Next Article in Journal
Application of an Inter-Species Extrapolation Method for the Prediction of Drug Interactions between Propolis and Duloxetine in Humans
Previous Article in Journal
A Link between Genetic Disorders and Cellular Impairment, Using Human Induced Pluripotent Stem Cells to Reveal the Functional Consequences of Copy Number Variations in the Central Nervous System—A Close Look at Chromosome 15
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 21
Issue 5
10.3390/ijms21051861
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization and Evaluation of Resistance to Powdery Mildew of Wheat–Aegilops geniculata Roth 7Mg (7A) Alien Disomic Substitution Line W16998

by
Yajuan Wang
1,2,3,†,
Deyu Long
1,†,
Yanzhen Wang
1,
Changyou Wang
1,2,3,
Xinlun Liu
1,2,3,
Hong Zhang
1,2,3,
Zengrong Tian
1,2,3,
Chunhuan Chen
1,2,3 and
Wanquan Ji
1,2,3,*
1
College of Agronomy, Northwest A&F University, Yangling 712100, China
2
State Key Laboratory of Crop Stress Biology for Arid Areas, Yangling 712100, China
3
Shaanxi Research Station of Crop Gene Resources and Germplasm Enhancement, Ministry of Agriculture, Yangling 712100, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2020, 21(5), 1861; https://doi.org/10.3390/ijms21051861
Submission received: 12 February 2020 / Revised: 29 February 2020 / Accepted: 5 March 2020 / Published: 9 March 2020
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Review Reports Versions Notes

Abstract

:
Aegilops geniculata Roth has been used as a donor of disease-resistance genes, to enrich the gene pool for wheat (Triticum aestivum) improvement through distant hybridization. In this study, the wheat–Ae. geniculata alien disomic substitution line W16998 was obtained from the BC1F8 progeny of a cross between the common wheat ‘Chinese Spring’ (CS) and Ae. geniculata Roth (serial number: SY159//CS). This line was identified using cytogenetic techniques, analysis of genomic in situ hybridization (GISH), functional molecular markers (Expressed sequence tag-sequence-tagged site (EST–STS) and PCR-based landmark unique gene (PLUG), fluorescence in situ hybridization (FISH), sequential fluorescence in situ hybridization–genomic in situ hybridization (sequential FISH–GISH), and assessment of agronomic traits and powdery mildew resistance. During the anaphase of meiosis, these were evenly distributed on both sides of the equatorial plate, and they exhibited high cytological stability during the meiotic metaphase and anaphase. GISH analysis indicated that W16998 contained a pair of Ae. geniculata alien chromosomes and 40 common wheat chromosomes. One EST–STS marker and seven PLUG marker results showed that the introduced chromosomes of Ae. geniculata belonged to homoeologous group 7. Nullisomic–tetrasomic analyses suggested that the common wheat chromosome, 7A, was absent in W16998. FISH and sequential FISH–GISH analyses confirmed that the introduced Ae. geniculata chromosome was 7Mg. Therefore, W16998 was a wheat–Ae. geniculata 7Mg (7A) alien disomic substitution line. Inoculation of isolate E09 (Blumeria graminis f. sp. tritici) in the seedling stage showed that SY159 and W16998 were resistant to powdery mildew, indeed nearly immune, whereas CS was highly susceptible. Compared to CS, W16998 exhibited increased grain weight and more spikelets, and a greater number of superior agronomic traits. Consequently, W16998 was potentially useful. Germplasms transfer new disease-resistance genes and prominent agronomic traits into common wheat, giving the latter some fine properties for breeding.

1. Introduction

Given ongoing population growth and conflicting resource demands, improvement of wheat (Triticum aestivum L.) yield is increasingly challenging. Loss of genetic diversity not only limits further improvement of quality and yield, but also increases the vulnerability of wheat to abiotic and biotic stresses. Powdery mildew caused by Blumeria graminis (DC.) Speer f. sp. tritici Em. Marchal (Bgt) is the most destructive wheat disease in the world [1]. The pathogen can attack all above-ground wheat parts, including spikes, leaves and stems. The consequence of using pesticides in large quantities is that the environment becomes polluted and costs are increased, so the breeding of resistant cultivars is the safest, and environmentally effective approach to prevent epidemics of the disease [2]. Accurate evaluation and effective utilization of resistant germplasms are prerequisites for the development of resistant cultivars. This is necessary to improve wheat disease resistance, enable screening of large germplasm resources, and enable the transfer and polymerization of resistance genes. It is an increasingly important approach for enriching common wheat with beneficial genes derived from related species by distant hybridization [3,4,5]. Many powdery mildew resistance genes are derived from wild relatives of wheat, and have been introduced to common wheat by additions, substitutions, and translocations of chromosomes. For example, Pm21 and Pm55 are derived from Haynaldia villosa Schur [6,7], and Pm40 is derived from Elytrigia intermedia (Host) Nevski [8]. Pm12, Pm32, and Pm53 are derived from Aegilops speltoides Tausch [9,10,11]. Pm13 is derived from Ae. longissima Schweinf. and Muschl. [12], Pm57 is derived from Ae. searsii Feldman and Kislev [13], and Pm43 is derived from Thinopyrum intermedium (Host) Barkworth and D.R.Dewey [14]. Thus, the introduction of resistance genes from wild relatives is imperative and effective approach for broadening the genetic background of wheat.
Ae. geniculata Roth (ovate goatgrass; syn. Ae. ovata L. pro parte, 2n = 4x = 28, UgUgMgMg), a wild relative of annual wheat, contains many excellent traits for wheat breeding, such as high grain protein content, disease resistance and pest resistance [15,16,17,18], high grain iron and zinc content, early maturity [19], drought and heat adaption [15], and salt tolerance [20]. Ae. geniculata is a useful genetic resource for the improvement of cultivated bread (or common) wheat, because it is highly cross-compatible with common wheat [21]. A complete set of wheat–Ae. geniculata alien disomic addition lines was developed by Friebe et al. [22]. In 2007, Kuraparthy discovered two new disease-resistant genes in 5Mg of Ae. geniculata: stripe rust resistance gene Yr40 and leaf rust resistance gene Lr57 [23]. In 2002, Zeller found powdery mildew resistance gene Pm29 in Ae. geniculata, and proved it is located on 7D chromosome. Ae. geniculata has broad potential for genetic improvements in wheat breeding [24].
In order to utilize the Ae. geniculate resistance genes in wheat, distant hybridization between the common wheat ‘Chinese Spring’ (CS) and Ae. geniculata SY159 has been carried out since 2009, backcrossing in F1 using CS, a series of wheat Ae. geniculata hybrids, including alien disomic addition line NA0973-5-4-1-2-9-1 [4], and some unrecognized hybrids. Among wheat–Ae. geniculate derivative lines, a new wheat–Ae. geniculate chromosome substitution line W16998 exhibited high resistance to powdery mildew in wheat-growing regions. In this study, the objectives were: (1) to determine the chromosome numbers and genomic composition of the alien chromosomes using cytogenetic analysis and GISH (genomic in situ hybridization) identification of line W16998; (2) to determine the homologous group relationships of introduced Ae. geniculata chromosomes, using molecular markers, FISH (fluorescence in situ hybridization) and sequential FISH–GISH analysis, and nullisomic–tetrasomic analysis of CS; (3) to investigate agronomic character and powdery mildew resistance.

2. Results

2.1. Cytological Characterization

The results of cytological observation indicated that the root tip chromosome numbers were 2n = 42 (Figure 1A). We looked at 120 root tip cells: 113 cells had 42 chromosomes, comprising 94.17% of the total number of observations. A total of 61 pollen mother cells were observed: 56 pollen mother cells had a value of 2n = 21II in meiotic metaphase (Figure 1B). No trivalents or quadrivalents were observed at meiotic metaphase I. No laggard chromosomes were observed at meiotic anaphase I and chromosomes were distributed evenly on both sides of the equatorial plate (Figure 1C). Therefore, the line W16998 exhibited high cytological stability.
To determine the numbers of alien chromosomes of the derived line, W16998 was analyzed by GISH, using SY159 genomic DNA as the probe and CS as barrier. The result was that, there, two chromosomes exhibited strong green hybridization signals in the root tip cells (Figure 2). These results indicate that W16998 comprised two Ae. geniculata chromosomes and 40 common wheat chromosomes.

2.2. Molecular Marker Analysis

In order to clarify the relationship of the Ae. geniculata homologous chromosome group to the alien disomic substitution line W16998, we analyzed the distribution of 300 EST–STS and PLUG markers on seven homologous groups of wheat. The data reveal that 112 primers (37.3%) had polymorphisms between CS and SY159. Eight primers (7.1%) had distinctive bands amplified in SY159, W16998 and CS. These eight markers (BE637663-7AL 7BL 7DL (EST–STS), TNAC1868-7AL 7BL 7DL, TNAC1782-7AS 7BS 7DS, TNAC1829-7AS 7BS 7DS, TNAC1845-7AL 7BL 7DL, TNAC1888-7AL 7BL 7DL, TNAC1929-7AL 7BL 7DL, and TNAC1941-7AS 7BS 7DS (PLUG)) were mapped to the seventh homologous group. This is evidence that these markers were specific markers of Ae. geniculata chromosomes in W16998 (Table 1, Figure 3). This shows that Ae. geniculata 7Ug or 7Mg chromosomes were introduced into common wheat CS. In other words, these chromosomal components had Ae. geniculata 7Ug or 7Mg chromosomes.

2.3. Nullisomic–Tetrasomic Analysis

These marker results indicate that two alien chromosomes were homoeologous with the wheat group 7 chromosomes. On the basis of amplification of the nullisomic–tetrasomic lines of CS, the homoeologous group 7 PLUG markers amplified specific bands for wheat chromosomes 7A, 7B and 7D. Ultimately, two PLUG markers, TNAC1868-Taql and TNAC1941-Taql, clearly amplified fragments of chromosomes 7A, 7B, and 7D in CS, and Ae. geniculata-specific bands were detected in W16998 (Figure 4). These results verify that the Ae. geniculata chromosomes introduced into W16998 belonged to the seventh homologous group, and the chromosome 7A-specific band was absent in W16998.

2.4. FISH and Sequential FISH–GISH Analysis

To determine the identity of the wheat chromosomes replaced by Ae. geniculata chromosomes in W16998, FISH and sequential FISH–GISH analyses were performed. Oligo-pSc 119.2 (green signal) and Oligo-pTa535 (red signal), two oligonucleotide probes, were able to clearly distinguish the 42 wheat chromosomes simultaneously [25]. Compared with the FISH karyotype of CS (Figure 5A) and W16998 (Figure 5C), it was shown that one pair of 7A wheat chromosomes was absent in W16998. These results accorded with the results of nulli-tetrasomic analysis. One pair of chromosomes in W16998 showed special signals. One pair of the alien chromosomes carried red signal (pTa535) on both ends, in contrast with the FISH analysis of the 7Mg alien disomic addition lines NA0973-5-4-1-2-9-1 (Figure 5B). This pair of specific chromosomes in W16998 (Figure 5C) is highly similar to the 7Mg chromosome (Figure 5B). The results of sequential FISH–GISH analysis show that this pair of specific chromosomes in W16998 has strong signs of Ae. geniculate. To sum up, based on FISH analysis combined with nulli-terasomic analysis, and on functional molecular marker screening in combination with sequential FISH-GISH observation, W16998 was designated a wheat–Ae. geniculata 7Mg (7A) alien disomic substitution line.
Interestingly, an additional strong green signal (Oligo-pSc119.2) appeared on the end of the short arm of chromosome 1A in W16998 (Figure 5C). This was different from the FISH karyotype of CS, with NA0973-5-4-1-2-9-1 of 7Mg alien disomic addition lines on the end of the short arm of chromosome 1A. Other common wheats have no green signal (Oligo-pSc119.2). We have marked it with white arrows (Figure 5A–C).

2.5. Evaluation of Powdery Mildew Resistance and Agronomic Traits

In 2018 and 2019, at the seedling stage, we planted 30 plants each of CS, SY159 and W16998. These were inoculated using the Bgt isolate E09 of powdery mildew, and their susceptibility compared to that of ‘Shaanyou 225’. At 15 days after inoculation, when the powdery mildew spores were fully developed on the leaves of the ‘Shaanyou 225’, the results showed that the SY159 and W16998 plants were nearly immune to powdery mildew. In contrast, CS was highly susceptible (Figure 6E). These results suggested that the wheat–Ae. geniculata 7Mg alien disomic substitution line inherited a high degree of powdery mildew resistance from Ae. geniculata.
The average spikes of W16998 plants were bulkier than those of CS, and the spikes bore long awns similar to those of the parent Ae. geniculata SY159 (Figure 6A). On average, the tillers of W16998 were higher than those of CS, but shorter than those of SY159. The average number of kernels per spike and the 1000-grain weight of W16998 were significantly higher than in CS and SY159. The number of kernels per spike was 50 grains. The 1000-grain weight was 40 g (Table 2), which was significantly higher, according to Duncan’s multiple range test (p < 0.01).

3. Discussion

Chromosome engineering research is important for wheat breeders, to develop new disease-resistant germplasms and broaden the genetic base [17,26,27,28]. Friebe et al. [22] reported that the Ae. geniculata (accession TA2899) was crossed (as the male parent) with CS, to obtain a complete set of wheat–Ae. geniculata chromosome addition lines, where TA7667 was an Ae. geniculata 7Mg alien disomic addition line. Wang et al. [18] reported the NA0973-5-4-1-2-9-1 of a wheat–Ae. geniculata 7Mg alien disomic addition line (Ae. geniculata accession: SY159) after inoculation with Bgt isolate E09: NA0973-5-4-1-2-9-1 showed almost immune to powdery mildew, whereas TA7667 was susceptible. Meanwhile, Zeller et al. [24] conducted chromosomal mapping of the powdery mildew resistance gene Pm29 in the common mildew-resistant wheat line Pova, derived from the wheat ‘Poros’–Ae. geniculata (accession TA2899) alien addition line. The Bgt races used in the study were collected from different parts of Europe and selected from single spore progenies. On the basis of the afore-mentioned information, W16998 contains a novel powdery mildew resistance gene different to Pm29. These results suggest that the 7Mg chromosomes of Ae. geniculata contain valuable powdery mildew resistance genes for the genetic improvement of wheat. However, it is important and necessary to continue to study and map powdery mildew resistance genes from Ae. geniculata 7Mg line W16998.
It is an important part of genetic wheat improvement to introduce beneficial genes from other species into common wheat by means of distant hybridization. The techniques of FISH and GISH analysis can not only determine the constitution and number of chromosomes, but can also detect alien chromosomes or introgressive segments introduced into common wheat’s genetic background efficiently and accurately [29,30]. FISH and GISH have high sensitivity, are simple to program, generate obvious contrast, and can detect multiple probes at the same time. These characteristics have quickly turned them into mainstream techniques for in situ hybridization. For instance, Mariyana Georgieva reported that line 55 (1–57) contained 42 wheat chromosomes and six Th. intermedium pairs, including two S and one JS pairs, while line H95 contained 44 wheat chromosomes and four Thinopyrum chromosome pairs—including one J chromosome and three S pairs—using GISH. FISH analysis detected a null (1D)-tetrasomy (1B) in 55(1–57) and a 6B tetrasomy in H95 [31]. In addition, various forms of functional molecular markers are also highly effective, display good stability, are easy to operate and are low-cost. Using molecular markers can not only reliably identify alien chromosomes or introgressive fragments in wheat’s genetic background, but can also be used to define the homoeologous group relationships of alien chromosomes from related species [32]. For example, EST and PLUG markers have been used to identify the homoeologous group relationship of alien chromosomes’ widespread availability [33]. In this study, GISH analysis showed that W16998 incorporated two alien chromosomes from Ae. geniculata. Using functional molecular markers, nullisomic–tetrasomic analysis FISH and FISH–GISH methods showed that the two alien Ae. geniculata chromosomes in W16998 belonged to homoeologous group 7 (Figure 3), the common wheat chromosome, 7A, was replaced in W16998. This substitution might be the result of a chain of events, such as asymmetrical bivalent formation and subsequent gametic selection. Chromosomes 7A and 7Mg of W16998 have high homology; the produced chromosomes exchange and recombine during the separation of progeny. According to previously published studies, chromosome structure recombination, chromosome constitution variation, and genomic changes can trigger occasionally during the process of interspecific hybridization or allopolyploidization. This is referred to as “genome shock” [34,35]. In previous papers, the presence of pSc119.2 sites was variable [36,37]. Interestingly, structural differences in chromosomes between CS and W16998 were detected, based on differences in the signal of the Oligo-pSc119.2 probe on the short arm of chromosome 1A (Figure 5). This observation indicates that wheat chromosomes may experience extensive restructuring and structural alterations, as well as wheat–wheat translocations, when common wheat is crossed with relatively wild species [22,25,34]. This might be due to an undetected translocation, or to an increase in the copy number at the target spot [38], but further study is necessary for validation.
Kernels per spike are one of the three factors determining wheat yield. It is very important to create new germplasm with multi-grain characteristics through distant hybridization. Breeding for large spikes by increasing the number of kernels per spike is an option for improving the yield potential of wheat [39,40]. Haynaldia, Elytrigia, Leymus, Aegilops, Secale, and others, have all been successfully hybridized with common wheat: the offspring germplasm contains large spikes, higher numbers of spikelets, more kernels per spike and more florets [41,42]. Wu et al. [41] reported introgression from the 6P chromosome of Agropyron cristatum, conferring increased numbers of florets and kernels. This was the first reported transfer of an A. cristatum chromosome to common wheat, and enhanced the floret and kernel numbers of the wheat. Friebe et al. [22] showed that spikes in the 4Mg alien disomic addition line contain more florets than usual. In the present study, W16998 showed a relatively greater number of superior agronomic traits compared to its parents. In particular, the W16998 line produced longer spikes, more tillers, more spikelets per spike, more kernels per spikelet, and more kernels per spike, and 1000-grain weight was increased (Figure 6, Table 2). Consequently, the wheat–Ae. geniculata 7Mg (7A) alien disomic substitution line W16998, on account of its desirable agronomic characteristics and strong powdery mildew resistance, may be useful as a novel donor source for wheat chromosome engineering breeding.

4. Materials and Methods

4.1. Materials

Ae. geniculata (No. SY159) was provided by Dr. Lihui Li and Dr. Xinming Yang of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China. This genotype is resistant or almost resistant to mixed Bgt isolates in northern China. The ‘Chinese Spring’ (CS) wheat and SY159 began a process of distant hybridization in 2008. The individual plants in F1 were backcrossed with CS. The disomic substitution line W16998 was isolated from the BC1F8 progeny, which exhibited resistance powdery mildew in the field, and somatic cell chromosome number 2n = 42, in 2018 and 2019. CS and its nulli–tetrasomic lines (CSN7AT7B, CSN7AT7D, CSN7BT7A, and CSN7DT7A) were used in a molecular cytogenetic analysis to determine the chromosomal location. NA0973-5-4-1-2-9-1 (CS-AEGEN DA 7Mg), with 7Mg chromosomes from Ae. geniculate, was used as a control [18]. The wheat ‘Shaanyou 225′ was used as a mildew-susceptible control in tests of powdery mildew resistance. The Bgt isolate E09 is a widely prevalent isolate, and was used to test powdery mildew resistance [43]. All of the above-mentioned materials were obtained from the College of Agronomy, Northwest A&F University, China.

4.2. Cytological Observation

The seeds were immersed in water on a wet petri dish with filter paper at room temperature for 1 day, until they germinated and become white. Following germination, they were placed in darkness in a constant-temperature incubator at 23 °C. When the root tips grew to 2–4 cm, they were excised, put into a centrifuge tube, and pretreated with nitrous oxide for two hours. They were then fixed in 95% acetic acid for 10 min and placed in 70% ethanol. The root tips were treated with 1% pectinase and 2% cellulose at 37 °C for 1 h, using a production process described by Han et al. [44]. At the appropriate stage of development, young panicles were excised and put into a tube of ethanol–chloroform–acetic acid solution (6:3:1, v/v/v) for one week at 25–30 °C. Anthers were extracted and squashed on a slide in 1% acetocarmine. The number of root tip chromosome and pollen mother cell chromosome pairs was observed with a light microscope and photographed.

4.3. GISH, FISH and Sequential FISH–GISH

The genomic DNA of Ae. geniculata SY159 was used as the probe for GISH, and the genomic DNA of CS was used as blocking DNA. The Ae. geniculata genomic DNA was labeled with fluorescein-12-dUTP. The GISH procedure was performed as described by Fu [29] and Pei [45], with minor modifications. The oligonucleotide probes Oligo-pTa535 (red) and Oligo-pSc119.2 (green) (Shanghai Invitrogen Biotechnology Co. Ltd., Shanghai, China) were used for FISH and sequential FISH–GISH analysis, as described by Tang et al. [25]. The results of in situ hybridization and fluorescent signals were viewed and photographed with an Olympus BX-43 microscope equipped with a DP80 camera [4].

4.4. EST–STS and PLUG Markers Analysis

Expressed sequence tag–sequence-tagged site (EST–STS) markers were selected from the Wheat Haplotype Polymorphisms Website (http://wheat.pw.usda.gov/SNP/new/pcr_primers.shtml). PCR-based landmark unique gene (PLUG) markers were synthesized by AuGCT DNA-SYN Biotechnology Co., Ltd., Beijing, China [31,46]. These markers come from homoeologous groups 1 to 7 in wheat chromosomes. The PCR amplification and electrophoresis procedures were as described previously [4,31].

4.5. Powdery Mildew Resistance and Agronomic Trait Evaluation

CS, SY159, W16998, and ‘Shaanyou 225′ were used to evaluate to powdery mildew resistance at the seedling stage in the greenhouse. The infection type was recorded for 30 plants, as previously described [47,48]. At two weeks after inoculation with Bgt isolate E09, when the powdery mildew spores of ‘Shaanyou 225′ were fully infected, the plants were investigated and infection type (IT) was evaluated. Survey results were recorded using a 0–4 scale. Plants with IT of 0–2 were judged resistant to powdery mildew, whereas plants with IT of 3–4 were judged susceptible to powdery mildew.
The morphological traits of line W16998, and its parents CS and SY159, were assessed at the physiological maturity stage in 2018 and 2019, in the field. Ten plants were selected randomly and their agronomic traits were recorded, including plant height, tillering, spke length, number of kernels per spike, number of spikelets per spike, number of kernels per spikelet, 1000-grain weight, and awnedness [4]. All agronomic trait data were analyzed using Duncan’s multiple range test, and significant differences were found (p < 0.01).

5. Conclusions

In this work, we have characterized and identified line W16998 from the BC1F8 progeny of crossing between ‘Chinese Spring’ (CS) wheat and Ae. geniculata SY159, using cytology, GISH analysis, EST–STS, PLUG analysis, FISH analysis, sequential FISH–GISH analysis, and disease resistance assessment. The results showed that line W16998 was a wheat–Ae. geniculata 7Mg (7A) alien disomic substitution line, with substitution conferring powdery mildew resistance. This substitution line is potentially useful. Germplasms transfer new disease-resistance genes and determine prominent agronomic traits for wheat breeding and chromosome engineering.

Author Contributions

Y.W. (Yajuan Wang) and W.J. designed the study, analyzed the data and wrote the article. Y.W. (Yajuan Wang) and D.L. performed the research. Y.W. (Yajuan Wang), C.W. and X.L. contributed to the development of material. Y.W. (Yajuan Wang), D.L. and Y.W. (Yanzhen Wang) contributed to cytological analysis. H.Z., Z.T. and C.C. contributed to powdery mildew resistance and agronomic trait evaluation. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China (No. 2016YFD0100102), the National Natural Science Foundation China (No. 31471481), and Crop Germplasm Resources Protection (No. 2019NWB036-02-1).

Acknowledgments

We would like to thank Robert McKenzie to edited language of this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ullah, K.N.; Li, N.; Shen, T.; Wang, P.S.; Tang, W.B.; Ma, S.W.; Zhang, Z.M.; Jia, H.Y.; Kong, Z.X.; Ma, Z.Q. Fine mapping of powdery mildew resistance gene Pm4e in bread wheat (Triticum aestivum L.). Planta 2018, 248, 1319–1328. [Google Scholar] [CrossRef]
  2. Li, T.; Zhang, Z.Y.; Hu, Y.K.; Duan, X.Y.; Xin, Z.Y. Identification and molecular mapping of a resistance gene to powdery mildew from the synthetic wheat line M53. J. Appl. Genet. 2011, 52, 137–143. [Google Scholar] [CrossRef] [PubMed]
  3. Benavente, E.; Fernández-Calvín, B.; Orellana, J. Relationship between the levels of wheat-rye metaphase I chromosomal pairing and recombination revealed by GISH. Chromosoma 1996, 105, 92–96. [Google Scholar] [CrossRef]
  4. Wang, Y.J.; Quan, W.; Peng, N.N.; Wang, C.Y.; Yang, X.F.; Liu, X.L.; Zhang, H.; Chen, C.H.; Ji, W.Q. Molecular cytogenetic identification of a wheat-Aegilops geniculata Roth 7Mg disomic addition line with powdery mildew resistance. Mol. Breed. 2016, 36, 40. [Google Scholar] [CrossRef]
  5. Zhu, C.; Wang, Y.Z.; Chen, C.H.; Wang, C.Y.; Zhang, A.C.; Peng, N.N.; Wang, Y.J.; Zhang, H.; Liu, X.L.; Ji, W.Q. Molecular cytogenetic identification of a wheat-Thinopyrum ponticum substitution line with stripe rust resistance. Genome 2017, 60, 860–867. [Google Scholar] [CrossRef]
  6. Chen, P.D.; Qi, L.L.; Zhou, B.; Zhang, S.Z.; Liu, D.J. Development and molecular cytogenetic analysis of wheat—Haynaldia villosa 6VS/6AL translocation lines specifying resistance to powdery mildew. Theoret. Appl. Genet. 1995, 91, 1125–1128. [Google Scholar] [CrossRef] [PubMed]
  7. Zhang, R.Q.; Sun, B.X.; Chen, J.; Cao, A.Z.; Xing, L.P.; Feng, L.G.; Lan, C.X.; Chen, P.D. Pm55, a developmental-stage and tissue-specific powdery mildew resistance gene introgressed from Dasypyrum villosum into common wheat. Theor. Appl. Genet. 2016, 10, 1975–1984. [Google Scholar] [CrossRef] [PubMed]
  8. Luo, P.G.; Luo, H.Y.; Chang, Z.J.; Zhang, H.Y.; Zhang, M.; Ren, Z.L. Characterization and chromosomal location of Pm40 in common wheat: A new gene for resistance to powdery mildew derived from Elytrigia intermedium. Theor. Appl. Genet. 2009, 118, 1059–1064. [Google Scholar] [CrossRef] [PubMed]
  9. Jia, J.; Devos, K.M.; Chao, S.; Miller, T.E.; Reader, S.M.; Gale, M.D. RFLP-based maps of the homoeologous group-6 chromosomes of wheat and their application in the tagging of Pm12, a powdery mildew resistance gene transferred from Aegilops speltoides to wheat. Theor. Appl. Genet. 1996, 92, 559–565. [Google Scholar] [CrossRef]
  10. Hsam, S.L.K.; Lapochkina, I.F.; Zeller, F.J. Chromosomal location of genes for resistance to powdery mildew in common wheat (Triticum aestivum L. em Thell.). Gene Pm32 in a wheat-Aegilops speltoides translocation line. Euphytica 2003, 133, 367–370. [Google Scholar] [CrossRef]
  11. Petersen, S.; Lyerly, J.H.; Worthington, M.L.; Parks, W.R.; Cowger, C.; Marshall, D.S.; Brown-Guedira, G.; Murphy, J.P. Mapping of powdery mildew resistance gene Pm53 introgressed from Aegilops speltoides into soft red winter wheat. Theor. Appl. Genet. 2015, 128, 303–312. [Google Scholar] [CrossRef] [PubMed]
  12. Ceoloni, C.; Signore, G.D.; Ercoli, L.; Donini, P. Locating the alien chromatin segment in common wheat-Aegilops longissima mildew resistant transfers. Hereditas 1992, 116, 239–245. [Google Scholar] [CrossRef]
  13. Liu, W.X.; Koo, D.-H.; Xia, Q.; Li, C.X.; Bai, F.Q.; Song, Y.L.; Friebe, B.; Gill, B.S. Homoeologous recombination-based transfer and molecular cytogenetic mapping of powdery mildew-resistant gene Pm57 from Aegilops searsii into wheat. Theor. Appl. Genet. 2017, 130, 841–848. [Google Scholar] [CrossRef] [PubMed]
  14. He, R.L.; Chang, Z.J.; Yang, Z.J.; Yuan, Z.Y.; Zhan, H.X.; Zhang, X.J. Inheritance and mapping of powdery mildew resistance gene Pm43 introgressed from Thinopyrum intermedium into wheat. Theor. Appl. Genet. 2009, 118, 1173–1180. [Google Scholar] [CrossRef]
  15. Zaharieva, M.; Monneveux, P.; Henry, M.; Rivoal, R.; Valkoun, J.; Nachit, M.M. Evaluation of a collection of wild wheat relative Aegilops geniculata Roth and identification of potential sources for useful traits. Euphytica 2001, 119, 33–38. [Google Scholar] [CrossRef]
  16. Gill, B.S.; Sharma, H.C.; Raupp, W.J.; Browder, L.E.; Hatchett, J.H.; Harvey, T.L.; Moseman, J.G.; Waines, J.W. Evaluation of Aegilops species for resistance to powdery mildew, wheat leaf rust, Hessian fly, and greenbug. Plant Dis. 1985, 69, 314–316. [Google Scholar] [CrossRef]
  17. Friebe, B.R.; Jiang, J.; Raupp, W.J.; McIntosh, R.A.; Gill, B.S. Characterization of wheat-alien translocations conferring resistance to diseases and pests: Current status. Euphytica 1996, 91, 59–87. [Google Scholar] [CrossRef]
  18. Ohta, S. Diverse morphological and cytogenetic variation and differentiation of the two subspecies in Aegilops geniculata Roth, a wild relative of wheat. Genet. Resour. Crop Evol. 2017, 64, 2009–2020. [Google Scholar] [CrossRef]
  19. Rawat, N.; Tiwari, V.K.; Singh, N.; Randhawa, G.S.; Singh, K.; Chhuneja, P.; Dhaliwal, H.S. Evaluation and utilization of Aegilops and wild Triticum species for enhancing iron and zinc content in wheat. Genet. Resour. Crop Evol. 2009, 56, 53–64. [Google Scholar] [CrossRef]
  20. Siddiqui, K.A.; Yosufzai, M.N. Natural and indused variation for endomorphic traits in the tribe Triticeae. In Proceedings of the 7th International Wheat Genetics Symposium, Cambridge, UK, 13–19 July 1988; pp. 139–144. [Google Scholar]
  21. Zhang, X.Y.; Wang, R.R.C.; Dong, Y.S. RAPD polymorphisms in Aegilops geniculata Roth (Ae. ovata auct. non L.). Genet. Resour. Crop Evol. 1996, 43, 429–433. [Google Scholar] [CrossRef]
  22. Friebe, B.R.; Tuleen, N.A.; Gill, B.S. Development and identification of a complete set of Triticum aestivum-Aegilops geniculata chromosome addition lines. Genome 1999, 42, 374–380. [Google Scholar] [CrossRef]
  23. Kuraparthy, V.; Chhuneja, P.; Dhaliwal, H.S.; Kaur, S.; Bowden, R.L.; Gill, B.S. Characterization and mapping of cryptic alien introgression from Aegilops geniculata with new leaf rust and stripe rust resistance genes Lr57 and Yr40 in wheat. Theor. Appl. Genet. 2007, 114, 1379–1389. [Google Scholar] [CrossRef] [PubMed]
  24. Zeller, F.; Kong, L.; Hartl, L.; Mohler, V.; Hsam, S.L.K. Chromosomal location of genes for resistance to powdery mildew in common wheat (Triticum aestivum L. em Thell.) Gene Pm29 in line Pova. Euphytica 2002, 123, 187–194. [Google Scholar] [CrossRef]
  25. Tang, Z.X.; Yang, Z.J.; Fu, S.L. Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J. Appl. Genet. 2014, 55, 313–318. [Google Scholar] [CrossRef]
  26. Lukaszewski, A.J.; Porter, D.R.; Baker, C.A.; Rybka, K.; Lapinski, B. Attempts to transfer Russian wheat aphid resistance from a rye chromosome in Russian triticales to wheat. Crop Sci. 2001, 41, 1743–1749. [Google Scholar] [CrossRef] [Green Version]
  27. Wang, D.; Zhuang, L.F.; Sun, L.; Feng, Y.G.; Pei, Z.Y.; Qi, Z.J. Allocation of a powdery mildew resistance locus to the chromosome arm 6RL of Secale cereale L. cv. ‘Jingzhouheimai’. Euphytica 2010, 176, 157–166. [Google Scholar] [CrossRef]
  28. Zhuang, L.F.; Liu, P.; Liu, Z.Q.; Chen, T.T.; Wu, N.; Sun, L.; Qi, Z.J. Multiple structural aberrations and physical mapping of rye chromosome 2R introgressed into wheat. Mol. Breed. 2015, 35, 133. [Google Scholar] [CrossRef]
  29. Fu, S.L.; Yang, M.Y.; Ren, Z.L.; Yan, B.; Tang, Z.X. Abnormal mitosis induced by wheat-rye 1R monosomic addition lines. Genome 2014, 57, 21–28. [Google Scholar] [CrossRef]
  30. Fu, S.L.; Chen, L.; Wang, Y.Y.; Li, M.; Yang, Z.J.; Qiu, L.; Yan, B.J.; Ren, Z.L.; Tang, Z.X. Oligonucleotide probes for ND-FISH analysis to identify rye and wheat chromosomes. Sci. Rep. 2015, 215, 10552. [Google Scholar] [CrossRef] [Green Version]
  31. Georgieva, M.; Sepsi, A.; Tyankova, N.; Molnár-Láng, M. Molecular cytogenetic characterization of two high protein wheat-Thinopyrum intermedium partial amphiploids. J. Appl. Genet. 2011, 52, 269–277. [Google Scholar] [CrossRef]
  32. Yang, X.F.; Wang, C.Y.; Li, X.; Chen, C.H.; Tian, Z.R.; Wang, Y.J.; Ji, W.Q. Development and Molecular Cytogenetic Identification of a Novel Wheat-Leymus mollis Lm#7Ns (7D) Disomic Substitution Line with Stripe Rust Resistance. PLoS ONE 2015, 10, e0140227. [Google Scholar] [CrossRef]
  33. Hu, L.J.; Li, G.R.; Zeng, Z.X.; Chang, Z.J.; Liu, C.; Yang, Z.J. Molecular characterization of a wheat-Thinopyrum ponticum partial amphiploid and its derived substitution line for resistance to stripe rust. J. Appl. Genet. 2011, 52, 279–285. [Google Scholar] [CrossRef] [PubMed]
  34. Li, H.; Guo, X.X.; Wang, C.Y.; Ji, W.Q. Spontaneous and divergent hexaploid Triticales derived from common wheat × Rye by complete elimination of D-genome chromosomes. PLoS ONE 2015, 10, e0120421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Zheng, Q.; Lv, Z.L.; Niu, Z.X.; Li, B.; Li, H.W.; Xu, S.S.; Han, F.P.; Li, Z.S. Molecular cytogenetic characterization and stem rust resistance of five wheat-Thinopyrum ponticum partial amphiploids. J. Genet. Genom. 2014, 41, 591–599. [Google Scholar] [CrossRef] [PubMed]
  36. Schneider, A.; Linc, G.; Molnár-Láng, M. Fluorescence in situ hybridization polymorphism using two repetitive DNA clones in different cultivars of wheat. Plant Breed. 2003, 122, 396–400. [Google Scholar] [CrossRef]
  37. Kwiatek, M.; Wiśniewska, H.; Apolinarska, B. Cytogenetic analysis of Aegilops chromosomes, potentially usable in triticale (X Triticosecale Witt.) breeding. J. Appl. Genet. 2013, 54, 147–155. [Google Scholar] [CrossRef] [Green Version]
  38. Guo, J.T.; Lei, Y.H.; Zhang, H.T.; Song, D.H.; Liu, X.; Cao, Z.L.; Chu, C.G.; Zhuang, L.F.; Qi, Z.J. Frequent variations in tandem repeats pSc200 and pSc119.2 cause rapid chromosome evolution of open-pollinated rye. Mol. Breed. 2019, 39, 133. [Google Scholar] [CrossRef]
  39. Frederic, J.R.; Bauer, P.J. Ecology and Physiology of Yield Determination; Food Products Press: Binghamtom, NY, USA, 2000; pp. 45–65. [Google Scholar]
  40. Yen, C.; Zheng, Y.L.; Yang, J.L. An ideotype for high yield breeding in theory and practice. In Proceedings of the 8th International Wheat Genetics Symposium, Beijing, China, 20–25 July 1993; Agricultural Sci-Tech. Press: Beijing, China, 1995; pp. 1113–1117. [Google Scholar]
  41. Wu, J.; Yang, X.M.; Wang, H.; Li, H.J.; Li, L.H.; Li, X.Q.; Liu, W.H. The introgression of chromosome 6P specifying for increased numbers of florets and kernels from Agropyron cristatum into wheat. Theor. Appl. Genet. 2006, 114, 13–20. [Google Scholar] [CrossRef]
  42. Li, Z.S.; Rong, S.; Cheng, S.Y.; Zhong, G.C.; Mu, S.M. Wheat Wide Hybridization; Chinese Scientific Press: Beijing, China, 1985. [Google Scholar]
  43. An, D.G.; Ma, P.T.; Zheng, Q.; Fu, S.L.; Li, L.H.; Han, F.P.; Han, G.H.; Wang, J.; Xu, Y.F.; Jin, Y.L.; et al. Development and molecular cytogenetic identification of a new wheat-rye 4R chromosome disomic addition line with resistances to powdery mildew, stripe rust and sharp eyespot. Theor. Appl. Genet. 2019, 132, 257–272. [Google Scholar] [CrossRef]
  44. Han, F.P.; Lamb, J.C.; Birchler, J.A. High frequency of centromere inactivation resulting in stable dicentric chromosomes of maize. Proc. Natl. Acad. Sci. USA 2006, 103, 3238–3243. [Google Scholar] [CrossRef] [Green Version]
  45. Pei, Y.R.; Cui, Y.; Zhang, Y.P.; Wang, H.G.; Bao, Y.G.; Li, X.F. Molecular cytogenetic identification of three rust-resistant wheat-Thinopyrum ponticum partial amphiploids. Mol. Cytogenet. 2018, 11, 27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Ishikawa, G.; Nakamura, T.; Ashida, T.; Saito, M.; Nasuda, S.; Endo, T.R.; Wu, J.Z.; Matsumoto, T. Localization of anchor loci representing five hundred annotated rice genes to wheat chromosomes using PLUG markers. Theor. Appl. Genet. 2009, 118, 499–514. [Google Scholar] [CrossRef] [PubMed]
  47. Sheng, B. Grades of resistance to powdery mildew classified by different phenotypes of response in the seeding stage of wheat. Plant Prot. 1988, 1, 49. [Google Scholar]
  48. Wang, Y.J.; Wang, C.Y.; Quan, W.; Jia, X.J.; Fu, Y.; Zhang, H.; Liu, X.L.; Chen, C.H.; Ji, W.Q. Identification and mapping of PmSE5785, a new recessive powdery mildew resistance locus, in synthetic hexaploid wheat. Euphytica 2016, 207, 619–626. [Google Scholar] [CrossRef]
Ijms 21 01861 g001 550
Figure 1. Cytogenetic analysis of W16998. (A). root tip cells at mitotic metaphase, 2n = 42. (B). pollen mother cell chromosomal configurations at meiotic metaphase, 2n = 21П. (C). pollen mother cell chromosomal configurations at anaphase I, 2n = 21 + 21.
Figure 1. Cytogenetic analysis of W16998. (A). root tip cells at mitotic metaphase, 2n = 42. (B). pollen mother cell chromosomal configurations at meiotic metaphase, 2n = 21П. (C). pollen mother cell chromosomal configurations at anaphase I, 2n = 21 + 21.
Ijms 21 01861 g001
Ijms 21 01861 g002 550
Figure 2. GISH (genomic in situ hybridization) analysis of W16998, using Ae. geniculata SY159 genomic DNA as a probe (green) and CS (Chinese Spring) genomic DNA as a blocker on root tip metaphase I. Chromosomes were counterstained using DAPI (blue).
Figure 2. GISH (genomic in situ hybridization) analysis of W16998, using Ae. geniculata SY159 genomic DNA as a probe (green) and CS (Chinese Spring) genomic DNA as a blocker on root tip metaphase I. Chromosomes were counterstained using DAPI (blue).
Ijms 21 01861 g002
Ijms 21 01861 g003 550
Figure 3. EST–STS and PLUG functional molecular marker analysis of W16998. The red arrows indicate the SY159-specific bands. (M). DL2000 (2 kb DNA ladder). (1). CS. (2). SY159. (3). W16998. (A). BE637663. (B). TANC1868-TaqI. (C). TNAC1782-HaeII. (D). TNAC1829-TaqI. (E). TNAC1845-TaqI. (F). TNAC1888-TaqI. (G). TNAC1929-TaqI. (H). TNAC1841-TaqI.
Figure 3. EST–STS and PLUG functional molecular marker analysis of W16998. The red arrows indicate the SY159-specific bands. (M). DL2000 (2 kb DNA ladder). (1). CS. (2). SY159. (3). W16998. (A). BE637663. (B). TANC1868-TaqI. (C). TNAC1782-HaeII. (D). TNAC1829-TaqI. (E). TNAC1845-TaqI. (F). TNAC1888-TaqI. (G). TNAC1929-TaqI. (H). TNAC1841-TaqI.
Ijms 21 01861 g003
Ijms 21 01861 g004 550
Figure 4. Nullisomic-tetrasomic analysis of W16998. The red arrows indicate the SY159-specific bands. The white arrows indicate CS and the nullisomic-tetrasomic-specific bands. (M). DL2000. (1). CS. (2). SY159. (3). W16998. (4). CSN7AT7B. (5). CSN7AT7D. (6). CSN7BT7A. (7). CSN7DT7A. (8). CS. (A). TNAC1868-TaqI. (B). TNAC1941-TaqI.
Figure 4. Nullisomic-tetrasomic analysis of W16998. The red arrows indicate the SY159-specific bands. The white arrows indicate CS and the nullisomic-tetrasomic-specific bands. (M). DL2000. (1). CS. (2). SY159. (3). W16998. (4). CSN7AT7B. (5). CSN7AT7D. (6). CSN7BT7A. (7). CSN7DT7A. (8). CS. (A). TNAC1868-TaqI. (B). TNAC1941-TaqI.
Ijms 21 01861 g004
Ijms 21 01861 g005 550
Figure 5. Karyotypes with the genomic composition variation of W16998, obtained using FISH and sequential FISH–GISH analyses. The probes for FISH were Oligo-pSc119.2 (green) and Oligo-pTa535 (red). The probe for sequential FISH–GISH was SY159 genomic DNA (green). The red arrows indicate Ae. geniculata chromosomes; the white arrows indicate structural variations in the chromosomes. (A). FISH of CS. (B). FISH of NA0973-5-4-1-2-9-1 (CS-AEGEN DA 7Mg). (C). FISH of W16998. (D). GISH of W16998 in the same cell as (C).
Figure 5. Karyotypes with the genomic composition variation of W16998, obtained using FISH and sequential FISH–GISH analyses. The probes for FISH were Oligo-pSc119.2 (green) and Oligo-pTa535 (red). The probe for sequential FISH–GISH was SY159 genomic DNA (green). The red arrows indicate Ae. geniculata chromosomes; the white arrows indicate structural variations in the chromosomes. (A). FISH of CS. (B). FISH of NA0973-5-4-1-2-9-1 (CS-AEGEN DA 7Mg). (C). FISH of W16998. (D). GISH of W16998 in the same cell as (C).
Ijms 21 01861 g005
Ijms 21 01861 g006 550
Figure 6. Morphological and powdery mildew reactions of W16998. (1) CS; (2) SY159; (3) W16998. (M) Shaanyou 225. (A). plants. (B). florets. (C). spikes. (D). kernels. (E). symptoms in response to inoculation with E09 at the seedling stages.
Figure 6. Morphological and powdery mildew reactions of W16998. (1) CS; (2) SY159; (3) W16998. (M) Shaanyou 225. (A). plants. (B). florets. (C). spikes. (D). kernels. (E). symptoms in response to inoculation with E09 at the seedling stages.
Ijms 21 01861 g006
Table
Table 1. Expressed sequence tag-sequence-tagged site (EST–STS) and PCR-based landmark unique gene (PLUG) marker list for W16998.
Table 1. Expressed sequence tag-sequence-tagged site (EST–STS) and PCR-based landmark unique gene (PLUG) marker list for W16998.
MarkerTypePrimer (5’-3’)LocationGeltype/RestrictionenzymeTm °C/t (h)
BE637663EST-SSRF: ACTGTTGCTTCGCTCCAAGT
R: GTTCCATTTCCGATGTGCTC		7AL 7BL 7DL8% non-denaturing polyacrylamide gel/-60/-
TNAC1868PLUGF: CTCCGCCTTCATCGGAAA
R: CCGTTCTGCTTCAGGATCTC		7AL 7BL 7DL8% non-denaturing polyacrylamide gel/-60/-
TNAC1782PLUGF: TCACTGAACAGCCTAGACATGG
R: ATTCGCAGACCGCATCTATC		7AS 7BS 7DS2% agarose gel/TaqI/HaeIII60/2 or 37/2
TNAC1829PLUGF: GCCACTTCCTCCCTCCTC
R: GTCGGTCCTCCAGTATCAGC		7AL 7BL 7DL2% agarose gel/TaqI60/2
TNAC1845PLUGF: AATGAACAGCTTGCTTTCTGC
R: CAGATGCTCTGGATTTCATGG		7AL 7BL 7DL2% agarose gel/TaqI60/2
TNAC1888PLUGF: AGGGATGTGTTGGAGCTGTTA
R: CACAGTGACCTTCTGCTCCTT		7AL 7BL 7DL2% agarose gel/TaqI60/2
TNAC1929PLUGF: GCACCAGAAGGTTCAGTAGCA
R: ATCTGTCAGCAGGGCACACT		7AS 7BS 7DS2% agarose gel/TaqI60/2
TNAC1941PLUGF: AATGATCCTGACAAGGTGCAG
R: GTAGCGATGGCATCCAGAGA		7AS 7BS 7DS2% agarose gel/TaqI60/2
- represent no data.
Table
Table 2. Analysis of the agronomic traits of W16998 and its parents (CS, SY159).
Table 2. Analysis of the agronomic traits of W16998 and its parents (CS, SY159).
MaterialsTilleringPlant Height (cm)Spike Length (cm)Spikelets/SpikeKernels/SpikeletKernels/SpikeThousand Kenel Weight (g)Awnedness
CS13 ± 4130 ± 59.0 ± 0.320 ± 24 ± 140 ± 430 ± 0.5awnless
SY15975 ± 565 ± 52.8 ± 0.43 ± 13 ± 110 ± 218 ± 2.0Long awn
W1699815 ± 5120 ± 511.0 ± 0.5 **23 ± 25 ± 250 ± 5 **40 ± 1.0 **Long awn
** Indicates significant differences between the substitution line W16998 and wheat parent CS (p < 0.01).

Share and Cite

MDPI and ACS Style

Wang, Y.; Long, D.; Wang, Y.; Wang, C.; Liu, X.; Zhang, H.; Tian, Z.; Chen, C.; Ji, W. Characterization and Evaluation of Resistance to Powdery Mildew of Wheat–Aegilops geniculata Roth 7Mg (7A) Alien Disomic Substitution Line W16998. Int. J. Mol. Sci. 2020, 21, 1861. https://doi.org/10.3390/ijms21051861

AMA Style

Wang Y, Long D, Wang Y, Wang C, Liu X, Zhang H, Tian Z, Chen C, Ji W. Characterization and Evaluation of Resistance to Powdery Mildew of Wheat–Aegilops geniculata Roth 7Mg (7A) Alien Disomic Substitution Line W16998. International Journal of Molecular Sciences. 2020; 21(5):1861. https://doi.org/10.3390/ijms21051861

Chicago/Turabian Style

Wang, Yajuan, Deyu Long, Yanzhen Wang, Changyou Wang, Xinlun Liu, Hong Zhang, Zengrong Tian, Chunhuan Chen, and Wanquan Ji. 2020. "Characterization and Evaluation of Resistance to Powdery Mildew of Wheat–Aegilops geniculata Roth 7Mg (7A) Alien Disomic Substitution Line W16998" International Journal of Molecular Sciences 21, no. 5: 1861. https://doi.org/10.3390/ijms21051861

APA Style

Wang, Y., Long, D., Wang, Y., Wang, C., Liu, X., Zhang, H., Tian, Z., Chen, C., & Ji, W. (2020). Characterization and Evaluation of Resistance to Powdery Mildew of Wheat–Aegilops geniculata Roth 7Mg (7A) Alien Disomic Substitution Line W16998. International Journal of Molecular Sciences, 21(5), 1861. https://doi.org/10.3390/ijms21051861

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop