Chemotherapeutic Stress Influences Epithelial–Mesenchymal Transition and Stemness in Cancer Stem Cells of Triple-Negative Breast Cancer
Abstract
:1. Introduction
2. Results
2.1. BCSCs from TNBC Show Varying Resistance Against Different Chemotherapeutics
2.2. Proliferation of BCSCs Was Inhibited after Chemotherapeutic Stress and Recovered Gradually
2.3. Chemotherapeutic Stress Induces a Mesenchymal Cell Morphology and Change in EMT Gene Expression, but No Change in Migratory Capacity
2.4. Chemotherapeutic Stress Enhances the Self-Renewal of the BCSCs
2.5. Chemotherapeutic Stress Changes Cancer-Related miRNA Expression Profiles of the BCSCs
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. MSC Medium
4.3. Chemotherapy Agent
4.4. Flow Cytometry
4.5. Orthotopic Breast Cancer Xenografts
4.6. Immunohistochemistry
4.7. Cell Proliferation and Time–Dose Response Assay
4.8. Survival Model Construction
4.9. RNA Extraction
4.10. Reverse Transcription and Quantitative PCR
4.11. Migration Assay
4.12. Sphere-Forming Assay and Anchorage-Independent Growth Assay
4.13. Statistics
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
5-FU | 5-Fluorouracil |
BCSC | Breast cancer stem cell |
EMT | Epithelial-mesenchymal transition |
ER | Estrogen receptor |
FAC | 5-Fluorouracil, doxorubicin, and cyclophosphamide |
FEC | 5-Fluorouracil, epirubicin, and cyclophosphamide |
HER2 | Human epidermal growth factor receptor 2 |
HMEC | Human mammary epithelial cell |
MEBM | Mammary epithelial basal medium |
miRNA | microRNA |
NACT | Neoadjuvant chemotherapy |
NSCLC | Non-small cell lung cancer |
PR | Progesterone receptor |
RWD | Relative wound density |
TAC | Docetaxel, doxorubicin, and cyclophosphamide |
TC | Docetaxel and cyclophosphamide |
TNBC | Triple-negative breast cancer |
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA A Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Green Version]
- Foulkes, W.D.; Smith, I.E.; Reis-Filho, J.S. Triple-negative breast cancer. N. Engl. J. Med. 2010, 363, 1938–1948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bergin, A.R.T.; Loi, S. Triple-negative breast cancer: Recent treatment advances. F1000Research 2019, 8. F1000 Faculty Rev-1342. [Google Scholar] [CrossRef] [PubMed]
- Reya, T.; Morrison, S.J.; Clarke, M.F.; Weissman, I.L. Stem cells, cancer, and cancer stem cells. Nature 2001, 414, 105–111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mani, S.A.; Guo, W.; Liao, M.J.; Eaton, E.N.; Ayyanan, A.; Zhou, A.Y.; Brooks, M.; Reinhard, F.; Zhang, C.C.; Shipitsin, M.; et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008, 133, 704–715. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liao, T.T.; Yang, M.H. Revisiting epithelial-mesenchymal transition in cancer metastasis: The connection between epithelial plasticity and stemness. Mol. Oncol. 2017, 11, 792–804. [Google Scholar] [CrossRef]
- Honeth, G.; Bendahl, P.O.; Ringner, M.; Saal, L.H.; Gruvberger-Saal, S.K.; Lovgren, K.; Grabau, D.; Ferno, M.; Borg, A.; Hegardt, C. The CD44+/CD24− phenotype is enriched in basal-like breast tumors. Breast Cancer Res. BCR 2008, 10, R53. [Google Scholar] [CrossRef] [Green Version]
- Ma, F.; Li, H.; Wang, H.; Shi, X.; Fan, Y.; Ding, X.; Lin, C.; Zhan, Q.; Qian, H.; Xu, B. Enriched CD44(+)/CD24(-) population drives the aggressive phenotypes presented in triple-negative breast cancer (TNBC). Cancer Lett. 2014, 353, 153–159. [Google Scholar] [CrossRef]
- Fillmore, C.M.; Kuperwasser, C. Human breast cancer cell lines contain stem-like cells that self-renew, give rise to phenotypically diverse progeny and survive chemotherapy. Breast Cancer Res. BCR 2008, 10, R25. [Google Scholar] [CrossRef] [Green Version]
- Horiuchi, D.; Kusdra, L.; Huskey, N.E.; Chandriani, S.; Lenburg, M.E.; Gonzalez-Angulo, A.M.; Creasman, K.J.; Bazarov, A.V.; Smyth, J.W.; Davis, S.E.; et al. MYC pathway activation in triple-negative breast cancer is synthetic lethal with CDK inhibition. J. Exp. Med. 2012, 209, 679–696. [Google Scholar] [CrossRef] [Green Version]
- Liu, P.; Tang, H.; Song, C.; Wang, J.; Chen, B.; Huang, X.; Pei, X.; Liu, L. SOX2 Promotes Cell Proliferation and Metastasis in Triple Negative Breast Cancer. Front. Pharmacol. 2018, 9, 942. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [Green Version]
- Nassar, F.J.; Nasr, R.; Talhouk, R. MicroRNAs as biomarkers for early breast cancer diagnosis, prognosis and therapy prediction. Pharmacol. Ther. 2017, 172, 34–49. [Google Scholar] [CrossRef] [PubMed]
- Loh, H.-Y.; Norman, B.P.; Lai, K.-S.; Rahman, N.M.A.N.A.; Alitheen, N.B.M.; Osman, M.A. The Regulatory Role of MicroRNAs in Breast Cancer. Int. J. Mol. Sci. 2019, 20, 4940. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J. Cancer stem cells and chemoresistance: The smartest survives the raid. Pharmacol. Ther. 2016, 160, 145–158. [Google Scholar] [CrossRef] [Green Version]
- Metzger, E.; Stepputtis, S.S.; Strietz, J.; Preca, B.T.; Urban, S.; Willmann, D.; Allen, A.; Zenk, F.; Iovino, N.; Bronsert, P.; et al. KDM4 Inhibition Targets Breast Cancer Stem-like Cells. Cancer Res. 2017, 77, 5900–5912. [Google Scholar] [CrossRef] [Green Version]
- Bozorgi, A.; Khazaei, M.; Khazaei, M.R. New Findings on Breast Cancer Stem Cells: A Review. J. Breast Cancer 2015, 18, 303–312. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.; Cong, Y.; Wang, D.; Sun, Y.; Deng, L.; Liu, Y.; Martin-Trevino, R.; Shang, L.; McDermott, S.P.; Landis, M.D.; et al. Breast cancer stem cells transition between epithelial and mesenchymal states reflective of their normal counterparts. Stem Cell Rep. 2014, 2, 78–91. [Google Scholar] [CrossRef]
- Luo, M.; Brooks, M.; Wicha, M.S. Epithelial-mesenchymal plasticity of breast cancer stem cells: Implications for metastasis and therapeutic resistance. Curr. Pharm. Des. 2015, 21, 1301–1310. [Google Scholar] [CrossRef] [Green Version]
- Grosse-Wilde, A.; Fouquier d’Herouel, A.; McIntosh, E.; Ertaylan, G.; Skupin, A.; Kuestner, R.E.; del Sol, A.; Walters, K.A.; Huang, S. Stemness of the hybrid Epithelial/Mesenchymal State in Breast Cancer and Its Association with Poor Survival. PLoS ONE 2015, 10, e0126522. [Google Scholar] [CrossRef]
- Wang, J.; Yang, M.; Li, Y.; Han, B. The Role of MicroRNAs in the Chemoresistance of Breast Cancer. Drug Dev. Res. 2015, 76, 368–374. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.; Xie, Z.; Peng, Q. MiRNA-107 enhances chemosensitivity to paclitaxel by targeting antiapoptotic factor Bcl-w in non small cell lung cancer. Am. J. Cancer Res. 2017, 7, 1863–1873. [Google Scholar] [PubMed]
- Yang, X.; Xiao, Z.; Du, X.; Huang, L.; Du, G. Silencing of the long non-coding RNA NEAT1 suppresses glioma stem-like properties through modulation of the miR-107/CDK6 pathway. Oncol. Rep. 2017, 37, 555–562. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Li, K. miR-107 regulates growth and metastasis of gastric cancer cells via activation of the PI3K-AKT signaling pathway by down-regulating FAT4. Cancer Med. 2019, 8, 5264–5273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ai, H.; Zhou, W.; Wang, Z.; Qiong, G.; Chen, Z.; Deng, S. microRNAs-107 inhibited autophagy, proliferation, and migration of breast cancer cells by targeting HMGB1. J. Cell. Biochem. 2019, 120, 8696–8705. [Google Scholar] [CrossRef] [PubMed]
- La, X.; Zhang, L.; Li, Z.; Li, H.; Yang, Y. (-)-Epigallocatechin Gallate (EGCG) Enhances the Sensitivity of Colorectal Cancer Cells to 5-FU by Inhibiting GRP78/NF-kappaB/miR-155-5p/MDR1 Pathway. J. Agric. Food Chem. 2019, 67, 2510–2518. [Google Scholar] [CrossRef]
- Luan, T.; Zhang, X.; Wang, S.; Song, Y.; Zhou, S.; Lin, J.; An, W.; Yuan, W.; Yang, Y.; Cai, H.; et al. Long non-coding RNA MIAT promotes breast cancer progression and functions as ceRNA to regulate DUSP7 expression by sponging miR-155-5p. Oncotarget 2017, 8, 76153–76164. [Google Scholar] [CrossRef]
- Baba, O.; Hasegawa, S.; Nagai, H.; Uchida, F.; Yamatoji, M.; Kanno, N.I.; Yamagata, K.; Sakai, S.; Yanagawa, T.; Bukawa, H. MicroRNA-155-5p is associated with oral squamous cell carcinoma metastasis and poor prognosis. J. Oral Pathol. Med. 2016, 45, 248–255. [Google Scholar] [CrossRef] [Green Version]
- Li, S.P.; Xu, H.X.; Yu, Y.; He, J.D.; Wang, Z.; Xu, Y.J.; Wang, C.Y.; Zhang, H.M.; Zhang, R.X.; Zhang, J.J.; et al. LncRNA HULC enhances epithelial-mesenchymal transition to promote tumorigenesis and metastasis of hepatocellular carcinoma via the miR-200a-3p/ZEB1 signaling pathway. Oncotarget 2016, 7, 42431–42446. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.; Kim, C.; Kang, H.; Tak, H.; Ahn, S.; Yoon, S.K.; Kuh, H.J.; Kim, W.; Lee, E.K. microRNA-200a-3p increases 5-fluorouracil resistance by regulating dual specificity phosphatase 6 expression. Exp. Mol. Med. 2017, 49, e327. [Google Scholar] [CrossRef] [Green Version]
- De Cola, A.; Volpe, S.; Budani, M.C.; Ferracin, M.; Lattanzio, R.; Turdo, A.; D’Agostino, D.; Capone, E.; Stassi, G.; Todaro, M.; et al. miR-205-5p-mediated downregulation of ErbB/HER receptors in breast cancer stem cells results in targeted therapy resistance. Cell Death Dis. 2015, 6, e1823. [Google Scholar] [CrossRef] [PubMed]
- Gulei, D.; Magdo, L.; Jurj, A.; Raduly, L.; Cojocneanu-Petric, R.; Moldovan, A.; Moldovan, C.; Florea, A.; Pasca, S.; Pop, L.-A.; et al. The silent healer: miR-205-5p up-regulation inhibits epithelial to mesenchymal transition in colon cancer cells by indirectly up-regulating E-cadherin expression. Cell Death Dis. 2018, 9, 66. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Xiao, L.; Mao, X.; He, J.; Ding, Y.; Huang, J.; Peng, C.; Xu, Z. miR-205-5p Mediated Downregulation of PTEN Contributes to Cisplatin Resistance in C13K Human Ovarian Cancer Cells. Front. Genet. 2018, 9, 555. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Tang, H.; Zhang, L.; Gong, L.; Wu, G.; Ni, J.; Tang, X. Suppression of miR-21-3p enhances TRAIL-mediated apoptosis in liver cancer stem cells by suppressing the PI3K/Akt/Bad cascade via regulating PTEN. Cancer Manag. Res. 2019, 11, 955–968. [Google Scholar] [CrossRef] [Green Version]
- Pink, R.C.; Samuel, P.; Massa, D.; Caley, D.P.; Brooks, S.A.; Carter, D.R. The passenger strand, miR-21-3p, plays a role in mediating cisplatin resistance in ovarian cancer cells. Gynecol. Oncol. 2015, 137, 143–151. [Google Scholar] [CrossRef]
- He, J.H.; Li, Y.G.; Han, Z.P.; Zhou, J.B.; Chen, W.M.; Lv, Y.B.; He, M.L.; Zuo, J.D.; Zheng, L. The CircRNA-ACAP2/Hsa-miR-21-5p/ Tiam1 Regulatory Feedback Circuit Affects the Proliferation, Migration, and Invasion of Colon Cancer SW480 Cells. Cell. Physiol. Biochem. 2018, 49, 1539–1550. [Google Scholar] [CrossRef]
- Wang, P.; Chen, D.; Ma, H.; Li, Y. LncRNA MEG3 enhances cisplatin sensitivity in non-small cell lung cancer by regulating miR-21-5p/SOX7 axis. OncoTargets Ther. 2017, 10, 5137–5149. [Google Scholar] [CrossRef] [Green Version]
- An, Y.; Zhang, Z.; Shang, Y.; Jiang, X.; Dong, J.; Yu, P.; Nie, Y.; Zhao, Q. miR-23b-3p regulates the chemoresistance of gastric cancer cells by targeting ATG12 and HMGB2. Cell Death Dis. 2015, 6, e1766. [Google Scholar] [CrossRef] [Green Version]
- Yang, T.; He, X.; Chen, A.; Tan, K.; Du, X. LncRNA HOTAIR contributes to the malignancy of hepatocellular carcinoma by enhancing epithelial-mesenchymal transition via sponging miR-23b-3p from ZEB1. Gene 2018, 670, 114–122. [Google Scholar] [CrossRef]
- Jiang, W.; Min, J.; Sui, X.; Qian, Y.; Liu, Y.; Liu, Z.; Zhou, H.; Li, X.; Gong, Y. MicroRNA-26a-5p and microRNA-23b-3p up-regulate peroxiredoxin III in acute myeloid leukemia. Leuk. Lymphoma 2015, 56, 460–471. [Google Scholar] [CrossRef] [Green Version]
- Kong, X.; Ding, X.; Li, X.; Gao, S.; Yang, Q. 53BP1 suppresses epithelial-mesenchymal transition by downregulating ZEB1 through microRNA-200b/429 in breast cancer. Cancer Sci. 2015, 106, 982–989. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zou, J.; Liu, L.; Wang, Q.; Yin, F.; Yang, Z.; Zhang, W.; Li, L. Downregulation of miR-429 contributes to the development of drug resistance in epithelial ovarian cancer by targeting ZEB1. Am. J. Transl. Res. 2017, 9, 1357–1368. [Google Scholar] [PubMed]
- Yang, D.; Zhan, M.; Chen, T.; Chen, W.; Zhang, Y.; Xu, S.; Yan, J.; Huang, Q.; Wang, J. miR-125b-5p enhances chemotherapy sensitivity to cisplatin by down-regulating Bcl2 in gallbladder cancer. Sci. Rep. 2017, 7, 43109. [Google Scholar] [CrossRef] [PubMed]
- De Lima, A.B.; Silva, L.M.; Goncales, N.G.; Carvalho, M.R.S.; da Silva Filho, A.L.; da Conceicao Braga, L. Three-Dimensional Cellular Arrangement in Epithelial Ovarian Cancer Cell Lines TOV-21G and SKOV-3 is Associated with Apoptosis-Related miRNA Expression Modulation. Cancer Microenviron. 2018, 11, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Li, C.F.; Li, Y.C.; Wang, Y.; Sun, L.B. The Effect of LncRNA H19/miR-194-5p Axis on the Epithelial-Mesenchymal Transition of Colorectal Adenocarcinoma. Cell. Physiol. Biochem. 2018, 50, 196–213. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, K.; Sawada, K.; Miyamoto, M.; Kinose, Y.; Yoshimura, A.; Ishida, K.; Kobayashi, M.; Shimizu, A.; Nakatsuka, E.; Hashimoto, K.; et al. Downregulation of miR-194-5p induces paclitaxel resistance in ovarian cancer cells by altering MDM2 expression. Oncotarget 2019, 10, 673–683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, S.; Noh, H.; Teng, Y.; Shao, J.; Rehmani, H.; Ding, H.F.; Dong, Z.; Su, S.B.; Shi, H.; Kim, J.; et al. SHOX2 is a direct miR-375 target and a novel epithelial-to-mesenchymal transition inducer in breast cancer cells. Neoplasia 2014, 16, 279–290. [Google Scholar] [CrossRef] [Green Version]
- Fu, H.; Fu, L.; Xie, C.; Zuo, W.S.; Liu, Y.S.; Zheng, M.Z.; Yu, J.M. miR-375 inhibits cancer stem cell phenotype and tamoxifen resistance by degrading HOXB3 in human ER-positive breast cancer. Oncol. Rep. 2017, 37, 1093–1099. [Google Scholar] [CrossRef] [Green Version]
- Shen, Y.; Zhou, J.; Li, Y.; Ye, F.; Wan, X.; Lu, W.; Xie, X.; Cheng, X. miR-375 mediated acquired chemo-resistance in cervical cancer by facilitating EMT. PLoS ONE 2014, 9, e109299. [Google Scholar] [CrossRef]
- Wang, Y.; Lieberman, R.; Pan, J.; Zhang, Q.; Du, M.; Zhang, P.; Nevalainen, M.; Kohli, M.; Shenoy, N.K.; Meng, H.; et al. miR-375 induces docetaxel resistance in prostate cancer by targeting SEC23A and YAP1. Mol. Cancer 2016, 15, 70. [Google Scholar] [CrossRef] [Green Version]
- Gu, Y.; Wei, X.; Sun, Y.; Gao, H.; Zheng, X.; Wong, L.L.; Jin, L.; Liu, N.; Hernandez, B.; Peplowska, K.; et al. miR-192-5p Silencing by Genetic Aberrations Is a Key Event in Hepatocellular Carcinomas with Cancer Stem Cell Features. Cancer Res. 2019, 79, 941–953. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; He, Y.; Lu, L.L.; Zhou, Z.Y.; Wan, N.B.; Li, G.P.; He, X.; Deng, H.W. miRNA-192-5p impacts the sensitivity of breast cancer cells to doxorubicin via targeting peptidylprolyl isomerase A. Kaohsiung J. Med. Sci. 2019, 35, 17–23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, Z.; Chen, J.S.; Wen, J.K.; Gao, H.T.; Zheng, B.; Qu, C.B.; Liu, K.L.; Zhang, M.L.; Gu, J.F.; Li, J.D.; et al. Silencing of miR-193a-5p increases the chemosensitivity of prostate cancer cells to docetaxel. J. Exp. Clin. Cancer Res. CR 2017, 36, 178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.; Gao, S.; Wang, C.; Wang, Z.; Zhang, H.; Huang, K.; Zhou, B.; Li, H.; Yu, Z.; Wu, J.; et al. Pathologically decreased expression of miR-193a contributes to metastasis by targeting WT1-E-cadherin axis in non-small cell lung cancers. J. Exp. Clin. Cancer Res. CR 2016, 35, 173. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, F.; Hosany, S.; Zhong, S.; Jiang, Y.; Zhang, F.; Lin, L.; Wang, X.; Gao, S.; Hu, X. MicroRNA-193a inhibits breast cancer proliferation and metastasis by downregulating WT1. PLoS ONE 2017, 12, e0185565. [Google Scholar] [CrossRef] [Green Version]
- Han, D.; Wang, J.; Cheng, G. LncRNA NEAT1 enhances the radio-resistance of cervical cancer via miR-193b-3p/CCND1 axis. Oncotarget 2018, 9, 2395–2409. [Google Scholar] [CrossRef] [Green Version]
- Mets, E.; Van der Meulen, J.; Van Peer, G.; Boice, M.; Mestdagh, P.; Van de Walle, I.; Lammens, T.; Goossens, S.; De Moerloose, B.; Benoit, Y.; et al. MicroRNA-193b-3p acts as a tumor suppressor by targeting the MYB oncogene in T-cell acute lymphoblastic leukemia. Leukemia 2015, 29, 798–806. [Google Scholar] [CrossRef] [Green Version]
- Song, H.; Zhang, Y.; Liu, N.; Zhao, S.; Kong, Y.; Yuan, L. miR-92a-3p Exerts Various Effects in Glioma and Glioma Stem-Like Cells Specifically Targeting CDH1/beta-Catenin and Notch-1/Akt Signaling Pathways. Int. J. Mol. Sci. 2016, 17, 1799. [Google Scholar] [CrossRef]
- Xu, P.; Wang, J.; Sun, B.; Xiao, Z. Comprehensive analysis of miRNAs expression profiles revealed potential key miRNA/mRNAs regulating colorectal cancer stem cell self-renewal. Gene 2018, 656, 30–39. [Google Scholar] [CrossRef]
- Zhang, X.; Wei, C.; Li, J.; Liu, J.; Qu, J. MicroRNA-361-5p inhibits epithelial-to-mesenchymal transition of glioma cells through targeting Twist1. Oncol. Rep. 2017, 37, 1849–1856. [Google Scholar] [CrossRef]
- Tian, L.; Zhao, Z.; Xie, L.; Zhu, J. MiR-361-5p suppresses chemoresistance of gastric cancer cells by targeting FOXM1 via the PI3K/Akt/mTOR pathway. Oncotarget 2018, 9, 4886–4896. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; Zhao, S.; Yu, M. Mechanism of Low Expression of miR-30a-5p on Epithelial-Mesenchymal Transition and Metastasis in Ovarian Cancer. DNA Cell Biol. 2019, 38, 341–351. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, J.; Liu, Y.; Zhang, B.; Zhong, F.; Wang, S.; Fang, Z. MiR-30a-5p confers cisplatin resistance by regulating IGF1R expression in melanoma cells. BMC Cancer 2018, 18, 404. [Google Scholar] [CrossRef] [PubMed]
- Morata-Tarifa, C.; Jimenez, G.; Garcia, M.A.; Entrena, J.M.; Grinan-Lison, C.; Aguilera, M.; Picon-Ruiz, M.; Marchal, J.A. Low adherent cancer cell subpopulations are enriched in tumorigenic and metastatic epithelial-to-mesenchymal transition-induced cancer stem-like cells. Sci. Rep. 2016, 6, 18772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qin, X.; Yu, S.; Zhou, L.; Shi, M.; Hu, Y.; Xu, X.; Shen, B.; Liu, S.; Yan, D.; Feng, J. Cisplatin-resistant lung cancer cell-derived exosomes increase cisplatin resistance of recipient cells in exosomal miR-100-5p-dependent manner. Int. J. Nanomed. 2017, 12, 3721–3733. [Google Scholar] [CrossRef] [Green Version]
- Li, L.; Li, S. miR-205-5p inhibits cell migration and invasion in prostatic carcinoma by targeting ZEB1. Oncol. Lett. 2018, 16, 1715–1721. [Google Scholar] [CrossRef] [Green Version]
- Yamada, A.; Ishikawa, T.; Ota, I.; Kimura, M.; Shimizu, D.; Tanabe, M.; Chishima, T.; Sasaki, T.; Ichikawa, Y.; Morita, S.; et al. High expression of ATP-binding cassette transporter ABCC11 in breast tumors is associated with aggressive subtypes and low disease-free survival. Breast Cancer Res. Treat. 2013, 137, 773–782. [Google Scholar] [CrossRef]
- Simoes-Wust, A.P.; Schurpf, T.; Hall, J.; Stahel, R.A.; Zangemeister-Wittke, U. Bcl-2/bcl-xL bispecific antisense treatment sensitizes breast carcinoma cells to doxorubicin, paclitaxel and cyclophosphamide. Breast Cancer Res. Treat. 2002, 76, 157–166. [Google Scholar] [CrossRef]
- Inao, T.; Iida, Y.; Moritani, T.; Okimoto, T.; Tanino, R.; Kotani, H.; Harada, M. Bcl-2 inhibition sensitizes triple-negative human breast cancer cells to doxorubicin. Oncotarget 2018, 9, 25545–25556. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Iliopoulos, D.; Zhang, Q.; Tang, Q.; Greenblatt, M.B.; Hatziapostolou, M.; Lim, E.; Tam, W.L.; Ni, M.; Chen, Y.; et al. XBP1 promotes triple-negative breast cancer by controlling the HIF1alpha pathway. Nature 2014, 508, 103–107. [Google Scholar] [CrossRef]
- Nedeljkovic, M.; Damjanovic, A. Mechanisms of Chemotherapy Resistance in Triple-Negative Breast Cancer-How We Can Rise to the Challenge. Cells 2019, 8, 957. [Google Scholar] [CrossRef] [Green Version]
- Martin, J.H.; Dimmitt, S. The rationale of dose–response curves in selecting cancer drug dosing. Br. J. Clin. Pharmacol. 2019, 85, 2198–2204. [Google Scholar] [CrossRef]
- McDermott, M.; Eustace, A.J.; Busschots, S.; Breen, L.; Crown, J.; Clynes, M.; O’Donovan, N.; Stordal, B. In vitro Development of Chemotherapy and Targeted Therapy Drug-Resistant Cancer Cell Lines: A Practical Guide with Case Studies. Front. Oncol. 2014, 4, 40. [Google Scholar] [CrossRef] [Green Version]
- Morel, A.P.; Lievre, M.; Thomas, C.; Hinkal, G.; Ansieau, S.; Puisieux, A. Generation of breast cancer stem cells through epithelial-mesenchymal transition. PLoS ONE 2008, 3, e2888. [Google Scholar] [CrossRef]
- De Craene, B.; Berx, G. Regulatory networks defining EMT during cancer initiation and progression. Nat. Rev. Cancer 2013, 13, 97–110. [Google Scholar] [CrossRef]
- Nieto, M.A.; Huang, R.Y.; Jackson, R.A.; Thiery, J.P. Emt: 2016. Cell 2016, 166, 21–45. [Google Scholar] [CrossRef] [Green Version]
- Guo, W.; Keckesova, Z.; Donaher, J.L.; Shibue, T.; Tischler, V.; Reinhardt, F.; Itzkovitz, S.; Noske, A.; Zurrer-Hardi, U.; Bell, G.; et al. Slug and Sox9 cooperatively determine the mammary stem cell state. Cell 2012, 148, 1015–1028. [Google Scholar] [CrossRef] [Green Version]
- Spaderna, S.; Schmalhofer, O.; Wahlbuhl, M.; Dimmler, A.; Bauer, K.; Sultan, A.; Hlubek, F.; Jung, A.; Strand, D.; Eger, A.; et al. The transcriptional repressor ZEB1 promotes metastasis and loss of cell polarity in cancer. Cancer Res. 2008, 68, 537–544. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Mani, S.A.; Donaher, J.L.; Ramaswamy, S.; Itzykson, R.A.; Come, C.; Savagner, P.; Gitelman, I.; Richardson, A.; Weinberg, R.A. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 2004, 117, 927–939. [Google Scholar] [CrossRef] [Green Version]
- Schaeffer, D.; Somarelli, J.A.; Hanna, G.; Palmer, G.M.; Garcia-Blanco, M.A. Cellular migration and invasion uncoupled: Increased migration is not an inexorable consequence of epithelial-to-mesenchymal transition. Mol. Cell. Biol. 2014, 34, 3486–3499. [Google Scholar] [CrossRef] [Green Version]
- Campbell, K.; Casanova, J. A common framework for EMT and collective cell migration. Development 2016, 143, 4291. [Google Scholar] [CrossRef] [Green Version]
- Cai, D.; Chen, S.C.; Prasad, M.; He, L.; Wang, X.; Choesmel-Cadamuro, V.; Sawyer, J.K.; Danuser, G.; Montell, D.J. Mechanical feedback through E-cadherin promotes direction sensing during collective cell migration. Cell 2014, 157, 1146–1159. [Google Scholar] [CrossRef] [Green Version]
- Shamir, E.R.; Pappalardo, E.; Jorgens, D.M.; Coutinho, K.; Tsai, W.-T.; Aziz, K.; Auer, M.; Tran, P.T.; Bader, J.S.; Ewald, A.J. Twist1-induced dissemination preserves epithelial identity and requires E-cadherin. J. Cell Biol. 2014, 204, 839. [Google Scholar] [CrossRef]
- Elkin, M.; Vlodavsky, I. Tail vein assay of cancer metastasis. Curr. Protoc. Cell Biol. 2001, 12, 19–22. [Google Scholar] [CrossRef]
- Edwards, L.A.; Li, A.; Berel, D.; Madany, M.; Kim, N.H.; Liu, M.; Hymowitz, M.; Uy, B.; Jung, R.; Xu, M.; et al. ZEB1 regulates glioma stemness through LIF repression. Sci. Rep. 2017, 7, 69. [Google Scholar] [CrossRef]
- Clarke, M.F.; Dick, J.E.; Dirks, P.B.; Eaves, C.J.; Jamieson, C.H.; Jones, D.L.; Visvader, J.; Weissman, I.L.; Wahl, G.M. Cancer stem cells--perspectives on current status and future directions: AACR Workshop on cancer stem cells. Cancer Res. 2006, 66, 9339–9344. [Google Scholar] [CrossRef] [Green Version]
- Castro, F.; Dirks, W.G.; Fähnrich, S.; Hotz-Wagenblatt, A.; Pawlita, M.; Schmitt, M. High-throughput SNP-based authentication of human cell lines. Int. J. Cancer 2013, 132, 308–314. [Google Scholar] [CrossRef] [Green Version]
- Wolff, A.C.; Hammond, M.E.; Schwartz, J.N.; Hagerty, K.L.; Allred, D.C.; Cote, R.J.; Dowsett, M.; Fitzgibbons, P.L.; Hanna, W.M.; Langer, A.; et al. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer. Arch. Pathol. Lab. Med. 2007, 131, 18–43. [Google Scholar] [CrossRef] [Green Version]
- Goldhirsch, A.; Winer, E.P.; Coates, A.S.; Gelber, R.D.; Piccart-Gebhart, M.; Thürlimann, B.; Senn, H.J.; Panel, M. Personalizing the treatment of women with early breast cancer: Highlights of the St Gallen International Expert Consensus on the Primary Therapy of Early Breast Cancer 2013. Ann. Oncol. 2013, 24, 2206–2223. [Google Scholar] [CrossRef]
ID | Doxorubicin | Paclitaxel |
---|---|---|
BCSC1 | 30 ng/mL | 3 ng/mL |
BCSC2 | 30 ng/mL | 3 ng/mL |
BCSC5 | 3 ng/mL | 1 ng/mL |
miRNA | Cancer Types Reported Relevant to EMT, Chemotherapy and Stemness | Reference |
---|---|---|
hsa-miR-107 | NCLC, glioma, gastric cancer, breast cancer. | [22,23,24,25] |
hsa-miR-155-5p | Colorectal cancer, breast cancer, oral squamous cell carcinoma. | [26,27,28] |
hsa-miR-200a-3p | Hepatocellular carcinoma. | [29,30] |
hsa-miR-205-5p | Breast cancer, colon cancer, ovarian cancer. | [31,32,33] |
hsa-miR-21-3p | Liver cancer, ovarian cancer. | [34,35] |
hsa-miR-21-5p | Colon cancer, NCLC. | [36,37] |
hsa-miR-23b-3p | Gastric cancer, hepatocellular carcinoma, acute myeloid leukemia. | [38,39,40] |
hsa-miR-429 | Breast cancer, ovarian cancer. | [41,42] |
hsa-miR-125b-5p | Gallbladder cancer, ovarian cancer. | [43,44] |
hsa-miR-194-5p | Colorectal adenocarcinoma, ovarian cancer. | [45,46] |
hsa-miR-375 | Breast cancer, cervical cancer, prostate cancer. | [47,48,49,50] |
hsa-miR-192-5p | Hepatocellular carcinoma, breast cancer. | [51,52] |
hsa-miR-193a-5p | Prostate cancer, NCLC, breast cancer. | [53,54,55] |
hsa-miR-193b-3p | Cervical cancer, T-cell acute lymphoblastic leukemia. | [56,57] |
hsa-miR-92a-3p | Glioma, colorectal cancer. | [58,59] |
hsa-miR-361-5p | Glioma, gastric cancer. | [60,61] |
hsa-miR-30a-5p | Ovarian Cancer, melanoma. | [62,63] |
hsa-miR-100-5p | Breast cancer, lung cancer. | [64,65] |
Genes | Forward Primer | Reverse Primer | Probes |
---|---|---|---|
ACTB | CCAACCGCGAGAAGATGA | CCAGAGGCGTACAGGGATAG | No. 64 |
E-cadherin | CCCGGGACAACGTTTATTAC | GCTGGCTCAAGTCAAAGTCC | No. 35 |
Vimentin | GACCAGCTAACCAACGACAAA | GAAGCATCTCCTCCTGCAAT | No. 39 |
ZEB1 | AACTGCTGGGAGGATGACAC | TCCTGCTTCATCTGCCTGA | No. 57 |
Slug | TGGTTGCTTCAAGGACACAT | GCAAATGCTCTGTTGCAGTG | No. 7 |
Snail | GCTGCAGGACTCTAATCCAGA | ATCTCCGGAGGTGGGATG | No. 11 |
Twist1 | AGCTACGCCTTCTCGGTCT | CCTTCTCTGGAAACAATGACATC | No. 58 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Strietz, J.; Bleilevens, A.; Stickeler, E.; Maurer, J. Chemotherapeutic Stress Influences Epithelial–Mesenchymal Transition and Stemness in Cancer Stem Cells of Triple-Negative Breast Cancer. Int. J. Mol. Sci. 2020, 21, 404. https://doi.org/10.3390/ijms21020404
Li X, Strietz J, Bleilevens A, Stickeler E, Maurer J. Chemotherapeutic Stress Influences Epithelial–Mesenchymal Transition and Stemness in Cancer Stem Cells of Triple-Negative Breast Cancer. International Journal of Molecular Sciences. 2020; 21(2):404. https://doi.org/10.3390/ijms21020404
Chicago/Turabian StyleLi, Xiao, Juliane Strietz, Andreas Bleilevens, Elmar Stickeler, and Jochen Maurer. 2020. "Chemotherapeutic Stress Influences Epithelial–Mesenchymal Transition and Stemness in Cancer Stem Cells of Triple-Negative Breast Cancer" International Journal of Molecular Sciences 21, no. 2: 404. https://doi.org/10.3390/ijms21020404
APA StyleLi, X., Strietz, J., Bleilevens, A., Stickeler, E., & Maurer, J. (2020). Chemotherapeutic Stress Influences Epithelial–Mesenchymal Transition and Stemness in Cancer Stem Cells of Triple-Negative Breast Cancer. International Journal of Molecular Sciences, 21(2), 404. https://doi.org/10.3390/ijms21020404