Next Article in Journal
Intestinal Goblet Cell Loss during Chorioamnionitis in Fetal Lambs: Mechanistic Insights and Postnatal Implications
Next Article in Special Issue
The Impact of Hanseniaspora vineae Fermentation and Ageing on Lees on the Terpenic Aromatic Profile of White Wines of the Albillo Variety
Previous Article in Journal
Identification of Two Dysfunctional Variants in the ABCG2 Urate Transporter Associated with Pediatric-Onset of Familial Hyperuricemia and Early-Onset Gout
Previous Article in Special Issue
High Potential of Pichia kluyveri and Other Pichia Species in Wine Technology
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 22
Issue 4
10.3390/ijms22041943
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of Genetic Modification Tools for Hanseniasporauvarum

by
Jennifer Badura
1,
Niël van Wyk
1,2,
Silvia Brezina
1,
Isak S. Pretorius
2,
Doris Rauhut
1,
Jürgen Wendland
1 and
Christian von Wallbrunn
1,*
1
Department of Microbiology and Biochemistry, Hochschule Geisenheim University, Von-Lade-Strasse 1, 65366 Geisenheim, Germany
2
ARC Centre of Excellence in Synthetic Biology, Department of Molecular Sciences, Macquarie University, Sydney, NSW 2113, Australia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2021, 22(4), 1943; https://doi.org/10.3390/ijms22041943
Submission received: 20 January 2021 / Revised: 8 February 2021 / Accepted: 11 February 2021 / Published: 16 February 2021
(This article belongs to the Special Issue Biotechnology of Non-conventional Yeasts)
Browse Figures
Versions Notes

Abstract

:
Apiculate yeasts belonging to the genus Hanseniaspora are commonly isolated from viticultural settings and often dominate the initial stages of grape must fermentations. Although considered spoilage yeasts, they are now increasingly becoming the focus of research, with several whole-genome sequencing studies published in recent years. However, tools for their molecular genetic manipulation are still lacking. Here, we report the development of a tool for the genetic modification of Hanseniaspora uvarum. This was employed for the disruption of the HuATF1 gene, which encodes a putative alcohol acetyltransferase involved in acetate ester formation. We generated a synthetic marker gene consisting of the HuTEF1 promoter controlling a hygromycin resistance open reading frame (ORF). This new marker gene was used in disruption cassettes containing long-flanking (1000 bp) homology regions to the target locus. By increasing the antibiotic concentration, transformants were obtained in which both alleles of the putative HuATF1 gene were deleted in a diploid H. uvarum strain. Phenotypic characterisation including fermentation in Müller-Thurgau must showed that the null mutant produced significantly less acetate ester, particularly ethyl acetate. This study marks the first steps in the development of gene modification tools and paves the road for functional gene analyses of this yeast.

1. Introduction

The term apiculate yeast signifies a distinctive lemon-shaped cell structure of yeast species belonging to the genus of Hanseniaspora and closely-related genera, such as Saccharomycodes and Nadsonia [1]. The genus Hanseniaspora has a cosmopolitan distribution and has often been reported to be the most abundant genus on mature and intact grape berries, and thus contributes the largest yeast population to the initial stages of a grape must fermentation [2,3]. Since Hanseniaspora is prevalent on grapes in almost all vineyards worldwide [4,5,6,7,8], it plays a crucial role in affecting the sensory profile of wine, especially regarding the complexity of wine [9,10,11]. In general, Hanseniaspora populations decrease significantly during wine fermentation as these yeasts are usually outcompeted by the main wine yeast, Saccharomyces cerevisiae. It was initially thought that the gradual increase in ethanol concentration was primarily responsible for the decline in the Hanseniaspora population, but there is growing scientific evidence suggesting that a variety of metabolites secreted by S. cerevisiae significantly impacts the viability of Hanseniaspora within a grape must fermentation [12]. Moreover, Hanseniaspora strains have been shown to withstand ethanol concentrations of more than 10% and are able to produce a considerable amount of ethanol themselves [12,13,14]. In the past, Hanseniaspora populations have been regarded to be spoilage yeasts when a significant proportion of these apiculate yeasts persists within a fermentation, as some strains are capable of producing significant amounts of acetaldehyde, acetic acid, and ethyl acetate. Winemaking practices, such as the addition of SO2 or even the utilisation of yeasts, which produce killer toxins that have antimicrobial activity against apiculate yeasts [15], are used to limit the proliferation of Hanseniaspora yeasts. This hypothesis of Hanseniaspora as purely a spoilage yeast has been challenged and re-evaluated in recent years as wine researchers are reporting many beneficial oenological contributions that Hanseniaspora strains can provide when co-cultured with S. cerevisiae in a mixed-culture type of must fermentation. The oenological benefits of Hanseniaspora wine strains include lower final ethanol levels as well as increased acetate and ethyl ester concentrations [16,17,18]. Although selected Hanseniaspora strains have been used in mixed starter cultures with S. cerevisiae in wine fermentations, no Hanseniaspora strain is commercially available yet for use as an oenological starter culture [19]. Moreover, its ester production capability is particularly striking.
By sheer numbers found in fermentations, one of the most prolific species is that of Hanseniaspora uvarum, which, in the earlier literature, was also referred to as Kloeckera apiculata. Apart from its predominance and importance in winemaking, H. uvarum strains have also been isolated from many other fermented beverages, such as cider [20] or tequila [21], as well as from various food-related niches such as the processing of coffee beans [22] and cocoa fermentations [23] and from fresh-squeezed orange juice [24]. In addition to its presence in foods and beverages, H. uvarum has also been isolated from soil [25], plants [26], insects [27], birds [28], molluscs [29], shrimps [30] and snails [14]. Due to its antagonistic properties against mould development, H. uvarum’s potential as a biocontrol agent has also been investigated [31,32,33].
In spite of the increasing importance of Hanseniaspora in wine fermentations, only in the past couple of years, has large-scale genome sequencing provided information on Hanseniaspora species [34,35,36,37]; this wealth of information provides a basic framework for analysing the biology of Hanseniaspora. Recent research has shown that the low specific activity of pyruvate kinase, catalysing one of the rate limiting steps in the glycolytic pathway, could explain the reduced capacity of Hanseniaspora to form ethanol [38]. Analyses of different Hanseniaspora genomes have provided insight into an extensive loss of genes involved in cell cycle regulation and the maintenance of genome integrity [39]. Comparisons among different species and strains have revealed that Hanseniaspora isolates possess particular dynamic genome structures with various variations in ploidy [40].
A central element of gene-function analyses is the ability to generate deletion strains. However, there is still a lack of protocols for targeted gene deletions in H. uvarum based on DNA-mediated transformation to achieve homologous gene replacements with disruption cassettes. In this study, we developed a basic tool for the initiation of molecular characterisation of H. uvarum genes. To this end, we targeted the H. uvarum ATF1 homolog encoding an alcohol acetyltransferase, successfully deleted both alleles in this diploid yeast, and compared the fermentation performance and flavour production of the mutant with the wild type.

2. Results

2.1. Plasmid Design and Construction

2.1.1. Design and Testing of Promoters

We originally attempted to transform Hanseniaspora using geneticin (kanMX) and hygromycin (hygMX) resistance cassettes already tailored for S. cerevisiae genetic modification. These cassettes are under the transcriptional control of the TEF1 promoter of Ashbya gossypii. Despite numerous attempts to optimise transformation procedures, we were unable to obtain transformants and opted to clone promoters of H. uvarum to drive the expression of the respective antibiotic markers. To this end, we PCR-amplified three regions upstream of the open reading frames (ORFs) of H. uvarum genes whose S. cerevisiae homologs are known to be strongly expressed. These genes encode translation elongation factor EF-1α (TEF1), 3-phosphoglycerate kinase 1 (PGK1) and fructose-1,6-bisphosphate aldolase 1 (FBA1). We cloned these three H. uvarum promoters upstream of the LacZ reporter gene to test their heterologous function in S. cerevisiae. By transforming S. cerevisiae with these synthetic constructs, expression of beta-galactosidase can be monitored by its conversion of X-Gal into a blue strain. S. cerevisiae transformed with HuFBA1 and HuPGK1 constructs did not result in blue-stained S. cerevisiae colonies, suggesting that these promoters are non-functional in S. cerevisiae. However, use of the HuTEF1 promoter yielded beta-galactosidase activity in S. cerevisiae (Figure 1). Next, we fused the HuTEF1 promoter to ORFs of antibiotic resistance genes to generate new marker genes for Hanseniaspora and to drive transcription of these resistance markers in Hanseniaspora transformants.

2.1.2. Choice of Candidate Gene and Design of the Knock-Out Cassette

We selected the ATF1 alcohol acetyltransferase I gene from H. uvarum as the candidate gene to knock out, as ATF1 and ATF2 in S. cerevisiae are known to be the main catalysts for ethyl acetate production in wine. The generation of an HuATF1 disruption cassette is described in the Material and Methods. The HuAtf1 protein shows only 22% homology to ScAtf1 and 25% ScAtf2, respectively. HuAtf1 contains both the active site HXXXDG [42] and the conserved WRLICLP motif of acetyltransferases (Figure 2a). The complete HuAtf1, ScAtf2, and ScAtf1 alignment can be seen in supplementary (Figure S1).

2.2. Generation of Strains and Verification of Transformants

We applied the two main Saccharomyces transformation procedures based on chemical or electro competence in order to transform H. uvarum. Although both methods yielded transformants, electroporation yielded more transformants. The specific electroporation protocol used, involved a sensitising step with lithium acetate [43]. We constructed selection cassettes containing the resistance markers for hygromycin (hph), geneticin (neoR), nourseothricin (clonNAT, natI), and zeocin (Sh Ble), commonly used for yeasts. The transformation of H. uvarum with the hygromycin-resistance selection cassette in the form of a linearised plasmid, containing HuTEF1 and hph, each flanked by 1000 bp upstream and downstream homology regions of the ORF of HuATF1, yielded many transformants, without background colonies. In total, more than 100 colonies were re-streaked on selection plates, incubated overnight, and genomic DNA was isolated. Subsequently, PCR with diagnostic primers (G1/G2 and G3/G4, Figure 2b) was used to verify the correct intended integration of the selection cassette. In 99% of the colonies, the targeted insertion of the selection cassette could be detected via PCR. Integration of the cassette was also confirmed by sequencing of both the G1-G2 PCR product and G3-G4 PCR product. In addition, a second HuATF1 allele was amplified by PCR suggesting a diploid state of H. uvarum.
Unfortunately, we were unable to obtain H. uvarum transformants using geneticin, nourseothricin, or zeocin in selection media. We found H. uvarum to be extremely resistant to these antibiotics even when we increased the concentration to two to three times more than what is recommended for the selection of S. cerevisiae transformants. This left us without a second dominant selection marker.
Since hygromycin proved to be the only antibiotic with which we were able to obtain H. uvarum transformants, we decided to transform it and plate the cells out on selective agar plates containing a three-fold higher concentration of hygromycin. From two out of 100 transformants that we obtained, we could not amplify an internal HuATF1 band even after several PCR attempts, which suggested that both alleles of ATF1 had been removed (Figure 2c). Primers were designed that bind outside the selection marker to the genomic DNA upstream and downstream of HuATF1 (G5/G6, Figure 2b) and were used to amplify this sequence via PCR. GelRed stained agarose gel can be found in Figure 2d. While Samples 1 (DSM2768 Ctrl) and 2 (DSM2768 #40) show only one band each, with sizes of 2 kb (Sample 1) and 2.5 kb (Sample 2), two bands of both sizes are visible in Sample 3 (DSM2768 #34). In H. uvarum DSM2768, only the HuATF1 band is visible. DSM2768 #34 showed two bands (HuATF1 and the selection cassette) indicative of a heterozygous state (single knock-out).
The transformant DSM2768 #40 (Sample 2) showed only one band corresponding to the size of the selection cassette, indicating an integration via homologous recombination. Sanger sequencing using primers G5 and G6 confirmed that only the HuTEF1-hph marker could be amplified from transformant DSM2768 #40. Accordingly, this is indicative of a homozygous deletion (double knock-out). Two independent homozygous deletion mutants were obtained (DSM2768 #40 and DSM2768 #46). The transformation efficiency of receiving double knock-out transformants obtained using the higher concentration of antibiotic was 2%.

2.3. Fermentations and Phenotypical Characterisation

In order to determine the phenotype of the transformants, fermentations with Müller-Thurgau must were performed. The phenotypical characterisation is shown in Figure 3. The most noteworthy difference between the double knock-out transformants (DSM2768 #40 and DSM2768 #46) and the control was the acetate ester content (Figure 3a). The most abundant acetate ester, ethyl acetate, had a concentration of 600–800 mg/L less in the Δ/Δ strains than the control (Supplementary Figure S2a). The four other acetate esters measured isoamyl acetate, 2-methylbutyl acetate, hexyl acetate, and 2-phenylethyl acetate also had significantly reduced amounts. In general, the alcohols of the respective esters showed an increase in the Δ/Δ strains, which also includes ethanol (Figure 3c and Figure 4b and Supplementary Figure S3). The Δ/Δ strains had an ~10% increase in ethanol. Interestingly, the Δ/Δ strain produced no detectable acetic acid and slightly increased levels of certain ethyl esters (ethyl propionate and ethyl butyrate) were found (Supplementary Figure S2f–h). The sugar consumption of all the strains was comparable over the period of three days (Figure 4a). The strain in which only one allele of HuATF1 was removed performed similarly to the control strain apart from isoamyl acetate, 2-methylbutyl acetate, isobutanol, and 2-phenyl ethanol, which increased slightly in production as compared with the control (Supplementary Figures S2 and S3). On the basis of the observation that the putative double knock-out yeast strains metabolised the same amounts of sugars as the control strain, it was concluded that the transformants were a physiological fit.

3. Discussion

Hanseniaspora uvarum is an important yeast in the beverage industry, in particular for wine. In recent years, researchers have shown particular interest in this yeast, and reports on its beneficial impact on winemaking as well as several genome sequences have been published [34,35,36,37]. Despite the growing interest, to date, there are no genetic modification tools available for H. uvarum.
Our study attempts to fill this gap and describes a successful genetic modification experiment in H. uvarum. A common antibiotic used in eukaryotic transformations, hygromycin, proved to be effective for selection purposes. Furthermore, H. uvarum was found not to be sensitive against other standard antibiotics which complicated our attempts to generate a double knock-out of the HuATF1 gene. However, by increasing the hygromycin concentration, we were able to obtain colonies in which both alleles of HuATF1 were successfully deleted. The transformation of H. uvarum DSM2768 with the linearised DNA containing the hygromycin selection cassette resulted in a highly efficient deletion of HuATF1. Previous reports have suggested that the phenotype of antibiotic resistance is dose dependent and that transformation efficiency correlates with the copy number in the yeast cell [44,45,46]. Hashida-Okado et al. [47] succeeded in generating a null mutant of a diploid S. cerevisiae strain by transforming with only one selection marker. These authors have shown that it is possible to disrupt both gene copies of homologous chromosomes of diploid cells in only one transformation step using one selection marker. After increasing the concentration of the antibiotic in the selective agar medium, transformants (such as DSM2768 #40) lacking HuATF1 were obtained, and integration of the selection cassette could be verified. On the basis of these results, it was concluded that DSM2768 #40 (as well as DSM2768 #46) is a null mutant.
We showed that it was also possible to generate a double knock-out of ATF1 in H. uvarum in such a fashion using only one selection cassette. This was done by tripling the antibiotic concentration in the selective plates. Here, the transformation efficiency of a single knock-out was 98% and that of a double knock-out was 2%.
The double knock-out stains showed a dramatic reduction in ethyl acetate production (~40%). HuATF1 deletion did not completely abolish ethyl acetate production, suggesting other transferase enzymes to be involved in its production besides HuATF1. This is similar to S. cerevisiae, as up to half of the ethyl acetate is still present when the major ATF genes (ATF1 and ATF2) are deleted, which are also known to be associated with ethyl acetate production [48,49].
The reduction in ethyl acetate was accompanied by an increase in the formation of ethanol. This can be explained by the function of ATF1 to esterify ethanol to ethyl acetate. In the case of a deletion of HuATF1, this esterification of ethanol to ethyl acetate is restricted, resulting in an accumulation of ethanol during fermentation. The same applies to the other acetate esters and their respective alcohols. In addition to ethyl acetate, other acetate esters were also produced in smaller quantities by the null mutant strain. In contrast, the production of the corresponding alcohols increased significantly. Contrary to what we expected, significantly lower levels of acetic acid were produced by the double knock-out strains. This is in contrast to a previous study in S. cerevisiae, where no significant differences in acetic acid levels were detected in an ATF1 knock-out strain as compared with the wild type [50]. Overexpression of ATF1 in S. cerevisiae led to a decrease in acetic acid production [48,51], presumably as more of the available pool of acetyl coenzyme A (acetyl-CoA) is needed for the acetate ester synthesis. As a major catalyst for acetate ester production was removed in H. uvarum, we were not expecting a dramatic drop in acetic acid levels. This astonishing finding warrants further investigation.
The knock-out of HuATF1 did not lead to any apparent reduction in the vitality of H. uvarum. The null mutant strain metabolised the same amounts of total sugars as the control strain.
The development of suitable transformation tools for the widespread wine yeast H. uvarum enables more detailed investigations of the individual metabolic pathways for the formation of aroma compounds and the genes involved. In S. cerevisiae, these methods are common practice, and thus the individual gene functions and metabolic pathways are well characterised. Up to now, a detailed investigation of H. uvarum has not been possible. The next steps are the development of additional selection markers and the knock out or overexpression of other genes involved in the metabolism of the aroma compounds in H. uvarum.

4. Materials and Methods

4.1. Strains and Culture Conditions

The yeast strains used and generated in this study (see Table 1) were routinely cultivated in YPD (1% yeast extract, 2% glucose, and 2% peptone) at either 25 °C (H. uvarum) or 30 °C (S. cerevisiae). Solid YPD plates were prepared by adding 2% agar and for transformation, two different concentrations of hygromycin b (200 and 600 µg/mL) were used. Plasmids were propagated in Escherichia coli DH5alpha in 2xYT (1.6% tryptone, 1% yeast extract, and 0.5% NaCl) supplemented with 100 µg/mL ampicillin.

4.2. Plasmid Design and Construction

Plasmids used in this study are listed in Table 2. Primers required for plasmid constructions are listed in Table 3. Plasmid constructions were assembled in S. cerevisiae BY4741 by yeast assembly. Plasmid DNAs were amplified in E. coli and prepared using a Plasmid Midi Purification Kit (Genaxxon, Ulm, Germany). For sequencing verification, PCR fragments were cloned either into pJET (Thermo Fisher Scientific, Waltham, MA, USA) or pGEM (Promega, Madison, WI, USA). DNA sequences of H. uvarum were obtained from the publicly available genomes of both DSM2768 (Accession: SAMN01885404) and AWRI3580 (Accession: SAMN04331434). By using corresponding S. cerevisiae homologs as queries, putative regions of interest, including the ATF1 locus (HuATF1) and the promoter regions of TEF1, FBA1, and PGK1 were identified using the BLAST function on NCBI. The TEF1, FBA1, and PGK1 promoter were amplified from H. uvarum DSM2768 genomic DNA using primers 1/2 (TEF1), 3/4 (FBA1), and 5/6 (PGK1). To test for promoter activity, the LacZ ORF was placed under the control of H. uvarum promoters using primers 7/8 (HuTEF1-promoter), 9/10 (HuFBA1-promoter), and 11/12 (HuPGK1-promoter), which added 40 bp of flanking homology region to pLacZ (Figure 1). The upstream region of the LacZ ORF [41] was removed by restriction digestion of pLacZ with KpnI and XhoI. The linearised vector and H. uvarum promoters (HuTEF1, HuFBA1, and HuPGK1) were transformed into yeast and fused to LacZ by in vivo recombination. Transformed cells were plated out on YPD plates +200 µg/mL geneticin. After two days of incubation, X-Gal was pipetted onto plates, and then plates were incubated to visualise beta-glucosidase activity. All restriction enzymes were purchased from Thermo Fisher Scientific (Waltham, MA, USA) and all primers were purchased from Sigma-Aldrich (Steinheim, Germany). The analyses of all PCR and restriction digestion products were performed by gel electrophoresis separation on 1% agarose gels, stained with GelRed (Genaxxon Bioscience, Ulm, Germany). Sequencing was conducted by Starseq, Mainz, Germany.
The transformation cassette for creating a null mutant of the ATF1 gene within the genome of H. uvarum is shown in Figure 2b. For selection of transformants, the hygromycin-resistance gene ORF was placed under control of HuTEF1 promoter. The pRS415 vector was linearised using BamHI and HindIII. Flanking adaptor regions to control in vivo recombination were added to HuTEF1 and hph marker fragments using the primer set 13/14 and 15/16. Next, BY4741 was transformed with the two PCR products and the cut vector. In addition, 1000 bp homology region upstream and downstream of HuATF1 gene was amplified from H. uvarum DSM2768 genomic DNA using primers 17/18 and 19/20, containing 40 bp flanking homology region to pRS415 and either HuTEF1 or hph. Flanking homology regions to guide in vivo recombination were added to pJB1-HuTEF-hph using primers 21/22. Then, BY4741 was transformed with the three PCR products and the linearised vector. Further knock-out cassettes with resistance genes against geneticin (neoR), nourseothricin (natI), and zeocin (Sh Ble) under the control of the HuTEF1 promoter were designed similar to the hygromycin knock-out cassette. Primers 23–34 are additional primers that were specifically used to assemble the knock-out cassettes with these three antibiotic resistances.
To transform H. uvarum DSM2768, the constructed plasmid (pJB2-HuTEF-hph-ATF1up/down) was linearised using XhoI and XbaI. The cut plasmid was purified using GeneJET Gel Extraction Kit (Thermo Fisher Scientific, Waltham, MA, USA).

4.3. Yeast Transformation

The transformation of S. cerevisiae was done according to the lithium acetate/single strand DNA/polyethylene glycol 4000 protocol described by Gietz and Schiestl [57]. For transformation of H. uvarum DSM2768, an adaption of the protocols described by Thompson et al. [58] and Bernardi et al. [43] was used. H. uvarum DSM2768 was grown overnight in 5 mL YPD at 30 °C. Then, the culture was transferred into 50 mL YPD and incubated at 25 °C for 5 h. After centrifuging and washing with sterile double-distilled water, the culture was resuspended in 25 mL ice-cold 0.1 M lithium acetate/10 mM dithiothreitol/10 mM TE solution and incubated at room temperature for 1 h. The pellet was washed in 25 mL ice-cold sterile double-distilled water first, and then washed with 10 mL of ice-cold 1 M sorbitol. After centrifugation at 4 °C, the cells were resuspended in 100 µL of ice-cold 1 M sorbitol. For transformation, 100 µL of cell suspension were used per sample. An aliquot of 15 µL of transforming DNA or sterile distilled water as negative control, respectively, was mixed with the cell suspension and incubated on ice for 5 min before electroporation with 1.8 kV in 0.2 cm cuvettes. Cells were resuspended in 1 mL of ice-cold 1 M sorbitol and 300 µL YPD and transferred into a 1.5 mL reaction tube for a 3 h incubation at 30 °C. Shortly before the cells were plated out on selective plates (concentration of antibiotics: hygromycin 200–600 µg/mL, geneticin 200 µg/mL, nourseothricin 100–200 µg/mL, andzeocin 50–700 µg/mL) which did not contain sorbitol, they were centrifuged, and the cell pellet resuspended in 1 mL of YPD.

4.4. Verification of Yeast Transformants

Yeast transformants were picked, re-streaked on selection plates, and inoculated in 5 mL YPD including 200 µg/mL hygromycin. Genomic DNA was isolated from these cells by suspending a colony in a 100 μL solution of 200 mM lithium acetate and 1% sodium dodecyl sulphate and incubating in a 70 °C heat block, for three minutes. Thereafter, 300 μL of cooled 100% ethanol was added and centrifuged for 3 min at 13.000 min−1. The supernatant was discarded, then, 400 μL of cooled 70% ethanol was added and centrifuged again with the same settings. The supernatant was discarded, and the pellet was left to dry. Afterwards, the pellet was resuspended in 50 μL of TE buffer. For verification of transformation, G-primers were constructed (Figure 2b), targeting ~20 bp located within the transformation cassette (primers 36/37) and ~20 bp located within the genome of H. uvarum DSM2768 (primers 35/38). The resulting PCR product included either the 1000 bp HuATF1 upstream or downstream region, respectively (primer sets used, 35/36 and 37/38).

4.5. Fermentations

In this study, pasteurised Müller-Thurgau grape must, harvested in 2019 from a vineyard of the Hochschule Geisenheim University in the Rheingau wine region of Germany, was used. The total sugar content was 180.9 g/L, of which 87.0 g/L was glucose and 93.3 g/L was fructose. The primary amino acid content of the must was analysed using the NOPA (nitrogen by o-phthaldialdehyde) assay and it amounted to 19.73 mg/L. The free ammonium level was 8.17 mg/L, as determined using a Rapid Ammonium kit from Megazyme (Bray, Ireland).
Fermentations with pasteurised Müller-Thurgau grape must using H. uvarum DSM2768, as well as the transformants H. uvarum DSM2768 (WT/Δ)/(Δ/Δ) generated within this study, were performed. Precultures of all yeast strains were prepared in shake flasks with YPD and incubated overnight at 30 °C. The next day, the must was inoculated with approximately 1 × 106 cells/mL (as determined via hemocytometer). Fermentations were carried out in triplicate, utilising 250 mL fermentation flasks closed with aluminium foil. The fermentation temperature was 17 °C and flasks were shaken at 120 min−1 and fermentation was stopped after 3 days. Samples for high performance liquid chromatography (HPLC) analysis and volatile compound analysis (VCA) were taken and directly measured analytically. In addition, the bio-dry mass was determined.

4.6. High Performance Liquid Chromatography (HPLC) Analysis

The final concentrations of the major organic acids, sugars, and ethanol were determined by HPLC, using a method according to Schneider et al. [59] and modified as described in [60]. An HPLC Agilent Technologies Series 1100, equipped with a binary pump, an autosampler, a multi-wavelength detector (MWD), and a refractive index detector (RID, Agilent Technologies, Steinheim, Germany) was employed. A column with a length of 250 mm, an inside diameter of 4.6 mm, and a particle size of 5 µm was used for the measurements (Allure Organic Acids Column, Restek, Bad Homburg v. d. Höhe, Germany). The MWD was set at a wavelength of 210 nm for the detection of organic acids and the RID was used for the detection of carbohydrates, organic acids, and ethanol. The eluent used was double distilled water with 0.5% ethanol and 0.0139% concentrated sulfuric acid. The flow rate was 0.6 mL/min at a temperature of 46 °C.

4.7. Volatile Compound Analysis

To analyse volatile compounds, headspace-solid phase microextraction gas chromatography mass spectrometry (HS-SPME-GC-MS) analysis was applied according to Câmara et al. [61]. An amount of 5 mL of each sample was needed to measure the quantity of different aroma compounds. A GC 7890 A, equipped with a MS 5975 B (both Agilent, Santa Clara, CA, USA), and MPS robotic autosampler and CIS 4 (both Gerstel, Mülheim an der Ruhr, Germany), was used. Before the addition of 5 mL of wine sample and 10 µL of internal standard each (concentration of stock solution standards, 600 mg/L 1-octanol and 52 mg/L cumene), 1.7 g NaCl were weighed into a 20 mL headspace vial. Solid phase microextraction was carried out using a 65 μm polydimethylsiloxane and divinylbenzol fiber (Supelco, Merck, Darmstadt, Germany). Aroma compound separation was performed with a 60 m × 0.25 mm × 1 μm gas chromatography column (Rxi®-5Si1 MS w/5m Integra-guard, Restek, Bad Homburg v. d. Höhe, Germany) with helium as carrier gas. The sample was injected in split mode (1:10, initial temperature 30 °C, rate 12 °C/s to 240 °C, hold for 4 min). The gas chromatography (GC) run started with an initial temperature of 40 °C for 4 min, raised to 210 °C (5 °C/min), and then raised to 240 °C (20 °C/min) and held for 10.5 min. Mass spectral data were acquired in a range of mass to charge ratio (m/z) of 35 to 250 and used to derive concentration values. A 5-point calibration curve was used for each volatile compound within a wine model solution of 10% ethanol with 3% tartaric acid pH 3, as described previously [62].

4.8. Data Analysis

The HPLC data were analysed using the software ChemStation for LC systems from Agilent (Agilent, Santa Clara, CA, USA). The HS-SPME-GC-MS data analyses were carried out using Agilent’s MassHunter software (Agilent, Santa Clara, CA, USA).
The graphics were created with GraphPad Prism 5 (Graph Pad Software, La Jolla, CA, USA) and statistical analyses were employed in the form of a one-way analysis of variance (ANOVA) in combination with Bonferroni’s multiple comparison test. For statistical analysis, all fermentations were done in triplicate and the values for the metabolites are the means of these triplicates.

Supplementary Materials

The following are available online at https://www.mdpi.com/1422-0067/22/4/1943/s1, Figure S1: Alignment of the amino acid sequence HuAtf1 with the two Atfs of Saccharomyces cerevisiae. The conserved WRLICLP motif as well as the HXXXDG active site are shown in boxes, Figure S2: Acetate esters, ethyl esters, and acetic acid produced after three days of fermentation of Müller-Thurgau must with Hanseniaspora uvarum DSM2768 for comparison (DSM2768 Ctrl), DSM2768 #34 (WT/Δ), DSM2768 #40 (Δ/Δ), and DSM2768 #46 (Δ/Δ). Pure must without the addition of yeasts served as a negative control (Must Ctrl). The measured acetate esters are: (a) ethyl acetate [mg/L]; (b) isoamyl acetate [μg/L]; (c) 2-methylbutyl acetate [μg/L]; (d) hexyl acetate [μg/L]; (e) 2-phenylethyl acetate [μg/L]; (f) ethyl propionate [μg/L], (g) ethyl butyrate [μg/L] and (h) acetic acid [g/L]. Acetate ester production was measured via HS-SPME-GC-MS analysis. Data are the mean of three independent experiments ± SEM, 1-way ANOVA, Bonferroni’s multiple comparison test, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Error bars indicate the standard deviation, Figure S3: Amounts of fatty acid and alcohols detected after three days of fermentation of Müller-Thurgau must with Hanseniaspora uvarum, DSM2768 for comparison (DSM2768 Ctrl), DSM2768 #34 (WT/Δ), DSM2768 #40 (Δ/Δ), and DSM2768 #46 (Δ/Δ). Pure must without the addition of yeasts served as a negative control (Must Ctrl). The measured fatty acid and alcohols are: (a) hexanoic acid [mg/L]; (b) isobutanol [mg/L]; (c) isoamyl alcohol [mg/L]; (d) 2-methyl-1-butanol [mg/L]; (e) hexanol [μg/L] and (f) 2-phenyl ethanol [mg/L]. The amounts of fatty acid and alcohols were measured via HS-SPME-GC-MS analysis. Data are the mean of three independent experiments ± SEM, 1-way ANOVA, Bonferroni’s multiple comparison test, * p < 0.05, ** p < 0.01, **** p < 0.0001. Error bars indicate the standard deviation.

Author Contributions

Conceptualisation, C.v.W., J.W., N.v.W. and J.B.; methodology, J.B., N.v.W. and J.W.; strain generation, J.B.; fermentations, J.B. and N.v.W.; analyses, S.B., validation, J.B. and N.v.W.; investigation, J.B. and N.v.W., data curation, J.B. and N.v.W.; visualisation, J.B.; writing—original draft preparation, J.B. and N.v.W.; writing—review and editing, J.B., N.v.W., I.S.P., D.R., J.W. and C.v.W. All authors have read and agreed to the published version of the manuscript.

Funding

The authors would like to thank the Hessen State Ministry of Higher Education, Research and the Arts for the financial support within the Hessen initiative for scientific and economic excellence (LOEWE) in the framework of AROMAplus (https://www.hs-geisenheim.de/aromaplus/, (accessed on 20 January 2021)). The authors thank Geisenheim University and Macquarie University for co-funding of this project and the research fellowship of N.V.W., I.S.P. is a team member of the Macquarie-led national Centre of Excellence in Synthetic Biology funded by the Australian Government thorough its agency, the Australian Research Council. J.W. is supported by the European Union Marie Skłodowska-Curie Actions Innovative Training Network Aromagenesis (764364) (https://www.aromagenesis.eu/, (accessed on 20 January 2021)).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

I.S.P. is a team member of the Macquarie-led national Centre of Excellence in Synthetic Biology funded by the Australian Government thorough its agency, the Australian Research Council. The authors would like to thank the Hessen State Ministry of Higher Education, Research and the Arts for the financial support within the Hessen initiative for scientific and economic excellence (LOEWE) in the framework of AROMAplus (https://www.hs-geisenheim.de/aromaplus/, (accessed on 20 January 2021)). J.W. is supported by the European Union Marie Skłodowska-Curie Actions Innovative Training Network Aromagenesis (764364) (https://www.aromagenesis.eu/, (accessed on 20 January 2021)). Heike Semmler and Beatrice Bernardi are thanked for their technical assistance. Christine Schlering is thanked for providing the Müller-Thurgau must. Jürgen Heinisch is thanked for providing the yeast strain DSM2768.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

MDPIMultidisciplinary Digital Publishing Institute
ATF1Alcohol acetyltransferase I
TEF1Translational elongation factor EF-1α
bpBase pair
DNADeoxyribonucleic acid
SO2Sulphur dioxide
kanMXGeneticin resistance marker
hygMXHygromycin resistance marker
ORFOpen reading frame
PCRPolymerase chain reaction
PGK13-Phosphoglycerate kinase 1
FBA1Fructose-1,6-bisphosphate aldolase 1
ATF2Alcohol acetyltransferase II
HphHygromycin b phosphotransferase
neoRNeomycin-geneticin resistance gene
natINourseothricin N-acetyltransferase
Sh BleBleomycin resistance protein
acetyl-CoAAcetyl coenzyme A
YPDYeast extract peptone dextrose media
ANOVAAnalysis of variance
TETris-ethylenediaminetetraacetic acid
HClHydrogen chloride
EDTAEthylenediaminetetraacetic acid
HPLCHigh performance liquid chromatography
VCAVolatile compound analysis
MWDMulti-wavelength detector
RIDRefractive index detector
HS-SPME-GC-MSHeadspace-solid phase microextraction gas chromatography mass Spectrometry
GCGas chromatography
MSMass spectrometry
MPSMultipurpose sampler
CISCooled injection system
NaClSodium chloride

References

  1. Martin, V.; Valera, M.; Medina, K.; Boido, E.; Carrau, F. Oenological impact of the Hanseniaspora/Kloeckera yeast genus on wines—A review. Fermentation 2018, 4, 76. [Google Scholar] [CrossRef] [Green Version]
  2. Heard, G.M.; Fleet, G.H. Evaluation of selective media for enumeration of yeasts during wine fermentation. J. Appl. Bacteriol. 1986, 60, 477–481. [Google Scholar] [CrossRef]
  3. Fleet, G. Yeast interactions and wine flavour. Int. J. Food Microbiol. 2003, 86, 11–22. [Google Scholar] [CrossRef]
  4. Heard, G.M.; Fleet, G.H. Growth of natural yeast flora during the fermentation of inoculated wines. Appl. Environ. Microbiol. 1985, 50, 727–728. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Holloway, P.; Subden, R.E.; Lachance, M.-A. The yeasts in a Riesling must from the Niagara grape-growing region of Ontario. Can. Inst. Food Sci. Technol. J. 1990, 23, 212–216. [Google Scholar] [CrossRef]
  6. Comi, G.; Romano, P.; Cocolin, L.; Fiore, C. Characterization of Kloeckera apiculata strains from the Friuli region in Northern Italy. World J. Microbiol. Biotechnol. 2001, 17, 391–394. [Google Scholar] [CrossRef]
  7. Jolly, N.P.; Augustyn, O.; Pretorius, I.S. The occurrence of non-Saccharomyces cerevisiae yeast species over three vintages in four vineyards and grape musts from four production regions of the Western Cape, South Africa. S. Afr. J. Enol. Vitic. 2003, 24. [Google Scholar] [CrossRef] [Green Version]
  8. Li, S.-S.; Cheng, C.; Li, Z.; Chen, J.-Y.; Yan, B.; Han, B.-Z.; Reeves, M. Yeast species associated with wine grapes in China. Int. J. Food Microbiol. 2010, 138, 85–90. [Google Scholar] [CrossRef]
  9. Belda, I.; Ruiz, J.; Alastruey-Izquierdo, A.; Navascués, E.; Marquina, D.; Santos, A. Unraveling the enzymatic basis of wine “flavorome”: A phylo-functional study of wine related yeast species. Front. Microbiol. 2016, 7, 12. [Google Scholar] [CrossRef] [Green Version]
  10. Tofalo, R.; Patrignani, F.; Lanciotti, R.; Perpetuini, G.; Schirone, M.; Di Gianvito, P.; Pizzoni, D.; Arfelli, G.; Suzzi, G. Aroma profile of Montepulciano d’Abruzzo wine fermented by single and co-culture starters of autochthonous Saccharomyces and non-Saccharomyces yeasts. Front. Microbiol. 2016, 7, 610. [Google Scholar] [CrossRef]
  11. Jolly, N.P.; Varela, C.; Pretorius, I.S. Not your ordinary yeast: Non-Saccharomyces yeasts in wine production uncovered. FEMS Yeast Res. 2014, 14, 215–237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Wang, C.; Mas, A.; Esteve-Zarzoso, B. Interaction between Hanseniaspora uvarum and Saccharomyces cerevisiae during alcoholic fermentation. Int. J. Food Microbiol. 2015, 206, 67–74. [Google Scholar] [CrossRef] [PubMed]
  13. Pina, C.; Santos, C.; Couto, J.A.; Hogg, T. Ethanol tolerance of five non-Saccharomyces wine yeasts in comparison with a strain of Saccharomyces cerevisiae—Influence of different culture conditions. Food Microbiol. 2004, 21, 439–447. [Google Scholar] [CrossRef]
  14. Akan, M.; Michling, F.; Matti, K.; Krause, S.; Muno-Bender, J.; Wendland, J. Snails as taxis for a large yeast biodiversity. Fermentation 2020, 6, 90. [Google Scholar] [CrossRef]
  15. Comitini, F.; Ciani, M. The zymocidial activity of Tetrapisispora phaffii in the control of Hanseniaspora uvarum during the early stages of winemaking. Lett. Appl. Microbiol. 2010, 50, 50–56. [Google Scholar] [CrossRef]
  16. Tristezza, M.; Tufariello, M.; Capozzi, V.; Spano, G.; Mita, G.; Grieco, F. The oenological potential of Hanseniaspora uvarum in simultaneous and sequential co-fermentation with Saccharomyces cerevisiae for industrial wine production. Front. Microbiol. 2016, 7, 670. [Google Scholar] [CrossRef] [Green Version]
  17. Petruzzi, L.; Capozzi, V.; Berbegal, C.; Corbo, M.R.; Bevilacqua, A.; Spano, G.; Sinigaglia, M. Microbial resources and enological significance: Opportunities and benefits. Front. Microbiol. 2017, 8, 995. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Roudil, L.; Russo, P.; Berbegal, C.; Albertin, W.; Spano, G.; Capozzi, V. Non-Saccharomyces commercial starter cultures: Scientific trends, recent patents and innovation in the wine sector. Recent Pat. Food Nutr. Agric. 2020, 11, 27–39. [Google Scholar] [CrossRef]
  19. Van Wyk, N.; von Wallbrunn, C.; Swiegers, J.H.; Pretorius, I.S. Biotechnology of wine yeasts. In Encyclopedia of Mycology; Elsevier: Amsterdam, The Netherlands, 2020; ISBN 9780128096338. [Google Scholar]
  20. Valles, B.S.; Bedriñana, R.P.; Tascón, N.F.; Simón, A.Q.; Madrera, R.R. Yeast species associated with the spontaneous fermentation of cider. Food Microbiol. 2007, 24, 25–31. [Google Scholar] [CrossRef]
  21. Lachance, M.A. Yeast communities in a natural tequila fermentation. Antonie van Leeuwenhoek 1995, 68, 151–160. [Google Scholar] [CrossRef] [PubMed]
  22. Masoud, W.; Cesar, L.B.; Jespersen, L.; Jakobsen, M. Yeast involved in fermentation of Coffea arabica in East Africa determined by genotyping and by direct denaturating gradient gel electrophoresis. Yeast 2004, 21, 549–556. [Google Scholar] [CrossRef]
  23. Batista, N.N.; Ramos, C.L.; Ribeiro, D.D.; Pinheiro, A.C.M.; Schwan, R.F. Dynamic behavior of Saccharomyces cerevisiae, Pichia kluyveri and Hanseniaspora uvarum during spontaneous and inoculated cocoa fermentations and their effect on sensory characteristics of chocolate. LWT—Food Sci. Technol. 2015, 63, 221–227. [Google Scholar] [CrossRef] [Green Version]
  24. Arias, C.R.; Burns, J.K.; Friedrich, L.M.; Goodrich, R.M.; Parish, M.E. Yeast species associated with orange juice: Evaluation of different identification methods. Appl. Environ. Microbiol. 2002, 68, 1955–1961. [Google Scholar] [CrossRef] [Green Version]
  25. Vadkertiová, R.; Dudášová, H.; Stratilová, E.; Balaščáková, M. Diversity of yeasts in the soil adjacent to fruit trees of the Rosaceae family. Yeast 2019, 36, 617–631. [Google Scholar] [CrossRef] [PubMed]
  26. Sláviková, E.; Vadkertiová, R.; Vránová, D. Yeasts colonizing the leaves of fruit trees. Ann. Microbiol. 2009, 59, 419–424. [Google Scholar] [CrossRef]
  27. Nguyen, N.H.; Suh, S.-O.; Blackwell, M. Five novel Candida species in insect-associated yeast clades isolated from Neuroptera and other insects. Mycologia 2007, 99, 842–858. [Google Scholar] [CrossRef] [PubMed]
  28. Kocan, R.M.; Hasenclever, H.F. Normal yeast flora of the upper digestive tract of some wild columbids. J. Wildl. Dis. 1972, 8, 365–368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. De Araujo, F.V.; Soares, C.A.; Hagler, A.N.; Mendonça-Hagler, L.C. Ascomycetous yeast communities of marine invertebrates in a southeast Brazilian mangrove ecosystem. Antonie van Leeuwenhoek 1995, 68, 91–99. [Google Scholar] [CrossRef] [PubMed]
  30. Pagnocca, F.G.; Mendonca-Hagler, L.C.; Hagler, A.N. Yeasts associated with the white shrimp Penaeus schmitti, sediment, and water of Sepetiba Bay, Rio de Janeiro, Brasil. Yeast 1989, 5, 479–483. [Google Scholar]
  31. Long, C.; Wu, Z.; Deng, B.-X. Biological control of Penicillium italicum of citrus and Botrytis cinerea of grape by strain 34–9 of Kloeckera apiculata. Eur. Food Res. Technol. 2005, 221, 197–201. [Google Scholar] [CrossRef]
  32. Basha, H.; Ramanujam, B. Growth promotion effect of Pichia guilliermondii in chilli and biocontrol potential of Hanseniaspora uvarum against Colletotrichum capsici causing fruit rot. Biocontrol Sci. Technol. 2015, 25, 185–206. [Google Scholar] [CrossRef]
  33. Liu, H.M.; Guo, J.H.; Cheng, Y.J.; Luo, L.; Liu, P.; Wang, B.Q.; Deng, B.X.; Long, C.A. Control of gray mold of grape by Hanseniaspora uvarum and its effects on postharvest quality parameters. Ann. Microbiol. 2010, 60, 31–35. [Google Scholar] [CrossRef]
  34. Sternes, P.R.; Lee, D.; Kutyna, D.R.; Borneman, A.R. Genome sequences of three species of Hanseniaspora isolated from spontaneous wine fermentations. Genome Announc. 2016, 4. [Google Scholar] [CrossRef] [Green Version]
  35. Seixas, I.; Barbosa, C.; Mendes-Faia, A.; Güldener, U.; Tenreiro, R.; Mendes-Ferreira, A.; Mira, N.P. Genome sequence of the non-conventional wine yeast Hanseniaspora guilliermondii UTAD222 unveils relevant traits of this species and of the Hanseniaspora genus in the context of wine fermentation. DNA Res. 2019, 26, 67–83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Guaragnella, N.; Chiara, M.; Capece, A.; Romano, P.; Pietrafesa, R.; Siesto, G.; Manzari, C.; Pesole, G. Genome sequencing and comparative analysis of three Hanseniaspora uvarum indigenous wine strains reveal remarkable biotechnological potential. Front. Microbiol. 2019, 10, 3133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Chen, K.; Yang, X.; Zheng, F.; Long, C. Genome sequencing and analysis of Kloeckera apiculata strain 34-9, a biocontrol agent against postharvest pathogens in citrus. Genes Genom. 2017, 39, 87–99. [Google Scholar] [CrossRef]
  38. Langenberg, A.-K.; Bink, F.J.; Wolff, L.; Walter, S.; von Wallbrunn, C.; Grossmann, M.; Heinisch, J.J.; Schmitz, H.-P. Glycolytic functions are conserved in the genome of the wine yeast Hanseniaspora uvarum, and pyruvate kinase limits its capacity for alcoholic fermentation. Appl. Environ. Microbiol. 2017, 83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Steenwyk, J.L.; Opulente, D.A.; Kominek, J.; Shen, X.-X.; Zhou, X.; Labella, A.L.; Bradley, N.P.; Eichman, B.F.; Čadež, N.; Libkind, D.; et al. Extensive loss of cell-cycle and DNA repair genes in an ancient lineage of bipolar budding yeasts. PLoS Biol. 2019, 17, e3000255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Saubin, M.; Devillers, H.; Proust, L.; Brier, C.; Grondin, C.; Pradal, M.; Legras, J.-L.; Neuvéglise, C. Investigation of genetic relationships between Hanseniaspora species found in grape musts revealed interspecific hybrids with dynamic genome structures. Front. Microbiol. 2019, 10, 2960. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Kayacan, Y.; Griffiths, A.; Wendland, J. A script for initiating molecular biology studies with non-conventional yeasts based on Saccharomycopsis schoenii. Microbiol. Res. 2019, 229, 126342. [Google Scholar] [CrossRef] [PubMed]
  42. Nancolas, B.; Bull, I.D.; Stenner, R.; Dufour, V.; Curnow, P. Saccharomyces cerevisiae Atf1p is an alcohol acetyltransferase and a thioesterase in vitro. Yeast 2017, 34, 239–251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Bernardi, B.; Kayacan, Y.; Akan, M.; Wendland, J. Overexpression of RAD51 enables PCR-based gene targeting in lager yeast. Microorganisms 2019, 7, 192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Sakai, K.; Yamamoto, M. Transformation of the yeast, Saccharomyces carlsbergensis, using an antibiotic resistance marker. Agric. Biol. Chem. 1986, 50, 1177–1182. [Google Scholar] [CrossRef]
  45. Nakazawa, N.; Hashimoto, H.; Harashima, S.; Oshima, Y. Use of the PDR4 gene as a dominant selective marker in combination with cerulenin for prototrophic strains in Saccharomyces cerevisiae. J. Ferment. Bioeng. 1993, 76, 60–63. [Google Scholar] [CrossRef]
  46. Kondo, K.; Saito, T.; Kajiwara, S.; Takagi, M.; Misawa, N. A transformation system for the yeast Candida utilis: Use of a modified endogenous ribosomal protein gene as a drug-resistant marker and ribosomal DNA as an integration target for vector DNA. J. Bacteriol. 1995, 177, 7171–7177. [Google Scholar] [CrossRef] [Green Version]
  47. Hashida-Okado, T.; Ogawa, A.; Kato, I.; Takesako, K. Transformation system for prototrophic industrial yeasts using the AUR1 gene as a dominant selection marker. FEBS Lett. 1998, 425, 117–122. [Google Scholar] [CrossRef] [Green Version]
  48. Lilly, M.; Bauer, F.F.; Lambrechts, M.G.; Swiegers, J.H.; Cozzolino, D.; Pretorius, I.S. The effect of increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles of wine and distillates. Yeast 2006, 23, 641–659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Verstrepen, K.J.; van Laere, S.D.M.; Vanderhaegen, B.M.P.; Derdelinckx, G.; Dufour, J.-P.; Pretorius, I.S.; Winderickx, J.; Thevelein, J.M.; Delvaux, F.R. Expression levels of the yeast alcohol acetyltransferase genes ATF1, Lg-ATF1, and ATF2 control the formation of a broad range of volatile esters. Appl. Environ. Microbiol. 2003, 69, 5228–5237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Christiaens, J.F.; Franco, L.M.; Cools, T.L.; de Meester, L.; Michiels, J.; Wenseleers, T.; Hassan, B.A.; Yaksi, E.; Verstrepen, K.J. The fungal aroma gene ATF1 promotes dispersal of yeast cells through insect vectors. Cell Rep. 2014, 9, 425–432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Van Wyk, N.; Kroukamp, H.; Espinosa, M.I.; von Wallbrunn, C.; Wendland, J.; Pretorius, I.S. Blending wine yeast phenotypes with the aid of CRISPR DNA editing technologies. Int. J. Food Microbiol. 2020, 324, 108615. [Google Scholar] [CrossRef] [PubMed]
  52. Sikorski, R.S.; Hieter, P. A System of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 1989, 122, 19–27. [Google Scholar] [CrossRef]
  53. Chee, M.K.; Haase, S.B. New and redesigned pRS plasmid shuttle vectors for genetic manipulation of Saccharomyces cerevisiae. G3 Genes|Genomes|Genetics 2012, 2, 515–526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Wach, A.; Brachat, A.; Pöhlmann, R.; Philippsen, P. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 1994, 10, 1793–1808. [Google Scholar] [CrossRef] [PubMed]
  55. Schaub, Y.; Dünkler, A.; Walther, A.; Wendland, J. New pFA-cassettes for PCR-based gene manipulation in Candida albicans. J. Basic Microbiol. 2006, 46, 416–429. [Google Scholar] [CrossRef] [PubMed]
  56. Gatignol, A.; Dassain, M.; Tiraby, G. Cloning of Saccharomyces cerevisiae promoters using a probe vector based on phleomycin resistance. Gene 1990, 91, 35–41. [Google Scholar] [CrossRef]
  57. Gietz, R.D.; Schiestl, R.H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2007, 2, 31–34. [Google Scholar] [CrossRef]
  58. Thompson, J.R.; Register, E.; Curotto, J.; Kurtz, M.; Kelly, R. An improved protocol for the preparation of yeast cells for transformation by electroporation. Yeast 1998, 14, 565–571. [Google Scholar] [CrossRef]
  59. Schneider, A.; Gerbi, V.; Redoglia, M. A rapid HPLC method for separation and determination of major organic acids in grape musts and wines. Am. J. Enol. Vitic. 1987, 38, 151. [Google Scholar]
  60. Mecca, D.; Benito, S.; Beisert, B.; Brezina, S.; Fritsch, S.; Semmler, H.; Rauhut, D. Influence of nutrient supplementation on Torulaspora Delbrueckii wine fermentation aroma. Fermentation 2020, 6, 35. [Google Scholar] [CrossRef] [Green Version]
  61. Câmara, J.S.; Alves, M.A.; Marques, J.C. Development of headspace solid-phase microextraction-gas chromatography–mass spectrometry methodology for analysis of terpenoids in Madeira wines. Anal. Chim. Acta 2006, 555, 191–200. [Google Scholar] [CrossRef]
  62. Dutraive, O.; Benito, S.; Fritsch, S.; Beisert, B.; Patz, C.-D.; Rauhut, D. Effect of sequential inoculation with non-Saccharomyces and Saccharomyces yeasts on Riesling wine chemical composition. Fermentation 2019, 5, 79. [Google Scholar] [CrossRef] [Green Version]
Ijms 22 01943 g001 550
Figure 1. Plasmid constructs and testing of the functionality of three putative Hanseniaspora uvarum promoters, HuTEF1, HuFBA1, and HuPGK1, in Saccharomyces cerevisiae using Streptococcus thermophilus LacZ as reporter gene (picture on the right, blue colonies indicate the conversion of X-gal by beta-galactosidase). (a) pRS417-SsMET25-LacZ [41] (negative control); (b) pRS417-SsTEF1-LacZ [41] (positive control); (c) pRS417-HuTEF1-LacZ construct, generated as described in Section 4.2 using primer set 7/8 (for primers see description in Section 4.2; (d) pRS417-HuFBA1-LacZ, built using primer set 9/10; (e) pRS417-HuPGK1-LacZ built using primer set 11/12. SsMET25 and SsTEF1 are promoter sequences from Saccharomycopsis schoenii [41].
Figure 1. Plasmid constructs and testing of the functionality of three putative Hanseniaspora uvarum promoters, HuTEF1, HuFBA1, and HuPGK1, in Saccharomyces cerevisiae using Streptococcus thermophilus LacZ as reporter gene (picture on the right, blue colonies indicate the conversion of X-gal by beta-galactosidase). (a) pRS417-SsMET25-LacZ [41] (negative control); (b) pRS417-SsTEF1-LacZ [41] (positive control); (c) pRS417-HuTEF1-LacZ construct, generated as described in Section 4.2 using primer set 7/8 (for primers see description in Section 4.2; (d) pRS417-HuFBA1-LacZ, built using primer set 9/10; (e) pRS417-HuPGK1-LacZ built using primer set 11/12. SsMET25 and SsTEF1 are promoter sequences from Saccharomycopsis schoenii [41].
Ijms 22 01943 g001
Ijms 22 01943 g002 550
Figure 2. (a) Alignment of the amino acid sequence of the Hanseniaspora uvarum HuAtf1 with the two S. cerevisiae Atf proteins. The conserved WRLICLP motif as well as the HXXXDG active site [42] are shown in boxes; (b) Replacement of the HuATF1 ORF by HuTEF1_hph. HuATF1 was replaced by the HuTEF1 promoter in front of the selection marker hph with 1000 bp of flanking regions that are upstream and downstream of the HuATF1 ORF. The G1/G2, G3/G4, and G5/G6 diagnostic primer sets were used to verify correct integration of the marker cassette and deletion of HuATF1. The G5/G6 primer set was used to determine the absence of HuATF1, and thus a double knock-out due to the different nucleotide size of HuATF1 and HuTEF1-hph; (c) GelRed stained agarose gel showing PCR amplification of HuATF1 using primer set 39/40. (1) DSM2768 Ctrl, (2) DSM2768 #34 (WT/Δ), (3) DSM2768 #40 (Δ/Δ), (4) DSM2768 #46 (Δ/Δ), (5) DSM2768 #97 (WT/Δ). Resulting bands with size of ~1.4 kb; (d) GelRed stained agarose gel showing PCR amplification of wild type, single, or double knock-out of HuATF1 using primer set 41/42 (G5/G6). (1) DSM2768 Ctrl, (2) DSM2768 #40 (Δ/Δ), (3) DSM2768 #34 (WT/Δ). Resulting bands with size of 2 kb and 2.5 kb.
Figure 2. (a) Alignment of the amino acid sequence of the Hanseniaspora uvarum HuAtf1 with the two S. cerevisiae Atf proteins. The conserved WRLICLP motif as well as the HXXXDG active site [42] are shown in boxes; (b) Replacement of the HuATF1 ORF by HuTEF1_hph. HuATF1 was replaced by the HuTEF1 promoter in front of the selection marker hph with 1000 bp of flanking regions that are upstream and downstream of the HuATF1 ORF. The G1/G2, G3/G4, and G5/G6 diagnostic primer sets were used to verify correct integration of the marker cassette and deletion of HuATF1. The G5/G6 primer set was used to determine the absence of HuATF1, and thus a double knock-out due to the different nucleotide size of HuATF1 and HuTEF1-hph; (c) GelRed stained agarose gel showing PCR amplification of HuATF1 using primer set 39/40. (1) DSM2768 Ctrl, (2) DSM2768 #34 (WT/Δ), (3) DSM2768 #40 (Δ/Δ), (4) DSM2768 #46 (Δ/Δ), (5) DSM2768 #97 (WT/Δ). Resulting bands with size of ~1.4 kb; (d) GelRed stained agarose gel showing PCR amplification of wild type, single, or double knock-out of HuATF1 using primer set 41/42 (G5/G6). (1) DSM2768 Ctrl, (2) DSM2768 #40 (Δ/Δ), (3) DSM2768 #34 (WT/Δ). Resulting bands with size of 2 kb and 2.5 kb.
Ijms 22 01943 g002
Ijms 22 01943 g003 550
Figure 3. Acetate ester production and formation of higher alcohols during fermentation. (a) Total acetate ester production (mg/L) including ethyl acetate, isoamyl acetate, 2-methylbutyl acetate, hexyl acetate, and 2-phenylethyl acetate; (b) Acetate ester production (mg/L) excluding ethyl acetate; (c) The formation of respective higher alcohols (mg/L) including isoamyl alcohol, 2-methyl-1-butanol, hexanol, and 2-phenyl ethanol after three days of fermentation of Müller-Thurgau must with H. uvarum DSM2768 for comparison (DSM2768 Ctrl), DSM2768 #34 (WT/Δ), DSM2768 #40 (Δ/Δ), and DSM2768 #46 (Δ/Δ). Pure must without the addition of yeasts served as a negative control (Must Ctrl). Total ester production was measured via HS-SPME-GC-MS analysis while acetic acid production was measured via high performance liquid chromatography (HPLC) analysis. Data are the mean of three independent experiments ± SEM, 1-way ANOVA, Bonferroni’s multiple comparison test, * p < 0.05 and **** p < 0.0001. Error bars indicate the standard deviation.
Figure 3. Acetate ester production and formation of higher alcohols during fermentation. (a) Total acetate ester production (mg/L) including ethyl acetate, isoamyl acetate, 2-methylbutyl acetate, hexyl acetate, and 2-phenylethyl acetate; (b) Acetate ester production (mg/L) excluding ethyl acetate; (c) The formation of respective higher alcohols (mg/L) including isoamyl alcohol, 2-methyl-1-butanol, hexanol, and 2-phenyl ethanol after three days of fermentation of Müller-Thurgau must with H. uvarum DSM2768 for comparison (DSM2768 Ctrl), DSM2768 #34 (WT/Δ), DSM2768 #40 (Δ/Δ), and DSM2768 #46 (Δ/Δ). Pure must without the addition of yeasts served as a negative control (Must Ctrl). Total ester production was measured via HS-SPME-GC-MS analysis while acetic acid production was measured via high performance liquid chromatography (HPLC) analysis. Data are the mean of three independent experiments ± SEM, 1-way ANOVA, Bonferroni’s multiple comparison test, * p < 0.05 and **** p < 0.0001. Error bars indicate the standard deviation.
Ijms 22 01943 g003
Ijms 22 01943 g004 550
Figure 4. (a) Total sugar consumption (g/L); (b) Ethanol production (%) after three days of fermentation of Müller-Thurgau must with H. uvarum DSM2768 for comparison (DSM2768 Ctrl), DSM2768 #34 (WT/Δ), DSM2768 #40 (Δ/Δ), and DSM2768 #46 (Δ/Δ). Pure must without the addition of yeasts served as a negative control (Must Ctrl). The amount of total sugar and ethanol produced was measured via high performance liquid chromatography (HPLC) analysis. Data are the mean of three independent experiments ± SEM, 1-way ANOVA, Bonferroni’s multiple comparison test, *** p < 0.001. Error bars indicate the standard deviation.
Figure 4. (a) Total sugar consumption (g/L); (b) Ethanol production (%) after three days of fermentation of Müller-Thurgau must with H. uvarum DSM2768 for comparison (DSM2768 Ctrl), DSM2768 #34 (WT/Δ), DSM2768 #40 (Δ/Δ), and DSM2768 #46 (Δ/Δ). Pure must without the addition of yeasts served as a negative control (Must Ctrl). The amount of total sugar and ethanol produced was measured via high performance liquid chromatography (HPLC) analysis. Data are the mean of three independent experiments ± SEM, 1-way ANOVA, Bonferroni’s multiple comparison test, *** p < 0.001. Error bars indicate the standard deviation.
Ijms 22 01943 g004
Table
Table 1. Strains used and generated in this study.
Table 1. Strains used and generated in this study.
StrainFeature/GenotypeSource
BY4741Saccharomyces cerevisiae MATa his3Δ1, leu2Δ0, met15Δ0, ura3Δ0Euroscarf, Oberursel, Germany
DSM2768Hanseniaspora uvarum ATF1/ATF1[38]
DSM2768 (WT/Δ)Hanseniaspora uvarum ATF1/atf1:HuTEF1-hphThis study
DSM2768 (Δ/Δ)Hanseniaspora uvarum atf1:HuTEF1-hph/atf1:HuTEF1-hphThis study
Table
Table 2. Plasmids used and generated in this study.
Table 2. Plasmids used and generated in this study.
StrainFeature/GenotypeSource
pRS415bla, LEU2[52]
pGEMblaPromega, Madison, WI, USA
pJETblaThermo Fisher Scientific, Waltham, MA, USA
pRS417-SsTEF-lacZbla, GEN3, lacZ driven by
S. schoenii TEF1 promoter		[41]
pRS417-SsMET25-lacZbla, GEN3, lacZ driven by
S. schoenii MET25 promoter		[41]
pRS417-HuTEF-lacZbla, GEN3, lacZ driven by
H. uvarum TEF1 promoter		This study
pRS417-HuFBA-lacZbla, GEN3, lacZ driven by
H. uvarum FBA1 promoter		This study
pRS417-HuPGK-lacZbla, GEN3, lacZ driven by
H. uvarum PGK1 promoter		This study
pRS40HHygMX[53]
pTEFpJET-HuTEF1This study
pJB1-HuTEF-hphpRS415-HuTEF1-hphThis study
pJB2-HuTEF-hph-ATF1up/downpRS415-HuTEF1-hph-1000 bp HuATF1 upstream/downstreamThis study
pFA-KanMX6KanMX6[54]
pJB3-HuTEF-neoRpRS415-HuTEF1-neoRThis study
pFA-NatMX3NatMX3[55]
pJB4-HuTEF-natIpRS415-HuTEF1-natIThis study
pZeoRBleMX6[56]
pJB5-HuTEF-Sh BlepRS415-HuTEF1-Sh BleThis study
pJB6-HuTEF-Sh Ble-ATF1up/downpRS415-HuTEF1-Sh Ble-1000 bp HuATF1 upstream/downstreamThis study
Table
Table 3. Primers used in this study.
Table 3. Primers used in this study.
Primer NumberPrimer NameSequence 5′ → 3′
Hu-Promoter Test
1TEF_LTTGATGGATAACTTGAAGGC
2TEF_RTCTATATACTGTATACCTTAG
3FBA_LGAAGATATACTAAATTTGTCCC
4FBA_RAATGTATGTATTTGTATAATTGATATTATTATGG
5PGK_LTGATTATGACTCTGATAGCAAC
6PGK_RTTTTAAGATTTGTAGTAATTTAATTGTTTATATG
7TEF forw. LacZCGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACG
ACGGCCAGTGTTGATGGATAACTTGAAGGC
8TEF rev. LacZCAATCTTTGGATCGTTTAAATAAGTTTGAATTTTT
TCAGTCATGTTTCTATATACTGTATACCTTAG
9FBA forw. LacZCGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACG ACGGCCAGTGGAAGATATACTAAATTTGTCCC
10FBA rev. LacZCAATCTTTGGATCGTTTAAATAAGTTTGAATTTTTTCAGTCA TGTTAATGTATGTATTTGTATAATTGATAT TATTATGG
11PGK forw. LacZCGCCAGGGTTTTCCCAGTCACGACGTTGTAAAAC GACGGCCAGTGTGATTATGACTCTGATAGCAAC
12PGK rev. LacZCAATCTTTGGATCGTTTAAATAAGTTTGAATTTTTTCAGTC ATGTTTTTTAAGATTTGTAGTAATTTAATTGTTTATATG
Construction Knock-Out Cassettehph
13pRS415 (ov) + TEF_LATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTA
TCGATTTGATGGATAACTTGAAGGC
14TEF_R+hyg (ov)TTTTTCAACAGAAGTAGCAGTCAATTCTGGTTTTT
TCATTCTATATACTGTATACCTTAG
15TEF (ov) + hyg_LAGCGGTATAACCATAGAAACTAAGGTATACAGTAT
ATAGAATGAAAAAACCAGAATTGAC
16hyg_R + pRS415 (ov)GCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAA
CTAGTAGGACCACCTTTGATTGTAA
17pRS415 (ov) + ATFup_LATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTA
TCGATGTACATCTGTTTTTAATGCT
18ATFup_R + TEF (ov)AGTATGGCCATTGTTATGATGCCTTCAAGTTATCC
ATCAACTCCGAGGTAATGTTTTTGA
19Hyg (ov) + ATFdown_L NEWAGGGTGGTAATTATTACTATTTACAATCAAAGGTG
GTCCTTCAAAATATTGTATTTTCTT
20ATFdown_R + pRS415 (ov) NEWCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAAC
TAGTGTATCCCAACAAAAGATAGAA
21ATFup (ov) + TEF_LTTAACCCCAGCAGGAATACATCAAAAACATTACCT
CGGAGTTGATGGATAACTTGAAGGC
22Hyg_R + ATFdown (ov) NEWTAAAAAGAATAAAACTTTGAAAGAAAATACAATAT
TTTGAAGGACCACCTTTGATTGTAA
Construction Knock-Out CassetteneoR, natI, Sh Ble
23TEF_R + kanMX (ov)CGTATAAATCAGCATCCATTCTATATACTGTATACC TTAGTTTCTATGGTTATACCGCTA
24TEF (ov) + kanMX_LAGCGGTATAACCATAGAAACTAAGGTATACAGTAT ATAGAATGGATGCTGATTTATACGG
25kanMX_R + pRS415 (ov)GCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAA CTAGTTAATAAATTATTTTTATTGT
26kanMX_R + ATFdown (ov)GGATCGTAAAGTCTATTAAAACTTTTAAAGTAATT GAACTTAATAAATTATTTTTATTGT
27kanMX (ov) + ATFdown_LTTCTTGCTTTATAAATAACAACAATAAAAATAATTT ATTAAGTTCAATTACTTTAAAAGT
28TEF_R + clo (ov)CCAATGTTTCAGCAACTTGTTCAGGAATAACAGAAA TTTTTCTATATACTGTATACCTTA
29clo_L + TEF (ov)AGCGGTATAACCATAGAAACTAAGGTATACAGTAT ATAGAAAAATTTCTGTTATTCCTGA
30TEF_R + Zeo (ov)GAGCAGTCAGGACTGGAACAGCAGAGGTGAGTTTA GCCATTCTATATACTGTATACCTTA
31Zeo_L + TEF (ov)AGCGGTATAACCATAGAAACTAAGGTATACAGTAT ATAGAATGGCTAAACTCACCTCTGC
32ATFdown_L + Zeo (ov)GTTTTATTATCTATTTATGCCCTTATATTCTGTAACTA TCTCAAAATATTGTATTTTCTT
33Zeo_R + ATFdown (ov)TAAAAAGAATAAAACTTTGAAAGAAAATACAATAT TTTGAGATAGTTACAGAATATAAGG
34Zeo_R + pRS415 (ov)CTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACT AGTGGATAGTTACAGAATATAAGG
Verification of Gene Deletion inH. uvarum(see Figure 2)
35G1 ATF1 FATTCCTGCGCAGTCTTAAGCTT
36G2 RCAAATCGCTGAAATGGGTGCT
37G3 FCAGGTGCTGGTACTGTTGGT
38G4 ATF1 R NEWAGAATCTTTTGACCGAGCATGA
39ATF1_LTTAATTAAATGCTTACGCTTTCGGATGTTC
40HuATF1 RAAAGGCGCGCCTACAATATTTTGACTAAATGTTAT
41G5 ATFup-TEF_LCAAAAGGCAACCATTCCCCC
42G6 ATFdown-Hyg_RCTGCCATGGCCAATATTCCA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Badura, J.; van Wyk, N.; Brezina, S.; Pretorius, I.S.; Rauhut, D.; Wendland, J.; von Wallbrunn, C. Development of Genetic Modification Tools for Hanseniasporauvarum. Int. J. Mol. Sci. 2021, 22, 1943. https://doi.org/10.3390/ijms22041943

AMA Style

Badura J, van Wyk N, Brezina S, Pretorius IS, Rauhut D, Wendland J, von Wallbrunn C. Development of Genetic Modification Tools for Hanseniasporauvarum. International Journal of Molecular Sciences. 2021; 22(4):1943. https://doi.org/10.3390/ijms22041943

Chicago/Turabian Style

Badura, Jennifer, Niël van Wyk, Silvia Brezina, Isak S. Pretorius, Doris Rauhut, Jürgen Wendland, and Christian von Wallbrunn. 2021. "Development of Genetic Modification Tools for Hanseniasporauvarum" International Journal of Molecular Sciences 22, no. 4: 1943. https://doi.org/10.3390/ijms22041943

APA Style

Badura, J., van Wyk, N., Brezina, S., Pretorius, I. S., Rauhut, D., Wendland, J., & von Wallbrunn, C. (2021). Development of Genetic Modification Tools for Hanseniasporauvarum. International Journal of Molecular Sciences, 22(4), 1943. https://doi.org/10.3390/ijms22041943

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop