoglycoside MIC breakpoints officially approved for T. pyogenes. Therefore, the results of MIC testing for gentamicin were interpreted according to the CLSI criteria approved for Corynebacterium spp. and coryneforms [40]. However, MIC breakpoints used previously by Dong et al. [15] for antimicrobial susceptibility testing in T. pyogenes were also applied in our study to interpret the MIC testing results for streptomycin and kanamycin.

4.3. Detection of Integrons and Gene Cassettes

A template DNA was extracted from studied T. pyogenes isolates cultured on CA after 48 h of incubation. For each isolate, colonies were suspended in 500 µL of distilled water and incubated at 99 °C for 10 min. Then, the sample was cooled on ice and centrifuged at 15,348 rcf (relative centrifugal force) for 6 min. A supernatant was collected and stored at −20 °C until further use.
The presence of the class 1 and class 2 integrons was confirmed by detection of the integron-encoded integrase genes, class 1 intI and class 2 intI, respectively. All isolates were tested by PCR technique using specific primers (Table 4). The presence of gene cassettes was also investigated by PCR using primer sets listed in Table 4. All PCR reaction mixtures with final volume of 25 µL contained: 8.5 µL of nuclease-free water (Thermo Fisher Scientific, Waltham, MA, USA), 12.5 µL of DreamTaq Green PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 10 pmol (picomoles) of each primer (Genomed, Warsaw, Poland), and 2 µL (70–90 ng) of the DNA template. The thermal cycling conditions included initial denaturation at 95 °C for 3 min followed by 30 cycles of DNA denaturation at 95 °C for 30 sec, annealing for 30 sec at variable temperatures, as shown in Table 4, and extension at 72 °C for 1 min with a final extension step of 72 °C for 5 min. Amplification products were recognized by electrophoresis (85 V by 45 min) in 0.8% (w/v) agarose gel in Tris-Acetate-EDTA (TAE) buffer with Midori Green DNA Stain (Nippon Genetics, Düren, Germany), and visualized and analyzed using a VersaDoc Model 1000 Imaging System and Quantity One software (version 4.4.0) (Bio-Rad, Hercules, CA, USA). All amplicons of the class 1 integron gene cassettes were sequenced (Genomed, Warsaw, Poland) and a Basic Local Alignment Search Tool (BLAST) analysis was carried out on the National Center for Biotechnology Information (NCBI) web site (http://blast.ncbi.nlm.nih.gov) [58].

4.4. Detection of Aminoglycoside Resistance Genes

PCR was used to detect genes aadA1, aadA9, aadA11, aacC, strA-strB, aph(3’)-IIIa, and aac(6’)-aph(2’’), encoding selected aminoglycoside resistance determinants. A composition of reaction mixtures was the same as described for amplification of integrons and gene cassettes, but with primers (Genomed, Warsaw, Poland) specific for studied genes (Table 4). Primers for the aadA9 and aadA11 genes were designed based on the obtained class 1 integron gene cassettes’ sequences. Primers for the aadA1 and aacC genes were designed based on the known sequences of those genes deposited in GenBank, JN084184 and JN084183, respectively. The primers were designed using Primer-Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). PCR thermal cycling conditions were as follows: An initial denaturation at 95 °C for 3 min followed by 35 cycles of DNA denaturation at 95 °C for 30 sec, annealing for 30 sec at different temperatures, as shown in Table 4, and extension at 72 °C for 45 sec with a final extension step of 72 °C for 2 min (for aadA1, aadA9, aadA11, aacC, aac(6’)-aph(2’’)) and 5 min (for strA-strB and aph(3’)-IIIa). Products of the amplification were separated by electrophoresis (85 V by 45 min) in 0.8% (w/v) agarose gel in TAE buffer with Midori Green DNA Stain (Nippon Genetics, Düren, Germany), and visualized and analyzed using a VersaDoc Model 1000 Imaging System and Quantity One software (version 4.4.0) (Bio-Rad, Hercules, CA, USA). The clinical isolates, K. pneumoniae 15/BM, P. aeruginosa 420/BM, Pediococcus pentosaceus WN1 and E. coli pMW10, were used as positive controls in the PCR reactions for aadA1, aacC, strA-strB, and aph(3’)-IIIa, respectively.
A single primer set was used to detect the linked strA-strB genes in PCR. The amplicon obtained in that reaction, corresponding mainly to a first part of the strB gene, was sequenced (Genomed, Warsaw, Poland) and a Basic Local Alignment Search Tool (BLAST) analysis was carried out on the National Center for Biotechnology Information (NCBI) web site (http://blast.ncbi.nlm.nih.gov) [58].

4.5. Nucleotide Sequence Accession Numbers

The aadA9 and aadA11 gene sequences, as well as the partial sequence of the strB gene obtained in the study were deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank) under accession numbers MN171325, MN171326, and MT500573, respectively.

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/21/12/4230/s1.

Author Contributions

Conceptualization, M.R., E.K., and I.S.; methodology, E.K., M.R., I.S., D.C.-C., and A.S.-G.; investigation, E.K., I.S., and D.C.-C.; writing—original draft preparation, E.K., M.R., and I.S.; writing—review and editing, E.K., M.R., I.S., D.C.-C., and A.S.-G., supervision, M.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Acknowledgments

The authors thank Barbara Chojnacka and Alicja Grzechnik for excellent technical assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jost, B.H.; Billington, S.J. Arcanobacterium pyogenes: Molecular pathogenesis of an animal opportunist. Antonie Van Leeuwenhoek 2005, 88, 87–102. [Google Scholar] [CrossRef]
  2. Yang, L.; Zhang, Y.; Wang, H.; Ma, B.; Xu, L.; Wang, J.; Zhang, W. Identification of B-cell linear epitopes in domains 1–3 of pyolysin of Trueperella pyogenes using polyclonal antibodies. Vet. Microbiol. 2017, 210, 24–31. [Google Scholar] [CrossRef]
  3. Rzewuska, M.; Kwiecień, E.; Chrobak-Chmiel, D.; Kizerwetter-Świda, M.; Stefańska, I.; Gieryńska, M. Pathogenicity and Virulence of Trueperella pyogenes: A Review. Int. J. Mol. Sci. 2019, 20, 2737. [Google Scholar] [CrossRef] [Green Version]
  4. Yoshimura, H.; Kojima, A.; Ishimaru, M. Antimicrobial susceptibility of Arcanobacterium pyogenes isolated from cattle and pigs. J. Vet. Med. B Infect. Dis. Vet. Public Health 2000, 47, 139–143. [Google Scholar] [CrossRef]
  5. Liu, M.; Wu, C.; Liu, Y.; Zhao, J.; Yang, Y.; Shen, J. Identification, susceptibility, and detection of integron-gene cassettes of Arcanobacterium pyogenes in bovine endometritis. J. Dairy Sci. 2009, 92, 3659–3666. [Google Scholar] [CrossRef]
  6. Santos, T.M.; Caixeta, L.S.; Machado, V.S.; Rauf, A.K.; Gilbert, R.O.; Bicalho, R.C. Antimicrobial resistance and presence of virulence factor genes in Arcanobacterium pyogenes isolated from the uterus of postpartum dairy cows. Vet. Microbiol. 2010, 145, 84–89. [Google Scholar] [CrossRef]
  7. Zhao, K.; Liu, Y.; Zhang, X.; Palahati, P.; Wang, H.; Yue, B. Detection and characterization of antibiotic resistance genes in Arcanobacterium pyogenes strains from abscesses of forest musk deer. J. Med. Microbiol. 2011, 60, 1820–1826. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Risseti, R.M.; Zastempowska, E.; Twarużek, M.; Lassa, H.; Pantoja, J.C.F.; De Vargas, A.P.C.; Guerra, S.T.; Bolanõs, C.A.D.; de Paula, C.L.; Alves, A.C.; et al. Virulence markers associated with Trueperella pyogenes infections in livestock and companion animals. Lett. Appl. Microbiol. 2017, 65, 125–132. [Google Scholar] [CrossRef] [PubMed]
  9. Kavitha, K.; Latha, R.; Udayashankar, C.; Jayanthi, K.; Oudeacoumar, P. Three cases of Arcanobacterium pyogenes-associated soft tissue infection. J. Med. Microbiol. 2010, 59, 736–739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Plamondon, M.; Martinez, G.; Raynal, L.; Touchette, M.; Valiguette, L. A fatal case of Arcanobacterium pyogenes endocarditis in a man with no identified animal contact: Case report and review of the literature. Eur. J. Clin. Microbiol. Infect. Dis. 2007, 26, 663–666. [Google Scholar] [CrossRef] [PubMed]
  11. Rzewuska, M.; Czopowicz, M.; Gawryś, M.; Markowska-Daniel, I.; Bielecki, W. Relationship between antimicrobial resistance, distribution of virulence factor genes and the origin of Trueperella pyogenes isolated from domestic animals and European bison (Bison bonasus). Microb. Pathog. 2016, 96, 35–41. [Google Scholar] [CrossRef] [PubMed]
  12. Billington, S.J.; Jost, B.H. Multiple genetic elements carry the tetracycline resistance gene tet(W) in the animal pathogen Arcanobacterium pyogenes. Antimicrob. Ag. Chemother. 2006, 50, 3580–3587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Jost, B.H.; Field, A.C.; Trinh, H.T.; Songer, J.G.; Billington, S.J. Tylosin resistance in Arcanobacterium pyogenes is encoded by an Erm X determinant. Antimicrob. Ag. Chemother. 2003, 47, 3519–3524. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Jost, B.H.; Trinh, H.T.; Songer, J.G.; Billington, S.J. A second tylosin resistance determinant, Erm B, in Arcanobacterium pyogenes. Antimicrob. Ag. Chemother. 2004, 48, 721–727. [Google Scholar] [CrossRef] [Green Version]
  15. Dong, W.L.; Kong, L.C.; Wang, Y.; Gou, C.; Xu, B.; Ma, H.; Gao, Y.H. Aminoglicoside resistance of Trueperella pyogenes isolated from pigs in China. J. Vet. Med. Sci. 2017, 79, 1836–1839. [Google Scholar] [CrossRef] [Green Version]
  16. Mazel, D. Integrons: Agents of bacterial evolution. Nat. Rev. Microbiol. 2006, 4, 608–620. [Google Scholar] [CrossRef]
  17. Barraud, O.; Ploy, M.C. Diversity of Class 1 Integron Gene Cassette Rearrangements Selected under Antibiotic Resistance Pressure. J. Bacteriol. 2015, 197, 2171–2178. [Google Scholar] [CrossRef] [Green Version]
  18. Deng, Y.; Bao, X.; Ji, L.; Chen, L.; Liu, J.; Miao, J.; Chen, D.; Bian, H.; Li, Y.; Yu, G. Resistance integrons: Class 1, 2 and 3 integrons. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 45. [Google Scholar] [CrossRef] [Green Version]
  19. Böhm, M.-E.; Razavi, M.; Marathe, N.P.; Flach, C.-F.; Larsson, D.G.J. Discovery of a novel integron-borne aminoglycoside resistance gene present in clinical pathogens by screening environmental bacterial communities. Microbiome 2020, 8, 41. [Google Scholar] [CrossRef] [Green Version]
  20. Palma, E.; Tilocca, B.; Roncada, P. Antimicrobial Resistance in Veterinary Medicine: An Overview. Int. J. Mol. Sci. 2020, 21, 1914. [Google Scholar] [CrossRef] [Green Version]
  21. Alduina, R.; Gambino, D.; Presentato, A.; Gentile, A.; Sucato, A.; Savoca, D.; Filippello, S.; Visconti, G.; Caracappa, G.; Vicari, D.; et al. Is Caretta Caretta a Carrier of Antibiotic Resistance in the Mediterranean Sea? Antibiotics 2020, 9, 116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Wu, K.; Wang, F.; Sun, J.; Wang, Q.; Chen, Q.; Yu, S.; Rui, Y. Class 1 integron gene cassettes in multidrug-resistant Gram-negative bacteria in southern China. Int. J. Antimicrob. Ag. 2012, 40, 264–2687. [Google Scholar] [CrossRef] [PubMed]
  23. Li, L.; Zhao, X. Characterization of the resistance class 1 integrons in Staphylococcus aureus isolates from milk of lactating dairy cattle in Northwestern China. BMC Vet. Res. 2018, 14, 59. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Clark, N.C.; Olsvik, O.; Swenson, J.M.; Spiegel, C.A.; Tenover, F.C. Detection of a streptomycin/spectinomycin adenylyltransferase gene (aadA) in Enterococcus faecalis. Antimicrob. Ag. Chemother. 1999, 43, 157–160. [Google Scholar] [CrossRef] [Green Version]
  25. Tauch, A.; Götker, S.; Pühler, A.; Kalinowski, J.; Thierbach, G. The 27.8-kb R-plasmid pTET3 from Corynebacterium glutamicum encodes the aminoglycoside adenyltransferase gene cassette aadA9 and the regulated tetracycline efflux system Tet 33 flanked by active copies of the widespread insertion sequence IS6100. Plasmid 2002, 48, 117–129. [Google Scholar] [CrossRef]
  26. Xu, Z.; Li, L.; Shirtliff, M.E.; Peters, B.M.; Li, B.; Peng, Y.; Alam, M.J.; Yamasaki, S.; Shi, L. Resistance class 1 integron in clinical methicillin-resistant Staphylococcus aureus strains in southern China, 2001–2006. Clin. Microbiol. Infect. 2011, 17, 714–718. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Ramirez, M.S.; Tolmasky, M.E. Aminoglycoside modifying enzymes. Drug Resist. Update 2010, 13, 151–171. [Google Scholar] [CrossRef] [Green Version]
  28. Larouche, A.; Roy, P.H. Effect of attC structure on cassette excision by integron integrases. Mobile DNA 2011, 2, 3. [Google Scholar] [CrossRef] [Green Version]
  29. Partridge, S.R.; Recchia, G.D.; Scaramuzzi, C.; Collis, C.M.; Stokes, H.W.; Hall, R.M. Definition of the attI site of class 1 integrons. Microbiology 2000, 146, 2855–2864. [Google Scholar] [CrossRef] [Green Version]
  30. Anonymous. FDA Annual Summary Report on Antimicrobials Sold or Distributed in 2018 for Use in Food-Producing Animals; FDA Center for Veterinary Medicine: Rockville, MD, USA, 2019. [Google Scholar]
  31. Tamai, I.A.; Mohammadzadeh, A.; Salehi, T.Z.; Mahmoodi, P. Genomic characterisation, detection of genes encoding virulence factors and evaluation of antibiotic resistance of Trueperella pyogenes isolated from cattle with clinical metritis. Antonie van Leeuwenhoek 2018, 111, 2441–2453. [Google Scholar] [CrossRef]
  32. Pohl, A.; Lübke-Becker, A.; Heuwieser, W. Minimum inhibitory concentrations of frequently used antibiotics against Escherichia coli and Trueperella pyogenes isolated from uteri of postpartum dairy cows. J. Dairy Sci. 2018, 101, 1355–1364. [Google Scholar] [CrossRef] [PubMed]
  33. Brodzki, P.; Bochniarz, M.; Brodzki, A.; Wrona, Z.; Wawron, W. Trueperella pyogenes and Escherichia coli as an etiological factor of endometritis in cows and the susceptibility of these bacteria to selected antibiotics. Pol. J. Vet. Sci. 2014, 17, 657–664. [Google Scholar] [CrossRef] [PubMed]
  34. Ozturk, D.; Turutoglu, H.; Pehlivanoglu, F.; Guler, L. Virulence genes, biofilm production and antibiotic susceptibility in Trueperella pyogenes isolated from cattle. Isr. J. Vet. Med. 2016, 71, 36–42. [Google Scholar]
  35. Rezanejad, M.; Karimi, S.; Momtaz, H. Phenotypic and molecular characterization of antimicrobial resistance in Trueperella pyogenes strains isolated from bovine mastitis and metritis. BMC Microbiol. 2019, 19, 305. [Google Scholar] [CrossRef] [PubMed]
  36. Dong, W.L.; Liu, L.; Odah, K.A.; Atiah, L.A.; Gao, Y.H.; Kong, L.C.; Ma, H.X. Antimicrobial resistance and presence of virulence factor genes in Trueperella pyogenes isolated from pig lungs with pneumonia. Trop. Anim. Health Prod. 2019, 19. [Google Scholar] [CrossRef] [PubMed]
  37. Galán-Relaño, Á.; Gómez-Gascón, L.; Luque, I.; Barrero-Domínguez, B.; Casamayor, A.; Cardoso-Toset, F.; Vela, A.I.; Fernández-Garayzábal, J.F.; Tarradas, C. Antimicrobial susceptibility and genetic characterization of Trueperella pyogenes isolates from pigs reared under intensive and extensive farming practices. Vet. Microbiol. 2019, 232, 89–95. [Google Scholar] [CrossRef]
  38. Moreno, L.Z.; Matajira, C.E.C.; da Costa, B.L.P.; Ferreira, T.S.P.; Silva, G.F.R.; Dutra, M.C.; Gomes, V.T.M.; Silva, A.P.S.; Christ, A.P.G.; Sato, M.I.Z.; et al. Characterization of porcine Trueperella pyogenes by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), molecular typing and antimicrobial susceptibility profiling in Sao Paulo State. Comp. Immunol. Microbiol. Infect. Dis. 2017, 51, 49–53. [Google Scholar] [CrossRef]
  39. Tell, L.A.; Brooks, J.W.; Lintner, V.; Matthews, T.; Kariyawasam, S. Antimicrobial susceptibility of Arcanobacterium pyogenes isolated from the lungs of white-tailed deer (Odocoileus virginianus) with pneumonia. J. Vet. Diagn. Investig. 2011, 23, 1009–1013. [Google Scholar] [CrossRef] [Green Version]
  40. CLSI. Methods for Antimicrobial Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria Isolated from Animals, 1st ed.; CLSI Supplement VET06; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2017. [Google Scholar]
  41. Byrne-Bailey, K.G.; Gaze, W.H.; Zhang, L.; Kay, P.; Boxall, A.; Hawkey, P.M.; Wellington, E.M.H. Integron Prevalence and Diversity in Manured Soil. Appl. Environ. Microbiol. 2011, 77, 684–687. [Google Scholar] [CrossRef] [Green Version]
  42. Llanes, C.; Neuwirth, C.; El Garch, F.; Hocquet, D.; Plésiat, P. Genetic analysis of a multiresistant strain of Pseudomonas aeruginosa producing PER-1 β-lactamase. Clin. Microbiol. Infect. 2006, 12, 270–278. [Google Scholar] [CrossRef]
  43. Agersø, Y.; Sandvang, D. Class 1 Integrons and Tetracycline Resistance Genes in Alcaligenes, Arthrobacter, and Pseudomonas spp. Isolated from Pigsties and Manured Soil. Appl. Environ. Microbiol. 2005, 71, 7941–7947. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Vinué, L.; Jové, T.; Torres, C.; Ploy, M.C. Diversity of class 1 integron gene cassette Pc promoter variants in clinical Escherichia coli strains and description of a new P2 promoter variant. Int. J. Antimicrob. Agents. 2011, 38, 526–529. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Chiou, C.S.; Jones, A.L. Expression and Identification of the strA-strB Gene Pair from Streptomycin-Resistant Erwinia Amylovora. Gene 1995, 152, 47–51. [Google Scholar] [CrossRef]
  46. Sunde, M.; Norström, M. The genetic background for streptomycin resistance in Escherichia coli influences the distribution of MICs. J. Antimicrob. Chemother. 2005, 56, 87–90. [Google Scholar] [CrossRef] [Green Version]
  47. Pyatov, V.; Vrtková, I.; Knoll, A. Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic. Acta Vet. Brno 2017, 86, 167–174. [Google Scholar] [CrossRef] [Green Version]
  48. Hou, X.; Song, X.; Ma, X.; Zhang, S.; Zhang, J. Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates. Braz. J. Microbiol. 2015, 46, 759–768. [Google Scholar] [CrossRef] [Green Version]
  49. L’Abée-Lund, T.M.; Sørum, H. Functional Tn5393-like transposon in the R plasmid pRAS2 from the fish pathogen Aeromonas salmonicida subspecies salmonicida isolated in Norway. Appl. Environ. Microbiol. 2000, 66, 5533–5535. [Google Scholar] [CrossRef] [Green Version]
  50. Dyall-Smith, M.L.; Liu, Y.; Billman-Jacobe, H. Genome Sequence of an Australian Monophasic Salmonella enterica subsp. enterica Typhimurium Isolate (TW-Stm6) Carrying a Large Plasmid with Multiple Antimicrobial Resistance Genes. Genome Announc. 2017, 5, e00793-17. [Google Scholar] [CrossRef] [Green Version]
  51. Pezzella, C.; Ricci, A.; DiGiannatale, E.; Luzzi, I.; Carattoli, A. Tetracycline and Streptomycin Resistance Genes, Transposons, and Plasmids in Salmonella enterica Isolates from Animals in Italy. Antimicrob. Ag. Chemother. 2004, 48, 903–908. [Google Scholar] [CrossRef] [Green Version]
  52. Navas, J.; Fernández-Martínez, M.; Salas, C.; Cano, M.E.; Martínez-Martínez, L. Susceptibility to Aminoglycosides and Distribution of aph and aac(3)-XI Genes among Corynebacterium striatum Clinical Isolates. PLoS ONE 2016, 11, e0167856. [Google Scholar] [CrossRef] [Green Version]
  53. Li, Y.; Li, L.; Kromann, S.; Chen, M.; Shi, L.; Meng, H. Antibiotic Resistance of Lactobacillus spp. and Streptococcus thermophilus Isolated from Chinese Fermented Milk Products. Foodborne Pathog. Dis. 2019, 16, 221–228. [Google Scholar] [CrossRef] [PubMed]
  54. Woegerbauer, M.; Zeinzinger, J.; Springer, B.; Hufnagl, P.; Indra, A.; Korschineck, I.; Hofrichter, J.; Kopacka, I.; Fuchs, R.; Steinwider, J.; et al. Prevalence of the aminoglycoside phosphotransferase genes aph(3’)-IIIa and aph(3’)-IIa in Escherichia coli, Enterococcus faecalis, Enterococcus faecium, Pseudomonas aeruginosa, Salmonella enterica subsp. enterica and Staphylococcus aureus isolates in Austria. J. Med. Microbiol. 2014, 63, 210–217. [Google Scholar] [PubMed] [Green Version]
  55. Lapierre, L.; Cornejo, J.; Borie, C.; Toro, C.; San Martín, B. Genetic characterization of antibiotic resistance genes linked to class 1 and class 2 integrons in commensal strains of Escherichia coli isolated from poultry and swine. Microb. Drug. Resist. 2008, 14, 265–272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Thu, W.P.; Sinwat, N.; Bitrus, A.A.; Angkittitrakul, S.; Prathan, R.; Chuanchuen, R. Prevalence, antimicrobial resistance, virulence gene, and class 1 integrons of Enterococcus faecium and Enterococcus faecalis from pigs, pork and humans in Thai-Laos border provinces. J. Glob. Antimicrob. Resist. 2019, 18, 130–138. [Google Scholar] [CrossRef]
  57. Rzewuska, M.; Stefańska, I.; Osińska, B.; Kizerwetter-Świda, M.; Chrobak, D.; Kaba, J.; Bielecki, W. Phenotypic characteristics and virulence genotypes of Trueperella (Arcanobacterium) pyogenes strains isolated from European bison (Bison bonasus). Vet. Microbiol. 2012, 160, 69–76. [Google Scholar] [CrossRef] [PubMed]
  58. Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Vakulenko, S.B.; Donabedian, S.M.; Voskresenskiy, A.M.; Zervos, M.J.; Lerner, S.A.; Chow, J.W. Multiplex PCR for Detection of Aminoglycoside Resistance Genes in Enterococci. Antimicrob. Ag. Chemother. 2003, 47, 1423–1426. [Google Scholar] [CrossRef] [Green Version]
  60. Ouoba, L.I.; Lei, V.; Jensen, L.B. Resistance of potential probiotic lactic acid bacteria and bifidobacteria of African and European origin to antimicrobials: Determination and transferability of the resistance genes to other bacteria. Int. J. Food Microbiol. 2008, 121, 217–224. [Google Scholar] [CrossRef]
Ijms 21 04230 g001 550
Figure 1. A schematic organization of the class 1 integrons and the aminoglycoside resistance gene cassettes aadA11 (A) and aadA9 (B) found in studied T. pyogenes isolates. Designations: intI, the integrase gene; attI, the recombination site of integrase; aadA9 and aadA11, the streptomycin/spectinomycin resistance genes encoding adenylotransferases; attC the recombination site of cassette; qacE∆1, the quaternary ammonium compounds resistance gene; sulI, the sulfonamide resistance gene; orf5, a gene of unknown function; P, promoter; Pc, cassette promoter; Pint, integron promoter.
Figure 1. A schematic organization of the class 1 integrons and the aminoglycoside resistance gene cassettes aadA11 (A) and aadA9 (B) found in studied T. pyogenes isolates. Designations: intI, the integrase gene; attI, the recombination site of integrase; aadA9 and aadA11, the streptomycin/spectinomycin resistance genes encoding adenylotransferases; attC the recombination site of cassette; qacE∆1, the quaternary ammonium compounds resistance gene; sulI, the sulfonamide resistance gene; orf5, a gene of unknown function; P, promoter; Pc, cassette promoter; Pint, integron promoter.
Ijms 21 04230 g001
Ijms 21 04230 g002 550
Figure 2. (A) Nucleotide sequences of the attI site associated with the class 1 integron gene cassettes aadA9 and aadA11 in studied T. pyogenes isolates. The weak, strong, and simple sites of the class 1 integrase binding are in bold. Differences in one nucleotide in the attI site sequences between aadA9 and aadA11 cassettes are in bold and underlined. (B) Nucleotide sequences of the attC sites associated with the class 1 integron gene cassettes aadA9 and aadA11 in T. pyogenes. Sequences of the inverse core sites and core sites for both gene cassettes are in bold and underlined.
Figure 2. (A) Nucleotide sequences of the attI site associated with the class 1 integron gene cassettes aadA9 and aadA11 in studied T. pyogenes isolates. The weak, strong, and simple sites of the class 1 integrase binding are in bold. Differences in one nucleotide in the attI site sequences between aadA9 and aadA11 cassettes are in bold and underlined. (B) Nucleotide sequences of the attC sites associated with the class 1 integron gene cassettes aadA9 and aadA11 in T. pyogenes. Sequences of the inverse core sites and core sites for both gene cassettes are in bold and underlined.
Ijms 21 04230 g002
Table
Table 1. Distribution of minimum inhibitory concentration (MIC), MIC50, and MIC90 values of three aminoglycoside antibiotics among studied Trueperella pyogenes isolates (n = 86).
Table 1. Distribution of minimum inhibitory concentration (MIC), MIC50, and MIC90 values of three aminoglycoside antibiotics among studied Trueperella pyogenes isolates (n = 86).
AntibioticNumber of Isolates with MIC (µg/mL)*MIC50MIC90
≤0.1250.250.51248163264≥128
Gentamicin912351812 │ 0.52
Streptomycin 4117│ 84493464
Kanamycin2612232013│523 18
*MIC breakpoints used in this study (vertical bars): Gentamicin ≥ 16 µg/mL, streptomycin > 4 µg/mL, kanamycin > 4 µg/mL; numbers of resistant isolates are in bold.
Table
Table 2. Prevalence of the aminoglycoside resistance in studied Trueperella pyogenes isolates (n = 86).
Table 2. Prevalence of the aminoglycoside resistance in studied Trueperella pyogenes isolates (n = 86).
Antibiotic Total (n = 86)Resistant Isolates From [% (n)]
Cattle (n = 26)Pigs (n = 21)European bison (n = 25)Goats (n = 8)Sheep (n = 5)Antelope (n = 1)
Gentamicin0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)
Streptomycin32.6 (28)53.8 (14)57.1 (12)0 (0)12.5 (1)20.0 (1)0 (0)
Kanamycin 11.6 (10)11.5 (3)23.8 (5)8,0 (2)0 (0)0 (0) 0 (0)
Table
Table 3. Distribution of the aminoglycoside resistance genes in studied Trueperella pyogenes isolates (n = 86).
Table 3. Distribution of the aminoglycoside resistance genes in studied Trueperella pyogenes isolates (n = 86).
Resistance GeneTotal (n = 86)Isolates From [% (n)]
Cattle (n = 26)Pigs (n = 21)European Bison (n = 25)Goats (n = 8)Sheep (n = 5)Antelope (n = 1)
aadA10 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)
aadA99.3 (8)27.0 (7)0 (0)0 (0)12.5 (1)0 (0)0 (0)
aadA118.1 (7)0 (0)33.3 (7)0 (0)0 (0)0 (0)0 (0)
aacC0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)
strA-strB1.2 (1)3.8 (1)0 (0)0 (0)0 (0)0 (0)0 (0)
aph(3’)-IIIa5.8 (5)0 (0)19.0 (4)0 (0)12.5 (1)0 (0)0 (0)
aac(6’)-aph(2’’)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)
Table
Table 4. Primers used in this study.
Table 4. Primers used in this study.
Amplification TargetPrimers Sequence (5’-3’)Annealing Temperature (°C)PCR Product size (bp)Reference
Class 1 intIF: CCTCCCGCACGATGATC57280[7]
R: TCCACGCATCGTCAGGC
Class 2 intIF: TTATTGCTGGGATTAGGC50233[7]
R: ACGGCTACCCTCTGTTATC
Class 1 gene cassetteF: GGCATCCAAGCAGCAAG58unpredictable[15]
R: AAGCAGACTTGACCTGA
aadA1F: CGGTGACCGTAAGGCTTGAT52193This study
R: ATGTCATTGCGCTGCCATTC
aadA9F: ACGCCGACCTTGCAATTCT52373This study
R: TAGCCAATGAACGCCGAAGT
aadA11F: CGTGCATTTGTACGGCTCTG53352This study
R: ACCTGCCAATGCAAGGCTAT
aacCF: TTGCTGCCTTCGACCAAGAA53256This study
R: TCCCGTATGCCCAACTTTGT
strA-strBF: TATCTGCGATTGGACCCTCTG60538[46]
R: CATTGCTCATCATTTGATCGGCT
aph(3’)-IIIaF: GGCTAAAATGAGAATATCACCGG55523[59]
R: CTTTAAAAAATCATACAGCTCGCG
aac(6’)-aph(2’’)F: CCAAGAGCAATAAGGGCATA48220[60]
R: CACTATCATAACCACTACCG

Share and Cite

MDPI and ACS Style

Kwiecień, E.; Stefańska, I.; Chrobak-Chmiel, D.; Sałamaszyńska-Guz, A.; Rzewuska, M. New Determinants of Aminoglycoside Resistance and Their Association with the Class 1 Integron Gene Cassettes in Trueperella pyogenes. Int. J. Mol. Sci. 2020, 21, 4230. https://doi.org/10.3390/ijms21124230

AMA Style

Kwiecień E, Stefańska I, Chrobak-Chmiel D, Sałamaszyńska-Guz A, Rzewuska M. New Determinants of Aminoglycoside Resistance and Their Association with the Class 1 Integron Gene Cassettes in Trueperella pyogenes. International Journal of Molecular Sciences. 2020; 21(12):4230. https://doi.org/10.3390/ijms21124230

Chicago/Turabian Style

Kwiecień, Ewelina, Ilona Stefańska, Dorota Chrobak-Chmiel, Agnieszka Sałamaszyńska-Guz, and Magdalena Rzewuska. 2020. "New Determinants of Aminoglycoside Resistance and Their Association with the Class 1 Integron Gene Cassettes in Trueperella pyogenes" International Journal of Molecular Sciences 21, no. 12: 4230. https://doi.org/10.3390/ijms21124230

APA Style

Kwiecień, E., Stefańska, I., Chrobak-Chmiel, D., Sałamaszyńska-Guz, A., & Rzewuska, M. (2020). New Determinants of Aminoglycoside Resistance and Their Association with the Class 1 Integron Gene Cassettes in Trueperella pyogenes. International Journal of Molecular Sciences, 21(12), 4230. https://doi.org/10.3390/ijms21124230

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop