Coapplication of Magnesium Supplementation and Vibration Modulate Macrophage Polarization to Attenuate Sarcopenic Muscle Atrophy through PI3K/Akt/mTOR Signaling Pathway
Abstract
:1. Introduction
2. Results
2.1. In Vivo Results
2.1.1. VIB and Mg Treatments Could Enhance Whole-Body Composition and Fiber Type Switch during Sarcopenia
2.1.2. Combined Treatment Yielded Better Treatment Effects in Whole Body Composition and Modulated Muscle Fiber Type Development during Progress of Sarcopenia
2.1.3. VIB and Mg Treatments Could Enhance Muscle Function to Ameliorate Muscle Aging Effects
2.1.4. Magnesium Supplementation and Vibration Treatment Regulated Macrophage Skewing and Reduced Inflammation during Sarcopenia
2.1.5. All Treatments Enhanced Muscle Proliferation and Prevented Expression of Muscle-Atrophy-Induced Ubiquitin Ligases via the PI3K/Akt/mTOR Pathway
2.2. In Vitro Results
Myotube Formation of Treatment Groups via the PI3K/Akt/mTOR Pathway
3. Discussion
4. Methodology
4.1. Animal Model and Study Design
4.2. Grip Strength Measurement
4.3. Muscle Mass by Dual-Energy X-ray Absorptiometry (DXA)
4.4. Muscle Strength by Ex Vivo Functional Test
4.5. Serum Mg Levels
4.6. C2C12 Myoblast Cell Culture
4.7. Immunohistochemical and Immunofluorescence Staining of Myofibers and C2C12 Myotubes
4.8. MRF and Atrogene mRNA Expression by Real-Time PCR
4.9. Protein Expression by Western Blot
4.10. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kwan, P. Sarcopenia, a neurogenic syndrome? J. Aging Res. 2013, 2013, 791679. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cruz-Jentoft, A.J.; Bahat, G.; Bauer, J.; Boirie, Y.; Bruyere, O.; Cederholm, T.; Cooper, C.; Landi, F.; Rolland, Y.; Sayer, A.A.; et al. Sarcopenia: Revised European consensus on definition and diagnosis. Age Ageing 2019, 48, 16–31. [Google Scholar] [CrossRef] [Green Version]
- Zammit, P.S. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin. Cell Dev. Biol. 2017, 72, 19–32. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Hu, P. Skeletal muscle regeneration is modulated by inflammation. J. Orthop. Translat. 2018, 13, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Miyazaki, M.; Moriya, N.; Takemasa, T. Transient activation of mTORC1 signaling in skeletal muscle is independent of Akt1 regulation. Physiol. Rep. 2020, 8, e14599. [Google Scholar] [CrossRef] [PubMed]
- Foletta, V.; White, L.; Larsen, A.; Léger, B.; Russell, A. The role and regulation of MAFbx/atrogin-1 and MuRF1 in skeletal muscle atrophy. Pflügers Arch. Eur. J. Physiol. 2011, 461, 325–335. [Google Scholar] [CrossRef] [PubMed]
- Bodine, S.; Baehr, L. Skeletal Muscle Atrophy and the E3 Ubiquitin Ligases, MuRF1 and MAFbx/Atrogin-1. Am. J. Physiol. Endocrinol. Metab. 2014, 307, E469–E484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Edström, E.; Altun, M.; Hägglund, M.; Ulfhake, B. Atrogin-1/MAFbx and MuRF1 Are Downregulated in Aging-Related Loss of Skeletal Muscle. J. Gerontol. Ser. A 2006, 61, 663–674. [Google Scholar] [CrossRef] [PubMed]
- Cui, C.-Y.; Driscoll, R.K.; Piao, Y.; Chia, C.W.; Gorospe, M.; Ferrucci, L. Skewed macrophage polarization in aging skeletal muscle. Aging Cell 2019, 18, e13032. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Wehling-Henricks, M.; Welc, S.S.; Fisher, A.L.; Zuo, Q.; Tidball, J.G. Aging of the immune system causes reductions in muscle stem cell populations, promotes their shift to a fibrogenic phenotype, and modulates sarcopenia. FASEB J. 2019, 33, 1415–1427. [Google Scholar] [CrossRef]
- Lee, B.; Qiao, L.; Lu, M.; Yoo, H.S.; Cheung, W.; Mak, R.; Schaack, J.; Feng, G.S.; Chi, N.W.; Olefsky, J.M.; et al. C/EBPα regulates macrophage activation and systemic metabolism. Am. J. Physiol. Endocrinol. Metab. 2014, 306, E1144–E1154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, E.Y.; Kim, Y.S.; Seo, J.-Y.; Park, I.; Ahn, H.K.; Jeong, Y.M.; Kim, J.H.; Kim, N. The Relationship between Sarcopenia and Systemic Inflammatory Response for Cancer Cachexia in Small Cell Lung Cancer. PLoS ONE 2016, 11, e0161125. [Google Scholar] [CrossRef] [PubMed]
- Narasimhan, A.; Shahda, S.; Kays, J.K.; Perkins, S.M.; Cheng, L.; Schloss, K.N.H.; Schloss, D.E.I.; Koniaris, L.G.; Zimmers, T.A. Identification of Potential Serum Protein Biomarkers and Pathways for Pancreatic Cancer Cachexia Using an Aptamer-Based Discovery Platform. Cancers 2020, 12, 3787. [Google Scholar] [CrossRef]
- Leung, K.S.; Li, C.Y.; Tse, Y.K.; Choy, T.K.; Leung, P.C.; Hung, V.W.; Chan, S.Y.; Leung, A.H.; Cheung, W.H. Effects of 18-month low-magnitude high-frequency vibration on fall rate and fracture risks in 710 community elderly—A cluster-randomized controlled trial. Osteoporos Int. 2014, 25, 1785–1795. [Google Scholar] [CrossRef]
- Guo, A.Y.; Leung, K.S.; Qin, J.H.; Chow, S.K.; Cheung, W.H. Effect of Low-Magnitude, High-Frequency Vibration Treatment on Retardation of Sarcopenia: Senescence-Accelerated Mouse-P8 Model. Rejuvenation Res. 2016, 19, 293–302. [Google Scholar] [CrossRef]
- Wang, J.; Cui, C.; Chim, Y.N.; Yao, H.; Shi, L.; Xu, J.; Wang, J.; Wong, R.M.Y.; Leung, K.-S.; Chow, S.K.-H.; et al. Vibration and β-hydroxy-β-methylbutyrate treatment suppresses intramuscular fat infiltration and adipogenic differentiation in sarcopenic mice. J. Cachexia Sarcopenia Muscle 2020, 11, 556–577. [Google Scholar] [CrossRef] [Green Version]
- Barbagallo, M.; Belvedere, M.; Dominguez, L.J. Magnesium homeostasis and aging. Magnes. Res. 2009, 22, 235–246. [Google Scholar] [CrossRef] [Green Version]
- Welch, A.A.; Kelaiditi, E.; Jennings, A.; Steves, C.J.; Spector, T.D.; MacGregor, A. Dietary Magnesium Is Positively Associated With Skeletal Muscle Power and Indices of Muscle Mass and May Attenuate the Association Between Circulating C-Reactive Protein and Muscle Mass in Women. J. Bone Miner. Res. 2016, 31, 317–325. [Google Scholar] [CrossRef] [Green Version]
- Moslehi, N.; Vafa, M.; Sarrafzadeh, J.; Rahimi-Foroushani, A. Does magnesium supplementation improve body composition and muscle strength in middle-aged overweight women? A double-blind, placebo-controlled, randomized clinical trial. Biol. Trace Elem. Res. 2013, 153, 111–118. [Google Scholar]
- Zhang, N.; Chim, Y.N.; Wang, J.; Wong, R.M.Y.; Chow, S.K.H.; Cheung, W.H. Impaired Fracture Healing in Sarco-Osteoporotic Mice Can Be Rescued by Vibration Treatment Through Myostatin Suppression. J. Orthop. Res. 2020, 38, 277–287. [Google Scholar] [CrossRef]
- Chen, L.K.; Woo, J.; Assantachai, P.; Auyeung, T.W.; Chou, M.Y.; Iijima, K.; Jang, H.C.; Kang, L.; Kim, M.; Kim, S.; et al. Asian Working Group for Sarcopenia: 2019 Consensus Update on Sarcopenia Diagnosis and Treatment. J. Am. Med. Dir. Assoc. 2020, 21, 300–307.e2. [Google Scholar] [CrossRef] [PubMed]
- Yamada, M.; Arai, H.; Yoshimura, K.; Kajiwara, Y.; Sonoda, T.; Nishiguchi, S.; Aoyama, T. Nutritional supplementation during resistance training improved skeletal muscle mass in community-dwelling frail older adults. J. Frailty Aging 2012, 1, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Aguiar, A.F.; Vechetti-Júnior, I.J.; Alves de Souza, R.W.; Castan, E.P.; Milanezi-Aguiar, R.C.; Padovani, C.R.; Carvalho, R.F.; Silva, M.D. Myogenin, MyoD and IGF-I regulate muscle mass but not fiber-type conversion during resistance training in rats. Int. J. Sports Med. 2013, 34, 293–301. [Google Scholar] [CrossRef] [PubMed]
- Zanou, N.; Gailly, P. Skeletal muscle hypertrophy and regeneration: Interplay between the myogenic regulatory factors (MRFs) and insulin-like growth factors (IGFs) pathways. Cell. Mol. Life Sci. 2013, 70, 4117–4130. [Google Scholar] [CrossRef] [PubMed]
- Latroche, C.; Weiss-Gayet, M.; Muller, L.; Gitiaux, C.; Leblanc, P.; Liot, S.; Ben-Larbi, S.; Abou-Khalil, R.; Verger, N.; Bardot, P.; et al. Coupling between Myogenesis and Angiogenesis during Skeletal Muscle Regeneration Is Stimulated by Restorative Macrophages. Stem. Cell Rep. 2017, 9, 2018–2033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, C.Y.; Ferrucci, L. Macrophages in skeletal muscle aging. Aging 2020, 12, 3–4. [Google Scholar] [CrossRef]
- Bodine, S.C.; Stitt, T.N.; Gonzalez, M.; Kline, W.O.; Stover, G.L.; Bauerlein, R.; Zlotchenko, E.; Scrimgeour, A.; Lawrence, J.C.; Glass, D.J. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat. Cell Biol. 2001, 3, 1014–1019. [Google Scholar] [CrossRef]
- Jagoe, R.T.; Goldberg, A.L. What do we really know about the ubiquitin-proteasome pathway in muscle atrophy? Curr. Opin. Clin. Nutr. Metab. Care 2001, 4, 183–190. [Google Scholar] [CrossRef]
- Lecker, S.H.; Jagoe, R.T.; Gilbert, A.; Gomes, M.; Baracos, V.; Bailey, J.; Price, S.R.; Mitch, W.E.; Goldberg, A.L. Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J. 2004, 18, 39–51. [Google Scholar] [CrossRef] [Green Version]
- Willett, M.; Cowan, J.L.; Vlasak, M.; Coldwell, M.J.; Morley, S.J. Inhibition of mammalian target of rapamycin (mTOR) signalling in C2C12 myoblasts prevents myogenic differentiation without affecting the hyperphosphorylation of 4E-BP1. Cell. Signal. 2009, 21, 1504–1512. [Google Scholar] [CrossRef]
- Pallafacchina, G.; Calabria, E.; Serrano, A.L.; Kalhovde, J.M.; Schiaffino, S. A protein kinase B-dependent and rapamycin-sensitive pathway controls skeletal muscle growth but not fiber type specification. Proc. Natl. Acad. Sci. USA 2002, 99, 9213–9218. [Google Scholar] [CrossRef] [PubMed]
- Villa-Bellosta, R. Dietary magnesium supplementation improves lifespan in a mouse model of progeria. EMBO Mol. Med. 2020, 12, e12423. [Google Scholar] [CrossRef] [PubMed]
- Guo, A.Y.; Leung, K.S.; Siu, P.M.; Qin, J.H.; Chow, S.K.; Qin, L.; Li, C.Y.; Cheung, W.H. Muscle mass, structural and functional investigations of senescence-accelerated mouse P8 (SAMP8). Exp. Anim. 2015, 64, 425–433. [Google Scholar] [PubMed] [Green Version]
- Zhang, N.; Chow, S.K.H.; Leung, K.S.; Lee, H.H.; Cheung, W.H. An animal model of co-existing sarcopenia and osteoporotic fracture in senescence accelerated mouse prone 8 (SAMP8). Exp. Gerontol. 2017, 97, 1–8. [Google Scholar] [CrossRef]
- Ravn, H.B.; Korsholm, T.L.; Falk, E. Oral magnesium supplementation induces favorable antiatherogenic changes in ApoE-deficient mice. Arterioscler. Thromb. Vasc. Biol. 2001, 21, 858–862. [Google Scholar] [CrossRef] [Green Version]
- Zheng, L.; Huang, L.; Chen, Z.; Cui, C.; Zhang, R.; Qin, L. Magnesium supplementation alleviates corticosteroid-associated muscle atrophy in rats. Eur. J. Nutr. 2021, 60, 4379–4392. [Google Scholar] [CrossRef]
- Zhang, L.W.; Warrington, J.P. Magnesium Sulfate Prevents Placental Ischemia-Induced Increases in Brain Water Content and Cerebrospinal Fluid Cytokines in Pregnant Rats. Front. Neurosci. 2016, 10, 561. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.T.; Yin, Y.; Yang, Y.J.; Lv, P.J.; Shi, Y.; Lu, L.; Wei, L.B. Resveratrol prevents TNF-alpha-induced muscle atrophy via regulation of Akt/mTOR/FoxO1 signaling in C2C12 myotubes. Int. Immunopharmacol. 2014, 19, 206–213. [Google Scholar] [CrossRef]
- Magee, P.; Pearson, S.; Allen, J. The omega-3 fatty acid, eicosapentaenoic acid (EPA), prevents the damaging effects of tumour necrosis factor (TNF)-alpha during murine skeletal muscle cell differentiation. Lipids Health Dis. 2008, 7, 24. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.H.; Tachibana, H.; Morinaga, Y.; Fujimura, Y.; Yamada, K. Modulation of proliferation and differentiation of C2C12 skeletal muscle cells by fatty acids. Life Sci. 2009, 84, 415–420. [Google Scholar] [CrossRef]
Gene | Sequence (5′to 3′) |
---|---|
MyoD | Forward: CCACTCCGGGACATAGACTTG Reverse: AAAAGCGCAGGTCTGGTGAG |
MyoG | Forward: GAGACATCCCCCTATTTCTACCA Reverse: GCTCAGTCCGCTCATAGCC |
Myf5 | Forward: CACCACCAACCCTAACCAGAG Reverse: AGGCTGTAATAGTTCTCCACCTG |
Myf6 | Forward: AGAGGGCTCTCCTTTGTATCC Reverse: CTGCTTTCCGACGATCTGTGG |
MAFbx | Forward: CAGCTTCGTGAGCGACCTC Reverse: GGCAGTCGAGAAGTCCAGTC |
MuRF1 | Forward: CCAGGCTGCGAATCCCTAC Reverse: ATTTTCTCGTCTTCGTGTTCCTT |
FOXO3 | Forward: CTGGGGGAACCTGTCCTATG Reverse: TCATTCTGAACGCGCATGAAG |
IGF-1 | Forward: GCTCTTCAGTTCGTGTGTG Reverse: CCTCAGATCACAGCTCCGGAAG |
GAPDH | Forward: AACGACCCCTTCATTGAC Reverse: TCCACGACATACTCAGCAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, C.; Bao, Z.; Chow, S.K.-H.; Wong, R.M.Y.; Welch, A.; Qin, L.; Cheung, W.H. Coapplication of Magnesium Supplementation and Vibration Modulate Macrophage Polarization to Attenuate Sarcopenic Muscle Atrophy through PI3K/Akt/mTOR Signaling Pathway. Int. J. Mol. Sci. 2022, 23, 12944. https://doi.org/10.3390/ijms232112944
Cui C, Bao Z, Chow SK-H, Wong RMY, Welch A, Qin L, Cheung WH. Coapplication of Magnesium Supplementation and Vibration Modulate Macrophage Polarization to Attenuate Sarcopenic Muscle Atrophy through PI3K/Akt/mTOR Signaling Pathway. International Journal of Molecular Sciences. 2022; 23(21):12944. https://doi.org/10.3390/ijms232112944
Chicago/Turabian StyleCui, Can, Zhengyuan Bao, Simon Kwoon-Ho Chow, Ronald Man Yeung Wong, Ailsa Welch, Ling Qin, and Wing Hoi Cheung. 2022. "Coapplication of Magnesium Supplementation and Vibration Modulate Macrophage Polarization to Attenuate Sarcopenic Muscle Atrophy through PI3K/Akt/mTOR Signaling Pathway" International Journal of Molecular Sciences 23, no. 21: 12944. https://doi.org/10.3390/ijms232112944
APA StyleCui, C., Bao, Z., Chow, S. K.-H., Wong, R. M. Y., Welch, A., Qin, L., & Cheung, W. H. (2022). Coapplication of Magnesium Supplementation and Vibration Modulate Macrophage Polarization to Attenuate Sarcopenic Muscle Atrophy through PI3K/Akt/mTOR Signaling Pathway. International Journal of Molecular Sciences, 23(21), 12944. https://doi.org/10.3390/ijms232112944