Next Article in Journal
Metabolomic Differences between the Skin and Blood Sera of Atopic Dermatitis and Psoriasis
Next Article in Special Issue
Reversal of Peripheral Neuropathic Pain by the Small-Molecule Natural Product Narirutin via Block of Nav1.7 Voltage-Gated Sodium Channel
Previous Article in Journal
Interleukin-22 Exerts Detrimental Effects on Salivary Gland Integrity and Function
Previous Article in Special Issue
Genetic Variant in Nicotinic Receptor α4-Subunit Causes Sleep-Related Hyperkinetic Epilepsy via Increased Channel Opening
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 23
Issue 21
10.3390/ijms232112999
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The α2δ Calcium Channel Subunit Accessorily and Independently Affects the Biological Function of Ditylenchus destructor

by
Xueling Chen
,
Mingwei An
,
Shan Ye
,
Zhuhong Yang
* and
Zhong Ding
*
College of Plant Protection, Hunan Agricultural University, Changsha 410128, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(21), 12999; https://doi.org/10.3390/ijms232112999
Submission received: 20 September 2022 / Revised: 23 October 2022 / Accepted: 24 October 2022 / Published: 27 October 2022
(This article belongs to the Special Issue Recent Advances in Ion Channels and Ion Channelopathies)
Browse Figures
Review Reports Versions Notes

Abstract

:
The α2δ subunit is a high-voltage activated (HVA) calcium channel (Cav1 and Cav2) auxiliary subunit that increases the density and function of HVA calcium channels in the plasma membrane of mammals. However, its function in plant parasitic nematodes remains unknown. In this study, we cloned the full-length cDNA sequence of the voltage-gated calcium channel (VGCC) α2δ subunit (named DdCavα2δ) in Ditylenchus destructor. We found that DdCavα2δ tends to be expressed in the egg stage, followed by the J3 stage. RNA-DIG in situ hybridization experiments showed that the DdCavα2δ subunit was expressed in the body wall, esophageal gland, uterus, post uterine, and spicules of D. destructor. The in vitro application of RNA interference (RNAi) affected the motility, reproduction, chemotaxis, stylet thrusting, and protein secretion of D. destructor to different degrees by targeting DdCα1D, DdCα1A, and DdCavα2δ in J3 stages, respectively. Based on the results of RNAi experiments, it was hypothesized that L-type VGCC may affect the motility, chemotaxis, and stylet thrusting of D. destructor. Non-L-type VGCC may affect the protein secretion and reproduction of D. destructor. The DdCavα2δ subunit gene also affected the motility, chemotaxis, and reproduction of D. destructor. These findings reveal the independent function of the VGCC α2δ subunit in D. destructor as well as give a theoretical foundation for future research on plant parasitic nematode VGCC.

1. Introduction

Intracellular Ca2+ influx is primarily mediated by voltage-gated calcium channels (VGCC), which are widely distributed in biological cell membranes. Based on electrophysiological and pharmacological characteristics, VGCCs are classified as L-type, non-L-type, or T-type calcium channels [1]. Based on their activation properties, they are divided into high-voltage activated (HVA) calcium channels and low-voltage activated (LVA) calcium channels, with the HVA calcium channel being divided into L-type (CaV1) and non-L-type (CaV2) channels, whereas the LVA calcium channel only has T-type channels (CaV3) [2]. In mammals, calcium channels are found in a variety of cells, including neurons, neurosecretory cells, and muscle cells, and they play an important role in muscle contraction, hormone secretion, and neurotransmitter release. CaV1 and CaV2 channels are typically made up of a pore-forming α1 subunit and β, α2δ, and γ auxiliary subunits, whereas only an α1 subunit has been identified in CaV3 channels [3,4,5].
Although the major biophysical and pharmacological features of these channels are determined by the α1 subunit, their expression is also influenced by auxiliary subunits β and α2δ. The β subunit is one of the major auxiliary subunits of HVA calcium channels, and four of its genes (β1–β4) have been cloned. The GK domain of the β subunit binds to the α-interacting domain (AID), thereby exerting its role in regulating the surface expression and gating properties of high-voltage activated calcium channels [6,7,8]. α2δ is another major auxiliary subunit of the HVA calcium channel, which increases the density of these channels in the plasma membrane, thereby enhancing their function [9,10]. Four α2δ subunit genes in vertebrates have been cloned: CACNA2D1, CACNA2D2, CACNA2D3, and CACNA2D4 [9,11,12,13].
α2δ consists of two subunits, α2 and δ, and both subunits are encoded by a single gene and covalently linked by disulfide bonds. Two cysteine (Cys) residues, Cys404 (located in the Von Willebrand Factor A domain (VWA domain) of α2) and Cys1047 (located within the extracellular domain of δ) in α2δ-1, are involved in the formation of intermolecular disulfide bonds [14]. α2 is completely extracellular, but there is controversy about the transmembrane mode of δ. It was initially suggested that δ belongs to the type I transmembrane proteins, while an increasing number of findings suggest that δ may be a glycosylphosphatidylinositol (GPI)-anchored protein. Davies et al. [15] proposed that α2δ-1 is a GPI-anchored protein and suggested that GPI anchoring of the α2δ subunit is required for its enhanced calcium current. Similarly, both the α2δ-3 and α2δ-4 genes were shown to be GPI-anchored proteins in mice, with the predicted GPI-anchoring motifs being CGG or GAS [16,17]. There is no doubt that all α2δ contain the VWA and Cache domains. The VWA domain contains ~200 amino acids and represents a dinucleotide binding fold with a metal ion-dependent adhesion site (MIDAS) motif, which participates in divalent cation-dependent interactions, and VWA structural domains are involved in protein–protein interactions through the MIDAS motif [18].
The MIDAS motif of α2δ-1 and α2δ-2 is “perfect”, and its key component is a five-residue motif with three ligand residues (D × S × S) near the N terminus of the VWA domain [19], which is also present in α2δ-3 and α2δ- 4 [20]. Downstream of the VWA structural domain, the α2δ subunit also has a bacterial chemosensory structural domain called the Cache domain [21]. The Cache domain of the α2δ subunit may be involved in the transport function of the α2δ subunit. α2δ-1 and α2δ-2 are target sites for gabapentin-like drugs [22], and it has been hypothesized that the Cache domain is associated with the binding of gabapentin drugs and with the binding of the putative endogenous ligand [23,24]. UNC-36 and TAG-180 are the α2δ subunits of VGCC from Caenorhabditis elegans [25]. UNC-36 has been shown to affect the voltage dependence, kinetics, and conductance of voltage-dependent calcium currents and to play a key role in striated muscle, whereas TAG-180 does not [26]. UNC-36 also plays a central role in the excitability and the functional activity of C. elegans mechanosensory neurons [27].
The sweet potato rot nematode, Ditylenchus destructor, is a migratory endoparasitic nematode from clade 12 based on a small subunit ribosomal DNA (SSU rDNA) sequence tree [28]. Moreover, D. destructor is a polyphagous worm with a wide host range that can live on fungi and plants. It can harm a range of plants, including peanuts, carrots, and Codonopsis pilosula, in addition to its two primary hosts of sweet potato and potato [29,30,31]. Furthermore, D. destructor may eat a variety of fungi [32]. Ditylenchus destructor became a quarantine focus in various nations due to the massive agricultural losses it has caused.
VGCC have been well studied in mammals, but few studies have been conducted in plant parasitic nematodes. We previously identified the L-type (DdCα1D), non-L-type (DdCα1A), and T-type (DdCa1G) VGCC α1 subunit genes in D. destructor and showed that DdCα1D is expressed in the body wall muscles of D. destructor and affects its motility, whereas DdCα1A is expressed in the esophageal glands, vulva, and vas deferens of D. destructor and affects its reproduction [33]. Here, we successfully cloned the gene for the VGCC α2δ subunit from D. destructor (DdCavα2δ), determined its position using in situ hybridization, and characterized its biological properties and functions using RNA interference techniques. We demonstrated that silencing the DdCα1D gene affects the motility, chemotaxis, and stylet thrusting of D. destructor, and silencing the DdCα1A gene affects D. destructor’s protein secretion and reproduction. Moreover, we showed that the auxiliary subunit DdCavα2δ gene contributes to these biological functions of the VGCC α1 subunit.
Consequently, the silencing of the DdCavα2δ subunit gene alone also affected the motility, chemotaxis, and reproduction coefficient of D. destructor.

2. Results

2.1. Cloning and Characterization of DdCavα2δ

RT-PCR was conducted using specific primers (Table 1), and PCR products were sequenced to confirm the amplification of the full-length cDNA sequence from D. destructor. DdCavα2δ included a 3825 bp open reading frame (ORF), identified with the NCBI ORF finder, that encoded 1275 amino acids (GenBank accession number MW267435) with a molecular mass of 147 kDa and a pI of 6.67. DdCavα2δ began with an ATG initiation codon following the 312-bp upstream 5′ untranslated region (UTR) and ended with a TGA stop codon upstream of the 635-bp 3′ UTR (Figure 1). SL1 is a guide and a widely conserved sequence present at the 5’ end of the mRNA of most nematodes [34], and the presence of 5′ trans-spliced leader sequences in the nematode phylum allows the use of an SL1-PCR strategy to clone full-length cDNAs from very small amounts of RNA [35]. In our study, the sequence obtained by SL1-PCR and 3′RACE has a start codon (ATG) upstream of the coding framework, a stop code (TGA) downstream, and a polyA tail at its 3′ end. Therefore, we indicated that this is the complete cDNA sequence.
There are 22 cysteine (Cys) residues in the DdCavα2δ amino acid sequence and nine predicted N-glycosylation sites (Figure 2). These cysteine residues may be associated with the formation of disulfide bonds. The amino acid sequence of DdCavα2δ was compared with the unc-36 sequence from C. elegans and four α2δ sequences from humans. BLAST Protein analysis with the encoded amino acid sequences showed that DdCavα2δ has features in common with other VGCC α2δ subunits, including two typical regions: the VWA domain and the Cache domain (Figure 3). Moreover, according to Qin et al., we also predicted the breaking point between α2 and δ subunits in the DdCavα2δ sequence (Figure 3) [12]. VWA domains are usually about 200 residues long, and there is a MIDAS motif in each VWA domain. We found that the VWA domains here all contained a “perfect” MIDAS motif, in which all five discontinuous and co-coordinating amino acids were present (DxSxS, A/T, D) [18]. The amino acid position of the VWA domain of the DdCavα2δ sequence was present at 270–487 amino acids (Figure 1), and this domain was highly conserved when compared with the unc-36 domain, with a similarity of 81.3%. The Cache domains of DdCavα2δ, unc-36, and tag-180 were all downstream of the VWA domains. The amino acid positions of the Cache domains in the DdCavα2δ sequence was 519–602 amino acids. The MIDAS motif in the DdCavα2δ sequence was highly conserved in comparison to the unc-36 sequence. These sequences all contained five co-coordinating amino acids, including D, S, S, A, and D.

2.2. Phylogenetic Analysis of DdCavα2δ

The phylogenetic analysis was based on the deduced amino acid sequences of the α2δ subunits of D. destructor and the corresponding subunits of C. elegans and other species. The amino acid sequences were obtained from the NCBI (https://www.ncbi.nlm.nih.gov/, accessed on 15 October 2022) and WormBase (https://parasite.wormbase.org/index.html, accessed on 15 October 2022) databases (Table 2). The phylogenetic tree shows the branches composed of vertebrate and invertebrate subunits. Particularly, the α2δ of D. destructor and the corresponding subunits of C. elegans were clustered in invertebrates, forming a different branch from vertebrates, and they were closely related to the evolutionary position of C. elegans (Figure 4). This implies that DdCavα2δ may have the same evolutionary relationship and a similar physiological function as the unc-36 gene of C. elegans.

2.3. Developmental Expression Analysis of DdCavα2δ

The expression level of DdCavα2δ was assessed by RT-qPCR at different developmental stages (including egg, J2, J3, and J4). DdCavα2δ was widely expressed at all developmental stages (Figure 5). Results indicated that DdCavα2δ plays an important role in all stages of D. destructor development. In particular, the expression of DdCavα2δ was significantly higher in the egg stage than in other developmental stages. In addition, the mRNA expression level of DdCavα2δ in the J3 and J4 were 3.4 and 2.7 times higher than in the J2 stage, respectively.

2.4. Tissue Localization of DdCavα2δ

In situ hybridization was used to detect the site of DdCavα2δ gene expression in the adult stages of D. destructor at the mRNA level (Figure 6). The antisense-probe treated nematodes showed positive staining in the esophageal glands (Figure 6E), body wall (Figure 6F), uterus and post uterine area of females (Figure 6G), and the spicules of males (Figure 6H), whereas the sense-probe treated nematodes showed no hybridization signal (Figure 6A–D).

2.5. Silencing Efficiency of dsRNA Soaking

Following 24 h of dsRNA treatment, FITC was taken up by D. destructor. The expression levels of DdCα1D, DdCα1A, and DdCavα2δ mRNA in D. destructor were measured by qPCR. When dsCavα2δ was fed, the transcript level of DdCavα2δ was significantly reduced to 31.4%, whereas the transcript levels of DdCα1D and DdCα1A were unchanged relative to the control (Figure 7A). When dsCα1D was fed, the transcript level of DdCα1D was significantly reduced to 67.8%, but the transcript levels of DdCα1A and DdCavα2δ were unchanged (Figure 7B). When dsCavα2δ and dsCα1D were fed simultaneously, the transcript levels of DdCavα2δ and DdCα1D decreased to 45.7% and 67.4%, respectively, whereas the transcript level of DdCα1A was unchanged (Figure 7D). When dsCα1A was fed, the transcript level of DdCα1A decreased to 44.7%, whereas there was no change in the transcript levels of DdCα1D and DdCavα2δ (Figure 7C). When dsCavα2δ and dsCα1A were fed simultaneously, the transcript levels of DdCavα2δ and DdCα1A were decreased to 41.2% and 33.3%, respectively, and the transcript level DdCα1D was unchanged (Figure 7E).
The above results showed that, when the dsRNA for each gene was fed, this led to a significant specific partial knock down of the target gene, indicating that our RNAi approach works. Furthermore, silencing of the DdCavα2δ subunit gene did not lead to the downregulation of the transcript levels of the DdCα1D and DdCα1A subunit genes. Silencing of the DdCα1D or DdCα1A subunits also did not lead to the downregulation of the DdCavα2δ subunit gene at the transcript level, indicating that the expression of DdCavα2δ does not affect the transcription of the DdCα1D and DdCα1A subunits. Thus, it is presumed that the α2δ and HVA α1 subunits do not appear to influence each other’s mRNA expression levels.

2.6. Phenotypic Analysis of DdCα1D, DdCα1A, and DdCavα2δ Genes after Knockout

2.6.1. Motility Assay

Results of the motility assay are shown in Figure 8. After washing dsRNA for 6 h, when dsGFP was fed, its passage rate was 33.7%. The sand column passage rates of other target dsRNA genes were significantly downregulated compared with dsGFP treatment. When dsCavα2δ was fed, its passage rate was 25.3%. When dsCa1D was fed, its passage rate was 23.7%. When dsCavα2δ and dsCα1D were fed simultaneously, the passage rate was 19.7%. When dsCa1A was fed, its passage rate (28.3%) was higher than that of dsCa1D. When dsCavα2δ and dsCα1A were fed simultaneously, the passage rate (25.7%) was higher than that of dsCavα2δ + dsCα1D. After washing dsRNA for 24 h, the sand column passage rate of D. destructor in all treatments increased significantly, but there were still significant differences compared to that observed in the dsGFP treatment.
The passage rate of dsGFP treatment was 54.3%. When dsCavα2δ was fed, the passage rate of D. destructor was 44.7%, and the passage rate was 42.0% when dsCa1D was fed. In addition, the nematode passage rate was 41.0% when dsCavα2δ and dsCa1D were fed simultaneously. The passage rate was 46.7% for the nematodes fed dsCa1A and 48% for nematodes fed both dsCavα2δ and dsCα1A. The above results indicated that the effect of RNA interference diminished the motility of nematodes, and this decrease in motility recovered with time. Additionally, results indicate that both L-type and non-L-type VGCC affect the motility of D. destructor, and the Cavα2δ subunit affects D. destructor locomotion. The Cavα2δ subunit might play an auxiliary role in the locomotion of D. destructor that is mediated by L-type and non-L-type VGCCs.

2.6.2. Chemotaxis Assay

In order to detect changes in D. destructor chemotaxis to sweet potato after silencing the DdCavα2δ subunit gene, the number of nematodes attracted to sweet potato blocks placed on 1% agar for 36 h was counted separately. The results are shown in Figure 9A. The attraction rate of the dsGFP treatment was 22.5%. Compared with the dsGFP treatment, the nematode attraction rates of the other target gene dsRNA treatments were decreased to various degrees. When dsCa1D was fed, the attraction rate of D. destructor was 7.3%. When dsCavα2δ was fed, the attraction rate was 12.0%. When dsCavα2δ and dsCa1D were fed simultaneously, the attraction rate was only 5.7%. The attraction rate was 12.7% when dsCa1A was fed and 9.0% for nematodes fed both dsCavα2δ and dsCα1A. The co-silencing of DdCα1D or DdCα1A and DdCavα2δ subunit genes also affected nematode chemotaxis, with the effect of dsCavα2δ + dsCα1D treatment being greater. This indicates that both L-type and non-L-type VGCC affect the chemotaxis of D. destructor, and the Cavα2δ subunit has an important auxiliary role in L-type and non-L-type VGCC-mediated nematode chemotaxis. The Cavα2δ subunit also had an effect on the chemotaxis of D. destructor.

2.6.3. Stylet Thrusting Assay

To assess the effect of HVA α1 and α2δ subunits on nematode stylet thrusting, nematodes were stimulated with serotonin, and the numb of stylets thrusting was counted over a one-minute period. It is evident from Figure 9B that the number of stylets thrusting following dsGFP treatment was 51.7 times/min. The number of stylets thrusting in dsCavα2δ, dsCa1A, and dsCavα2δ + dsCα1A treatments were not significantly different from that of dsGFP treatment: dsCavα2δ treatment nematodes had 49.7 stylets thrusting in one minute, dsCa1A treatment nematodes had 42.0 stylets thrusting, and dsCavα2δ + dsCα1A treatment nematodes had 41.0 stylets thrusting. The dsCa1D and dsCavα2δ + dsCα1D treatment nematodes showed significant differences in the number of stylets thrusting compared to that observed in the dsGFP treatment. The number of nematode stylets thrusting was 33.0 times/min in the dsCa1D treatment, and 27.3 times/min in the dsCavα2δ + dsCα1D treatment. These results indicate that the silencing of the DdCα1D subunit gene alone affects the stylets thrusting of D. destructor, and the co-silencing of the DdCα1D and DdCavα2δ subunit genes increases the effect of L-type VGCCs on the function of stylets thrusting. However, the difference between dsCα1D and dsCavα2δ + dsCα1D treatments was not significant. This indicates that L-type VGCCs affect the stylet thrusting function of the potato decay stem nematode, and non-L-type VGCCs have no effect on the stylet thrusting function of the potato decay stem nematode. Consequently, the auxiliary subunit Cavα2δ has an important auxiliary effect on L-type VGCC-mediated stylet thrusting in D. destructor, but non-L-type VGCCs have no direct effect on the stylet thrusting function of D. destructor.

2.6.4. Protein Secretion Assay

Secreted proteins from nematodes were detected after 16 h of 0.1% resorcinol treatment. As shown in Figure 9C, the nematode secretory protein content in the dsGFP treatment was 20,222.22 μg/mL. When dsCavα2δ and dsCα1D were fed, respectively, the protein content of D. destructor was not significantly different compared to that of the dsGFP treatment, which were 20,042.22 μg/mL and 20,004.44 μg/mL, respectively. Similarly, the protein content of D. destructor was 20.102 mg/mL and was not significantly different compared to that in the dsGFP treatment when dsCavα2δ and dsCα1D were fed simultaneously. However, the protein content was significantly downregulated when dsCα1A or dsCavα2δ + dsCα1A were fed, resulting in a protein secretion content of 19,740.00 μg/mL and 19,664.44 μg/mL, respectively. These results indicate that silencing the DdCα1A subunit gene alone affects protein secretion in potato rot stem nematodes and that co-silencing the DdCα1A and DdCavα2δ subunits increases the effect of non-L-type VGCCs on the protein secretion function of D. destructor. This indicates that L-type VGCCs have no effect on protein secretion function, but non-L-type VGCCs affect the protein secretion function of D. destructor. The Cavα2δ auxiliary subunit has an important auxiliary effect on nematode protein secretion mediated by non-L-type VGCCs, but it has no effect on the protein secretion function of D. destructor.

2.6.5. Reproduction Assay

The reproduction rate was significantly reduced 25 d after DdCα1D, DdCα1A, and DdCavα2δ were silenced. As shown in Figure 9D, the reproduction coefficient of D. destructor was 62.3 in the dsGFP treatment. The reproduction coefficients were significantly reduced 25 d after DdCα1D, DdCα1A, and DdCavα2δ were silenced. The reproduction coefficient was 35.2 for the dsCavα2δ treatment, 32.4 for the dsCa1D treatment, and 31.5 for the dsCavα2δ + dsCα1D treatment. When dsCa1A was fed, the reproduction coefficient was 22.2, and the reproduction coefficient was 17.2 when dsCavα2δ and dsCα1A were both fed. The above results indicate that the silencing of DdCα1D, DdCα1A, and DdCavα2δ subunit genes, respectively, all affected the reproduction coefficient of potato rot stem nematodes, and the silencing of the DdCα1A subunit gene had the greatest effect on the reproduction coefficient of nematodes. Co-silencing DdCα1D or DdCα1A with DdCavα2δ subunit genes further reduced the reproduction coefficient of D. destructor, which was even lower in the dsCavα2δ + dsCα1A treatment. These data indicate that both L-type and non-L-type VGCCs affect the reproduction of D. destructor, and the Cavα2δ auxiliary subunit has an important auxiliary role in non-L-type VGCC-mediated nematode reproduction. The Cavα2δ subunit also has an effect on the reproduction of nematodes. Among the Cavα2δ subunits, non-L type VGCCs had the greatest effect on the reproduction of D. destructor.

3. Discussion

In mammals and insects, voltage-gated sodium channels (VGSCs) play an important role in maintaining cellular excitability and normal physiological functions, making them important targets for a variety of neurotoxins [36]. However, VGSCs have not been found in nematodes [37], whose neuronal activity is thought to be related to VGCCs. VGCCs regulate a number of physiological functions, including neuronal excitability, transmitter release, and muscle contraction and are mainly composed of several subunits, such as α1, β, α2δ with γ [38]. In our study, we cloned and characterized a VGCC α2δ subunit from D. destructor, named DdCavα2δ. α2δ is a highly glycosylated extracellular protein containing a VWA domain that is normally found in extracellular matrix proteins and integrin receptors [39]. Therefore, it is highly likely that the interaction between α2δ and α1 occurs extracellularly. The amino acid sequence deduced from the DdCavα2δ cDNA sequence has a VWA domain and a MIDAS motif, and the domain and motif are also present in the unc-36 gene of C. elegans [19]. Thus, we tentatively defined DdCavα2δ as the VGCC auxiliary subunit of D. destructor. The analysis of the protein amino acid sequence also revealed that there was no GPI anchor site, “CGG” or “GAS”, as found in mammals, but a similar “GCS” sequence was found at the 903–905 amino acid position (underlined part of Figure 2). Therefore, further validation of the DdCavα2δ structure that spans the membrane remains to be conducted.
Four α2δ subunits (α2δ-1, α2δ-2, α2δ-3, and α2δ-4) have been identified in mammals, and Dolphin et al. showed that they are expressed in skeletal muscle, neurons, the brain, and the testis [9,20]. Two VGCC α2δ subunits (UNC-36 and TAG-180) were identified in C. elegans [25]. It was found that UNC-36 was expressed in the body wall, vulva, and pharynx muscles of C. elegans [27]. In a further study, UNC-36 was also shown to be expressed in muscle and motor neurons and co-regulated with EGL-19 (L-type α1) in C. elegans body muscles [26,27]. Ye et al. cloned three VGCC α1 subunit genes in D. destructor, DdCα1D, DdCα1A, and DdCa1G, and found that they play a role in modulating locomotion, feeding, and reproduction, respectively [33]. Recently, we identified the DdCavβ subunit of D. destructor and showed that it has a complementary role in the biological functions of the DdCα1D and DdCα1A subunits [40].
In the present study, DdCavα2δ was found to be expressed in the esophageal glands, body wall, uterus, and post uterine tissue of D. destructor, along with the spicules. This is highly consistent with studies on α2δ subunits in mammals and in C. elegans. Furthermore, we also showed that silencing the DdCα1D, DdCα1A, and DdCavα2δ subunit genes, respectively, significantly reduced the nematode passage rate in sand columns and the attraction rate of D. destructor, with lower passage and attraction rates when the DdCα1D subunit gene was silenced alone. In addition, the passage and attraction rates were lowest when DdCavα2δ was co-silenced with the DdCα1D subunit, but the rates were not significantly different from those observed with DdCα1D subunit gene silencing alone. The results showed that silencing of the DdCα1D subunit gene affected the stylet thrusting of D. destructor, and the co-silencing of the DdCα1D and DdCavα2δ subunit genes increased the effect of L-type VGCCs on the stylet thrusting of nematodes, but the difference was not significant.
By examining the protein content in the supernatant of D. destructor, we found that silencing the DdCα1A subunit gene reduced the nematode’s secretory protein content, and co-silencing of DdCavα2δ with the DdCα1A subunit gene increased the effect of non-L-type VGCCs on the nematode’s secretory protein function. Interestingly, we found some differences in secretory protein content when DdCavα2δ or DdCavβ were co-silenced with the DdCα1A subunit gene [40]. This may be due to the fact that the Cavβ and Cavα2δ auxiliary subunits have different affinities for the HVA Cavα1 subunit, thus causing a difference in the auxiliary effect on the α1 subunit. The binding of the Cavβ to Cavα1 subunits occurs at a high affinity action site [41], while the affinities between Cavα1 and Cavα2δ, however, appear rather weak [42]. We also found that the silencing of DdCα1D, DdCα1A, and DdCavα2δ subunit genes, respectively, all affected the reproduction coefficient of D. destructor, and the silencing of the DdCα1A subunit gene had the greatest effect on the reproduction coefficient. Co-silencing of DdCα1D or DdCα1A and DdCavα2δ subunit genes further reduced the reproduction coefficient, whereas the reproduction coefficient of dsCavα2δ + dsCα1A treated nematodes was even lower.
In this study, we found that DdCavα2δ was expressed in the uterus, post uterine tissue, and spicules. DdCα1A was also expressed in the vulva and vas deferens [33]. Therefore, we conclude that DdCα1A plays a key role in the reproduction of D. destructor along with DdCavα2δ. In the future, additional studies on the phenotypic effects of transgenic fungi on D. destructor should be conducted. This will provide a theoretical basis for control strategies against D. destructor.

4. Materials and Methods

4.1. Nematode

Ditylenchus destructor was isolated from infested sweet potatoes in Hebei, China, and was preserved in the storage roots of sweet potatoes. Sweet potatoes were washed with clean water, sterilized with 1% NaClO for 10 min, dried, and treated with UV light for 30 min. Approximately 1000 mixed stage D. destructor were inoculated into sweet potatoes by digging holes with a sterile hole punch, after which D. destructor were sealed in the sweet potato with paraffin. Inoculated sweet potatoes were incubated at 25 °C for 25–30 d in the dark, and nematodes in the mixed stage were collected using the modified Baermann method [43]. Nematode eggs were screened by density-gradient centrifugation with a 1500-mesh sieve [44]. Nematodes at different developmental stages were obtained at 1-week intervals.

4.2. Cloning of the DdCavα2δ Subunit

Total RNA was extracted from D. destructor using Trizol Reagent (Sangon Biotech Co., Ltd., Shanghai, China). RNA quality and concentration were determined with an ultra-micro spectrophotometer (Thermo, Shanghai, China), and RNA integrity was assessed using 1% gel electrophoresis. The first strand of cDNA was synthesized using the PrimeScript™Ⅲ First-Strand Synthesis System (Invitrogen, Carlsbad, USA) for RT-PCR. The DdCavα2δ gene putative sequence was obtained from the WormBase database (https://parasite.wormbase.org/index.html, accessed on 15 October 2022) by comparing WormBase database genes with the C. elegans unc-36 gene obtained from the National Center for Biotechnology Information (NCBI) database. First, to obtain the full length DdCavα2δ subunit coding region sequence, PCR was performed using gene-specific primers (D-F, D-R) (Table 1). PCR was conducted using a standard procedure in a 25-μL volume that included 2.5 μL 10 × Ex Taq Buffer (TaKaRa, Japan), 2 μL dNTP Mixture (TaKaRa), 1 μL cDNA template, 1 μL of each primer, 0.5 μL of EX Taq polymerase (TaKaRa), and 17 μL of ddH2O. PCR conditions included an initial denaturation step at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 4 min, and a final step for 7 min at 72 °C. PCR products were purified using an agarose gel recovery kit (Trans, Beijing, China). The purified fragments were cloned into pMD™ 19-T vectors (TaKaRa,) and transformed into E. coli DH5α competent cells (Tiangen, Beijing, China). Three positive clones were randomly selected for bidirectional sequencing through the commercial service of the Sangon Biotech Co., Ltd. To obtain the length of the DdCavα2δ subunit with its 5′-noncoding region sequence, PCR was performed using a spliced leader sequence, SL1, and a gene-specific primer (5′-R1, 5′-R2) (Table 1). Finally, the first strand of cDNA with the 3′-noncoding region was synthesized using the 3′ full RACE Core Set with PrimerScriptTMRTase (TaKaRa) with the primers listed in Table 1.

4.3. Gene Characterization and Phylogenetic Analysis

Three overlapping fragments were spliced using DNAMAN software (DNAMAN 9.1; Lynnon BioSoft, Canada) to generate the full-length cDNA for the DdCavα2δ subunit, and the amino acid sequence was deduced. The DdCavα2δ conserved structural domains were predicted by the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 15 October 2022) and were mapped using IBS 1.0. A phylogenetic tree of the DdCavα2δ subunit was constructed using the mega 6.0 neighbor joining method [45].

4.4. Stage-Specific Expression of DdCavα2δ

To analyze the expression of the DdCavα2δ subunit at each developmental stage in D. destructor, mRNA was extracted from approximately 1000 worms using the DynabeadsTM mRNA DIRECTTM Kit (Invitrogen). Additionally, cDNA was synthesized from mRNA using reverse transcription kits, according to the manufacturer’s instructions. Primers were designed (Table 1), and SYBR Green Real-time PCR was performed using the 18S rRNA as an internal reference. The qPCR data were analyzed using the CFX Manager software and the Bio-Rad 2−ΔΔCt method to calculate relative gene expression [46]. All experiments were repeated three times, and averages were calculated.

4.5. Tissue Localization of DdCavα2δ

In situ hybridization was performed following a previously published method with modifications [47]. Fragments used as probes were amplified from the full-length cDNA from D. destructor using HindIIIF and EcoRI R primers (Table 1). DIG-labeled forward and antisense probes were synthesized using the DIG RNA Labeling Kit (Roche, Basel, Germany). Approximately 10,000 mixed-stage D. destructor specimens were fixed in 4% Paraformaldehyde Fix Solution (Sangon Biotech Co., Ltd.) for 18 h at 4 °C, followed by fixation for 4 h at room temperature. Ditylenchus destructor were then cut into 2–5 segments and treated with 0.5 mg/mL proteinase K at room temperature for 1 h. Hybridization was performed at 50 °C for 22 h, and they were treated with an antibody solution at 37 °C for 2 h. Samples were treated with chromogenic solution (Sangon Biotech Co., Ltd.) overnight and then observed and photographed under a microscope (Motic, Xiamen, China).

4.6. dsRNA Synthesis and Soaking of D. destructor

Total RNA was extracted from D. destructor using the Trizol method, first strand cDNA was synthesized, and dsRNA was synthesized using gene-specific primers containing the T7 polymerase promoter sequence (Table 1) and a MEGAscriptTM RNAi Kit (Invitrogen). The quality and concentration of dsRNA were assessed using 1% agarose gel electrophoresis and a Thermo ultra-micro spectrophotometer, respectively. Based on the findings of P. E. Urwin, 1 mg/mL FITC solution was used as an indicator of dsRNA entry into D. destructor [48]. About 10,000 J3 worms were collected and immersed in a solution containing dsRNA and 3 mg/mL spermidine (Sigma, Shanghai, China), 50 mM octopamine (Sigma), and 5% gelatin. The worms were incubated in the solution with shaking at 120 rpm for 24 h at 25 °C in the dark. In addition, J3 worms that were incubated in green fluorescent protein (GFP) dsRNA served as the control. After 24 h of soaking in the solution, D. destructor specimens were washed three times with DEPC-water and immediately stored at −80 °C for later detection of gene expression or were collected into 1.5-mL centrifuge tubes for later detection of motility, chemotaxis, stylet thrusting, protein secretion, and reproduction coefficient.

4.7. Gene Expression Analysis after Gene Knockdown

To determine levels of DdCα1D, DdCα1A, and DdCavα2δ gene transcription following gene knockdown, approximately 1000 nematodes were collected after soaking in dsRNA for 24 h. mRNA was extracted, and cDNA was synthesized as described above. Specific qPCR primers were designed using NCBI, and 18S rRNA was used as the internal control for all qPCR assays (Table 1). The qPCR reaction solution was a 20-μL mixture that included 1 μL cDNA template, 10 μL SYBR Green Premix Pro Taq HS qPCR mix (Accurate Biology, Changsha, China), 1 μL of each primer (0.2 mM), and 7 μL ddH2O. Quantitative analysis was performed using the 2−ΔΔCT method, as described above.

4.8. Phenotypic Analysis after Gene Knockout

Post RNAi phenotype analysis was performed by assessing mobility, chemotaxis, stylet thrusting, protein secretion, and reproduction.
Ditylenchus destructor mobility after the knockdown of DdCα1D, DdCα1A and DdCavα2δ was assayed according to the procedure used by Kimber et al. [49]. One hundred treated J2s and control J2s were transferred into PVC tubes filled with moist sand, and the bottom of the PVC tubes were wrapped with 150-mesh nylon yarn. PVC tubes were transferred to a petri dish (50 mm) filled with 20 mL of ddH2O to cover the bottom of the sand column. Columns and petri dishes were kept in the dark at 25 °C. The number of worms passing through the sand column into the petri dish was counted at 6 h and 24 h, and the migration rating of the sand column was calculated. Migration rate (Mr) = Pp (passing population of nematodes)/100.
To determine whether chemotaxis was affected, we conducted experiments with 1-cm sweet potato blocks. Briefly, the blocks were placed on 1% agar in 90 mm petri dishes, 3 cm away from 200 J2s. Petri dishes were sealed with cling film and placed at 25 °C for 36 h. After incubation, the number of nematodes within 2 cm of the blocks was counted.
Worms were analyzed for stylet thrusting as previously reported by McClure et al., with slight modifications [50]. The concentrated suspension of aliquots (2 μL), containing approximately 50 J2 D. destructor specimens, was treated with 20 μL of 5 mM serotonin creatinine sulfate (Sigma) for 20 min, and 10 randomly selected J2s were observed for the frequency of stylet thrusting over a 1 min period. The number of twitches for each J2 in 60 s was calculated.
An assay using 0.1% resorcinol was developed to assess protein secretion in nematodes. Two thousand J2 nematodes from each treatment and control group were concentrated to 100 μL, an equal volume of 0.2% resorcinol was added, and specimens were incubated for 16 h at 25 °C. Lastly, the supernatant was aspirated, and the protein content was determined using a Modified BCA Protein Assay Kit (Sangon).
To assess whether the reproduction of nematodes treated with dsRNA was affected, 100 nematodes from each treatment group were inoculated into PDA medium filled with Botrytis cinerea. Then, 25 d after incubation at 25 °C, the total number of nematodes was counted, and the reproduction coefficient was calculated as the ratio of the final number of nematodes to the initial number of nematodes. Each assay experiment had three biological replicates and three technical replicates. Data were analyzed by one-way analysis of variance (ANOVA) in SPSS. Differences between treatments were tested using Duncan’s multiple range test (DMRT) with F test (DMRT) with p < 0.05 [51]. The significant difference letter marking method first ranked all the means from largest to smallest and then marked the largest mean with a; the average was compared with the following averages. If the difference was not significant (p > 0.05), the letter a was marked, and if the difference was significant (p < 0.05), the letter b was marked. If the mean was significantly (p < 0.05) less than the mean of the group marked by letter b, it was marked by letter c.

5. Conclusions

This study identified the VGCC α2δ subunit in D. destructor and analyzed its transcriptional levels at different developmental stages and its tissue localization. In this study, silencing of the HVA α1 and α2δ subunits in D. destructor was achieved simultaneously using multi-targeted dsRNA soaking. The function of DdCα1D, as well as DdCα1A, was further validated, and the auxiliary role of DdCavα2δ was demonstrated, enhancing our understanding of VGCCs in plant parasitic nematodes.

Author Contributions

Conception of the work: Z.D. Collection of data: X.C., M.A. and Z.Y. Analysis of data: Z.D., S.Y., X.C. and M.A. Writing of manuscript: X.C., Z.Y. and Z.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 31640063; No. 31872038).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dolphin, A.C. A short history of voltage-gated calcium channels. Br. J. Pharmacol. 2006, 147, S56–S62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Dolphin, A.C. Voltage-gated calcium channels: Their discovery, function and importance as drug targets. Brain Neurosci. Adv. 2018, 2, 1–8. [Google Scholar] [CrossRef] [PubMed]
  3. Mangoni, M.E.; Couette, B.; Bourinet, E.; Platzer, J.; Reimer, D.; Striessnig, J.; Nargeot, J. Functional role of L-type Cav1.3 Ca2+ channels in cardiac pacemaker activity. Proc. Natl. Acad. Sci. USA 2003, 100, 5543–5548. [Google Scholar] [CrossRef] [Green Version]
  4. Guzman, J.N.; Sanchez-Padilla, J.; Chan, C.S.; Surmeier, D.J. Robust pacemaking in substantia nigra dopaminergic neurons. J. Neurosci. 2009, 29, 11011–11019. [Google Scholar] [CrossRef] [Green Version]
  5. Striessnig, J.; Pinggera, A.; Kaur, G.; Bock, G.; Tuluc, P. L-type Ca2+ channels in heart and brain. Wiley Interdiscip. Rev. Membr. Transp. Signal. 2014, 3, 15–38. [Google Scholar] [CrossRef]
  6. Chen, Y.H.; Li, M.H.; Zhang, Y.; He, L.L.; Yamada, Y.; Fitzmaurice, A.; Shen, Y.; Zhang, H.; Tong, L.; Yang, J. Structural basis of the α1-β subunit interaction of voltage-gated Ca2+ channels. Nature 2004, 429, 675–680. [Google Scholar] [CrossRef] [PubMed]
  7. Opatowsky, Y.; Chen, C.C.; Campbell, K.P.; Hirsch, J.A. Structural analysis of the voltage-dependent Calcium Channel β subunit functional core and its complex with the α1 interaction domain. Neuron 2004, 42, 387–399. [Google Scholar] [CrossRef] [Green Version]
  8. Buraei, Z.; Yang, J. Structure and function of the β subunit of voltage-gated Ca2+ channels. Biochim. Biophys. Acta 2013, 1828, 1530–1540. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Barclay, J.; Balaguero, N.; Mione, M.; Ackerman, S.L.; Letts, V.A.; Brodbeck, J.; Canti, C.; Meir, A.; Page, K.M.; Kusumi, K.; et al. Ducky mouse phenotype of epilepsy and ataxia is associated with mutations in the Cacna2d2 gene and decreased calcium channel current in cerebellar Purkinje cells. J. Neurosci. 2001, 21, 6095–6104. [Google Scholar] [CrossRef] [Green Version]
  10. Brodbeck, J.; Davies, A.; Courtney, J.M.; Meir, A.; Balaguero, N.; Canti, C.; Moss, F.J.; Page, K.M.; Pratt, W.S.; Hunt, S.P.; et al. The ducky mutation in Cacna2d2 results in altered Purkinje cell morphology and is associated with the expression of a truncated alpha 2 delta-2 protein with abnormal function. J. Biol. Chem. 2002, 277, 7684–7693. [Google Scholar] [CrossRef]
  11. Klugbauer, N.; Lacinová, L.; Marais, E.; Hobom, M.; Hofmann, F. Molecular diversity of the calcium channel alpha2delta subunit. J. Neurosci. 1999, 19, 684–691. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Qin, N.; Yagel, S.; Momplaisir, M.L.; Codd, E.E.; D’Andrea, M.R. Molecular cloning and characterization of the human voltage-gated calcium channel alpha(2)delta-4 subunit. Mol. Pharmacol. 2002, 62, 485–496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Wycisk, K.A.; Zeitz, C.; Feil, S.; Wittmer, M.; Forster, U.; Neidhardt, J.; Wissinger, B.; Zrenner, E.; Wilke, R.; Kohl, S.; et al. Mutation in the auxiliary calcium-channel subunit CACNA2D4 causes autosomal recessive cone dystrophy. Am. J. Hum. Genet. 2006, 79, 973–977. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Calderón-Rivera, A.; Andrade, A.; Hernández-Hernández, O.; González-Ramírez, R.; Sandoval, A.; Rivera, M.; Gomora, J.C.; Felix, R. Identification of a disulfide bridge essential for structure and function of the voltage-gated Ca2+ channel α2δ-1 auxiliary subunit. Cell Calcium 2012, 51, 22–30. [Google Scholar] [CrossRef] [Green Version]
  15. Davies, A.; Kadurin, I.; Alvarez-Laviada, A.; Douglas, L.; Nieto-Rostro, M.; Bauer, C.S.; Pratt, W.S.; Dolphin, A.C. The alpha2delta subunits of voltage-gated calcium channels form GPI-anchored proteins, a posttranslational modification essential for function. Proc. Natl. Acad. Sci. USA 2010, 107, 1654–1659. [Google Scholar] [CrossRef] [Green Version]
  16. Pierleoni, A.; Martelli, P.L.; Casadio, R. PredGPI: A GPI-anchor predictor. BMC Bioinform. 2008, 9, 1–11. [Google Scholar] [CrossRef] [Green Version]
  17. Niklaus, F.; Pascal, M. Identification of GPI anchor attachment signals by a Kohonen self-organizing map. Bioinformatics 2005, 21, 1846–1852. [Google Scholar] [CrossRef] [Green Version]
  18. Whittaker, C.A.; Hynes, R.O. Distribution and evolution of von Willebrand/integrin A domains: Widely dispersed domains with roles in cell adhesion and elsewhere. Mol. Biol. Cell 2002, 13, 3369–3387. [Google Scholar] [CrossRef] [Green Version]
  19. Cantí, C.; Nieto-Rostro, M.; Foucault, I.; Heblich, F.; Wratten, J.; Richards, M.W.; Hendrich, J.; Douglas, L.; Page, K.M.; Davies, A.; et al. The metal-ion-dependent adhesion site in the Von Willebrand factor-A domain of alpha2delta subunits is key to trafficking voltage-gated Ca2+ channels. Proc. Natl. Acad. Sci. USA 2005, 102, 11230–11235. [Google Scholar] [CrossRef] [Green Version]
  20. Dolphin, A.C.; Annette, C. The α2δ subunits of voltage-gated calcium channels. Biochim. Biophys. Acta 2013, 1828, 1541–1549. [Google Scholar] [CrossRef]
  21. Anantharaman, V.; Aravind, L. Cache—A signaling domain common to animal Ca2+-channel subunits and a class of prokaryotic chemotaxis receptors. Trends Biochem. Sci. 2000, 25, 535–537. [Google Scholar] [CrossRef]
  22. Dolphin, A.C. Calcium channel α2δ subunits in epilepsy and as targets for antiepileptic drugs. Epilepsia 2011, 51, 82. [Google Scholar] [CrossRef]
  23. Brown, J.P.; Dissanayake, V.U.; Briggs, A.R.; Milic, M.R.; Gee, N.S. Isolation of the [3H] gabapentin-binding protein/α2δ Ca2+ channel subunit from porcine brain: Development of a radioligand binding assay for α2δ subunits using [3H] leucine. Anal. Biochem. 1998, 255, 236–243. [Google Scholar] [CrossRef] [PubMed]
  24. Dissanayake, V.; Gee, N.S.; Brown, J.P.; Woodruff, G.N. Spermine modulation of specific [3H]-gabapentin binding to the detergent-solubilized porcine cerebral cortex α2δ calcium channel subunit. Br. J. Pharmacol. 1997, 120, 833. [Google Scholar] [CrossRef] [Green Version]
  25. Bargmann, C.I. Neurobiology of the Caenorhabditis elegans Genome. Science 1998, 282, 2028–2033. [Google Scholar] [CrossRef]
  26. Lainé, V.; Frøkjær-Jensen, C.; Couchoux, H.; Jospin, M. The α1 Subunit EGL-19, the α2/δ Subunit UNC-36, and the β subunit CCB-1 underlie voltage-dependent calcium currents in Caenorhabditis elegans striated muscle. J. Biol. Chem. 2011, 286, 36180–36187. [Google Scholar] [CrossRef] [Green Version]
  27. Frkjaer-Jensen, C.; Kindt, K.S.; Kerr, R.A.; Suzuki, H.; Melnik-Martinez, K.; Gerstbreih, B.; Driscol, M.; Schafer, W.R. Effects of voltage-gated calcium channel subunit genes on calcium influx in cultured C. elegans mechanosensory neurons. J. Neurobiol. 2006, 66, 1125–1139. [Google Scholar] [CrossRef]
  28. Holovachov, O.; van Megen, H.; Bongers, T.; Bakker, J.; Helder, J.; van den Elsen, S.; Holterman, M.; Karssen, G.; Mooyman, P. A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences. Nematology 2009, 11, 927–950. [Google Scholar] [CrossRef]
  29. De Waele, D.G.C.R.; Jones, B.L.; Bolton, C.; van den Berg, E. Ditylenchus destructor in hulls and seeds of peanut. J. Nematol. 1989, 21, 10–15. [Google Scholar]
  30. Venter, C.; Waele, D.D.; Meyer, A.J. Reproductive and Damage Potential of Ditylenchus destructor on Six Peanut Cultivars. J. Nematol. 1993, 25, 59–62. [Google Scholar]
  31. Ni, C.; Zhang, S.; Li, H.; Liu, Y.; Li, W.; Xu, X.; Xu, Z. First report of potato rot nematode, Ditylenchus destructor Thorne, 1945 infecting Codonopsis pilosula in Gansu province, China. J. Nematol. 2020, 52, e2020–e2087. [Google Scholar] [CrossRef] [PubMed]
  32. Faulkner, L.R.; Darling, H.M. Pathological histology, hosts, and culture of the potato rot nematode. Phytopathology 1961, 51, 778–786. [Google Scholar]
  33. Ye, S.; Zeng, R.; Zhou, J.; An, M.; Ding, Z. Molecular characterization of Ditylenchus destructor voltage-gated calcium channel α1 subunits and analysis of the effect of their knockdown on nematode activity. Biochimie 2020, 171, 91–102. [Google Scholar] [CrossRef] [PubMed]
  34. Blaxter, M.; Liu, L. Nematode spliced leaders—Ubiquity, evolution and utility. Int. J. Parasitol. 1996, 26, 1025–1033. [Google Scholar]
  35. Mitreva, M.; Elling, A.A.; Dante, M.; Kloek, A.P.; Kalyanaraman, A.; Aluru, S.; Clifton, S.W.; Bird, D.M.; Baum, T.J.; McCarter, J.P. A survey of SL1-spliced transcripts from the root-lesion nematode Pratylenchus penetrans. Mol. Genet. Genom. 2004, 272, 138–148. [Google Scholar] [CrossRef]
  36. Catterall, W.A. From ionic currents to molecular mechanisms: The structure and function of voltage-gated sodium channels. Neuron 2000, 26, 13–25. [Google Scholar] [CrossRef] [Green Version]
  37. Zeng, R.; Yu, X.; Tan, X.; Ye, S.; Ding, Z. Deltamethrin affects the expression of voltage-gated calcium channel α1 subunits and the locomotion, egg-laying, foraging behavior of Caenorhabditis elegans. Pestic. Biochem. Physiol. 2017, 138, 84–90. [Google Scholar] [CrossRef]
  38. Arikkath, J.; Campbell, K.P. Auxiliary subunits: Essential components of the voltage-gated calcium channel complex. Curr. Opin. Neurobiol. 2003, 13, 298–307. [Google Scholar] [CrossRef]
  39. Geisler, S.; Schöpf, C.L.; Obermair, G.J. Emerging evidence for specific neuronal functions of auxiliary calcium channel α₂δ subunits. Gen. Physiol. Biophys. 2014, 34, 105–118. [Google Scholar] [CrossRef] [Green Version]
  40. An, M.; Chen, X.; Yang, Z.; Zhou, J.; Ye, S.; Ding, Z. Co-Silencing of the Voltage-Gated Calcium Channel β Subunit and High-Voltage Activated α1 Subunit by dsRNA Soaking Resulted in Enhanced Defects in Locomotion, Stylet Thrusting, Chemotaxis, Protein Secretion, and Reproduction in Ditylenchus destructor. Int. J. Mol. Sci. 2022, 23, 784–800. [Google Scholar] [CrossRef]
  41. Pragnell, M.; de Waard, M.; Moi, Y.; Tanabe, T.; Snutch, T.P.; Campbell, K.P. Calcium channel beta-subunit binds to a conserved motif in the I-II cytoplasmic linker of the alpha 1-subunit. Nature 1994, 368, 67–70. [Google Scholar] [CrossRef] [PubMed]
  42. Voigt, A.; Freund, R.; Heck, J.; Missler, M.; Obermair, G.J.; Thomas, U.; Heine, M. Dynamic association of calcium channel subunits at the cellular membrane. Neurophotonics 2016, 3, 41809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Whitehead, A.G.; Hemming, J.R. A comparison of some quantitative methods of extracting small vermiform nematodes from soil. Ann. Appl. Biol. 1965, 55, 25–38. [Google Scholar] [CrossRef]
  44. Schaad, N.W.; Walker, J.T. The Use of Density-Gradient Centrifugation for the Purification of Eggs of Meloidogyne spp. J. Nematol. 1975, 7, 203–204. [Google Scholar] [PubMed]
  45. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real- time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  47. Kud, J.; Solo, N.; Caplan, A.; Dandurand, L.M.; Xiao, F. In situ Hybridization of Plant-parasitic Nematode Globodera pallida Juveniles to Detect Gene Expression. Bio Protoc. 2019, 9, e3372. [Google Scholar] [CrossRef]
  48. Urwin, P.E.; Lilley, C.J.; Atkinson, H.J. Ingestion of double-stranded RNA by preparasitic juvenile cyst nematodes leads to RNA interference. Mol. Plant. Microbe Interact. 2002, 15, 747–752. [Google Scholar] [CrossRef] [Green Version]
  49. Kimber, M.J.; Mckinney, S.; Mcmaster, S.; Day, T.A.; Fleming, C.C.; Maule, A.G. flp gene disruption in a parasitic nematode reveals motor dysfunction and unusual neuronal sensitivity to RNA interference. FASEB J. 2007, 21, 1233–1243. [Google Scholar] [CrossRef]
  50. McClure, M.A. Induced Salivation in Plant-Parasitic Nematodes. Phytopathology 1987, 77, 1463–1469. [Google Scholar] [CrossRef]
  51. Duncan, D.B. Multiple range and multiple F tests. Biometrics 1955, 11, 1–42. [Google Scholar] [CrossRef]
Ijms 23 12999 g001 550
Figure 1. Sequence of DdCavα2δ cDNA and its deduced amino acid sequence. The start codon (ATG) and the stop codon (TGA) are indicated by boxes. The nucleic acid sequence fragment before the ATG is the 5’UTR, and the nucleic acid sequence fragment after the TGA is the 3’UTR. The underlined region indicates the SL1 at the front of the 5’UTR and the polyA tail at the end of the 3’UTR. The asterisk (*) shows the stop codon (TGA). Orange shows the N-terminal of the VWA domain; blue and green show the VWA domain and Cache domain, respectively; the MIDAS motif is marked with a “•” symbol.
Figure 1. Sequence of DdCavα2δ cDNA and its deduced amino acid sequence. The start codon (ATG) and the stop codon (TGA) are indicated by boxes. The nucleic acid sequence fragment before the ATG is the 5’UTR, and the nucleic acid sequence fragment after the TGA is the 3’UTR. The underlined region indicates the SL1 at the front of the 5’UTR and the polyA tail at the end of the 3’UTR. The asterisk (*) shows the stop codon (TGA). Orange shows the N-terminal of the VWA domain; blue and green show the VWA domain and Cache domain, respectively; the MIDAS motif is marked with a “•” symbol.
Ijms 23 12999 g001
Ijms 23 12999 g002 550
Figure 2. Amino acid sequence of the DdCavα2δ subunit. Blue indicates cysteine residues, red indicates N-glycosylation sites, and underlining indicates suspected GPI anchor sites.
Figure 2. Amino acid sequence of the DdCavα2δ subunit. Blue indicates cysteine residues, red indicates N-glycosylation sites, and underlining indicates suspected GPI anchor sites.
Ijms 23 12999 g002
Ijms 23 12999 g003 550
Figure 3. Multiple alignment analysis of DdCavα2δ with other species’ Cavα2δ. Blue indicates the VWA domain; green indicates the Cache domain; black indicates the α2; yellow indicates the δ; the red arrow indicates the breaking point between α2 and δ subunits. Other species’ Cavα2δ amino acid sequences from NCBI database (https://blast.ncbi.nlm.nih.gov, accessed on 15 October 2022), with the following accession numbers: human-α2δ-1 (NM_000722), human-α2δ-2 (AF042793), human-α2δ-3 (AF516696), human-α2δ-4 (AF516695), unc-36 (NM_001047386.6).
Figure 3. Multiple alignment analysis of DdCavα2δ with other species’ Cavα2δ. Blue indicates the VWA domain; green indicates the Cache domain; black indicates the α2; yellow indicates the δ; the red arrow indicates the breaking point between α2 and δ subunits. Other species’ Cavα2δ amino acid sequences from NCBI database (https://blast.ncbi.nlm.nih.gov, accessed on 15 October 2022), with the following accession numbers: human-α2δ-1 (NM_000722), human-α2δ-2 (AF042793), human-α2δ-3 (AF516696), human-α2δ-4 (AF516695), unc-36 (NM_001047386.6).
Ijms 23 12999 g003
Ijms 23 12999 g004 550
Figure 4. Phylogenetic analysis of DdCavα2δ with α2δ genes from other species. The phylogenetic tree was constructed from the amino acid sequences of 20 VWA structural domain-containing α2δ genes. The tree was constructed using MEGA 6.0 based on the neighbor-joining method according to the amino acid sequences. The phylogenetic tree and sequences of other species were in the NCBI database; accession numbers are shown in Table 2.
Figure 4. Phylogenetic analysis of DdCavα2δ with α2δ genes from other species. The phylogenetic tree was constructed from the amino acid sequences of 20 VWA structural domain-containing α2δ genes. The tree was constructed using MEGA 6.0 based on the neighbor-joining method according to the amino acid sequences. The phylogenetic tree and sequences of other species were in the NCBI database; accession numbers are shown in Table 2.
Ijms 23 12999 g004
Ijms 23 12999 g005 550
Figure 5. Relative transcript abundance of the DdCavα2δ gene at each developmental stage. Using the transcript levels in J2 as a reference, DdCavα2δ was significantly upregulated in other stages (J2, J3, and J4). Quantitative RT-PCR values are the mean ± standard error. Letters indicate significant differences according to Duncan’s one-way ANOVA of SPSS 21.0 Software (p < 0.05). Tissue localization analysis of DdCavα2δ was conducted. The experiments were performed three times with similar results.
Figure 5. Relative transcript abundance of the DdCavα2δ gene at each developmental stage. Using the transcript levels in J2 as a reference, DdCavα2δ was significantly upregulated in other stages (J2, J3, and J4). Quantitative RT-PCR values are the mean ± standard error. Letters indicate significant differences according to Duncan’s one-way ANOVA of SPSS 21.0 Software (p < 0.05). Tissue localization analysis of DdCavα2δ was conducted. The experiments were performed three times with similar results.
Ijms 23 12999 g005
Ijms 23 12999 g006 550
Figure 6. Tissue localization of DdCavα2δ mRNA in the adult stages of D. destructor. (A–D): No hybridization signal was observed in D. destructor with the sense probe. (E–H): Tissue localization of DdCavα2δ mRNA in D. destructor with the antisense probe. st: stylet; mb: median bulb; eg: esophageal glands; bw: body wall; u: uterus; v: vulva; pu: post uterine; s: spicules.
Figure 6. Tissue localization of DdCavα2δ mRNA in the adult stages of D. destructor. (A–D): No hybridization signal was observed in D. destructor with the sense probe. (E–H): Tissue localization of DdCavα2δ mRNA in D. destructor with the antisense probe. st: stylet; mb: median bulb; eg: esophageal glands; bw: body wall; u: uterus; v: vulva; pu: post uterine; s: spicules.
Ijms 23 12999 g006
Ijms 23 12999 g007 550
Figure 7. Effect of different dsRNA soaking solutions on the expression level of DdCα1D, DdCα1A, and DdCavα2δ genes. Control nematodes were soaked in the solution containing non-target GFP dsRNA. (A) Nematodes treated with DdCavα2δ dsRNA. (B) Nematodes treated with DdCα1D dsRNA. (C) Nematodes treated with DdCα1A dsRNA. (D) Nematodes treated with DdCavα2δ and DdCα1D dsRNA. (E) Nematodes treated with DdCavα2δ and DdCα1A dsRNA. After 24 h of dsRNA soaking, mRNA was extracted from D. destructor samples and then subjected to qRT-PCR analysis. Asterisks indicate significant differences based on Student’s t test, ** p < 0.01, ns indicates no significant difference. The experiments were performed three times with similar results.
Figure 7. Effect of different dsRNA soaking solutions on the expression level of DdCα1D, DdCα1A, and DdCavα2δ genes. Control nematodes were soaked in the solution containing non-target GFP dsRNA. (A) Nematodes treated with DdCavα2δ dsRNA. (B) Nematodes treated with DdCα1D dsRNA. (C) Nematodes treated with DdCα1A dsRNA. (D) Nematodes treated with DdCavα2δ and DdCα1D dsRNA. (E) Nematodes treated with DdCavα2δ and DdCα1A dsRNA. After 24 h of dsRNA soaking, mRNA was extracted from D. destructor samples and then subjected to qRT-PCR analysis. Asterisks indicate significant differences based on Student’s t test, ** p < 0.01, ns indicates no significant difference. The experiments were performed three times with similar results.
Ijms 23 12999 g007
Ijms 23 12999 g008 550
Figure 8. Effect of dsRNA soaking on the motility of D. destructor. One hundred J2-J3 worms treated with dsRNA were added to the sand column, and the number of worms passing through the sand column was counted at 6 h and 24 h, respectively, to calculate the migration rating. Each column represents the mean ± standard error of three replicates. Different letters indicate significant differences at p < 0.05 by Duncan’s multiple range test. The experiments were performed three times with similar results.
Figure 8. Effect of dsRNA soaking on the motility of D. destructor. One hundred J2-J3 worms treated with dsRNA were added to the sand column, and the number of worms passing through the sand column was counted at 6 h and 24 h, respectively, to calculate the migration rating. Each column represents the mean ± standard error of three replicates. Different letters indicate significant differences at p < 0.05 by Duncan’s multiple range test. The experiments were performed three times with similar results.
Ijms 23 12999 g008
Ijms 23 12999 g009 550
Figure 9. Effect of dsRNA soaking on the phenotype of D. destructor. (A) Effect of dsRNA soaking on the chemotaxis of D. destructor. (B) Effect of dsRNA soaking on the stylet thrusting of D. destructor. (C) Effect of dsRNA soaking on secreted proteins of D. destructor. (D) Effect of dsRNA soaking on the reproduction of D. destructor. The worms treated with clear water were set as the control. Different letters indicate significant differences at p < 0.05 by Duncan’s multiple range test. The experiments were performed three times with similar results.
Figure 9. Effect of dsRNA soaking on the phenotype of D. destructor. (A) Effect of dsRNA soaking on the chemotaxis of D. destructor. (B) Effect of dsRNA soaking on the stylet thrusting of D. destructor. (C) Effect of dsRNA soaking on secreted proteins of D. destructor. (D) Effect of dsRNA soaking on the reproduction of D. destructor. The worms treated with clear water were set as the control. Different letters indicate significant differences at p < 0.05 by Duncan’s multiple range test. The experiments were performed three times with similar results.
Ijms 23 12999 g009
Table
Table 1. Primers used in the study.
Table 1. Primers used in the study.
PrimerSequence (5′ to 3′)Use
SL1GGTTTAATTACCCAAGTTTGAGPrimers used for DdCavα2δ cloning
5′-R1ATGACAAATCTTTTAGGCGTTC
5′-R2GTGGGAATACCATAGAAGTTGAC
D-FAATGCCAAAAAATCGGACTTC
D-RATAGCAGGAGGATTAGAACGATG
3′ RACE outer primerTACCGTCGTTCCACTAGTGATTT
3′ RACE inner primerCGCGGATCCTCCACTAGTGATTTCACTATAGG
3′-F1CCGTCCTCCTTCTCACAAGATAG
3′-F2TCCCATCGTTCTAATCCTCCTGCTA
18S-FCTGATTAGCGATTCTTACGGAPrimers for real-time PCR analysis
18S-RAGAAGCATGCCACCTTTGA
qα2δ-FGCCTGGGATGCAAAAGTGAGTCA
qα2δ-RAGCGTTGAGGTAGCGAACGAAA
qL-FGACCCGTTATTGTTGAGCCA
qL-RACGTTCCTTCGAGATGAGA
qNL-FTAGAAAACAGGCGAGACTTCC
qNL-RCTCATCCGTTGTTCGATCCTC
HindIIIFCCCAAGCTTGCTGCAGTCCCGATGATGPrimers for ISH analysis
EcoRI RGGAATTCCCATGGTCCATCCGTCAC
dsα2δ-FTAATACGACTCACTATAGGGCAAGGCCTTTATTATCGGTAGPrimers used for synthesizing dsRNA
dsα2δ-RTAATACGACTCACTATAGGGGTCGGCACTTTCTGTGGTAG
dsL-FTAATACGACTCACTATAGGGAGGAAGATGACCTCTTGTTAG
dsL-RTAATACGACTCACTATAGGGCCCAATATATGACCGTCTTTG
dsNL-FTAATACGACTCACTATAGGGCGCAACACGTACCAAACTC
dsNL-RTAATACGACTCACTATAGGGCTCATCTGAATCGCTAAGAGG
dsGFP-FTAATACGACTCACTATAGGGTACATCGCTCTTTCTTCACCG
dsGFP-RTAATACGACTCACTATAGGGACCAACAAGATGAAGAGCACC
The underlined line indicates the restriction enzyme sites and the T7 promoter sequences.
Table
Table 2. DdCavα2δ information used for sequence alignment and phylogenetic analysis.
Table 2. DdCavα2δ information used for sequence alignment and phylogenetic analysis.
SpeciesMolecular Name/Accession NumberIdentity (%)
Caenorhabditis brenneritag-180/EGT44808.122.0
Caenorhabditiselegansunc-36/CCD66125.140.0
Homo sapiensalpha-2/delta-1/NP_001353796.124.6
alpha-2/delta-2 /NP_001167522.124.3
alpha-2/delta-3/NP_060868.227.0
alpha-2/delta-4/XP_011519343.126.2
Mus musculusalpha-2/delta-1/NP_001104316.124.4
alpha-2/delta-2/NP_001167518.124.3
alpha-2/delta-3/NP_033915.125.7
alpha-2/delta-4/NP_001028554.325.5
Oryctolagus cuniculusalpha-2/delta-1/NP_001075745.124.9
Pristionchus pacificustag-180/PDM71166.121.9
Rattus norvegicusalpha-2/delta-1/NP_037051.224.5
alpha-2/delta-2 /NP_783182.123.3
alpha-2/delta-3 /NP_783185.127.3
Sus scrofaalpha-2/delta-1/NP_999348.124.5
Trichinella nativaunc-36/KRZ54583.131.3
Trichinella papuaeunc-36/KRZ69354.134.7
Trichinella pseudospiralisunc-36/KRZ37420.131.3
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Chen, X.; An, M.; Ye, S.; Yang, Z.; Ding, Z. The α2δ Calcium Channel Subunit Accessorily and Independently Affects the Biological Function of Ditylenchus destructor. Int. J. Mol. Sci. 2022, 23, 12999. https://doi.org/10.3390/ijms232112999

AMA Style

Chen X, An M, Ye S, Yang Z, Ding Z. The α2δ Calcium Channel Subunit Accessorily and Independently Affects the Biological Function of Ditylenchus destructor. International Journal of Molecular Sciences. 2022; 23(21):12999. https://doi.org/10.3390/ijms232112999

Chicago/Turabian Style

Chen, Xueling, Mingwei An, Shan Ye, Zhuhong Yang, and Zhong Ding. 2022. "The α2δ Calcium Channel Subunit Accessorily and Independently Affects the Biological Function of Ditylenchus destructor" International Journal of Molecular Sciences 23, no. 21: 12999. https://doi.org/10.3390/ijms232112999

APA Style

Chen, X., An, M., Ye, S., Yang, Z., & Ding, Z. (2022). The α2δ Calcium Channel Subunit Accessorily and Independently Affects the Biological Function of Ditylenchus destructor. International Journal of Molecular Sciences, 23(21), 12999. https://doi.org/10.3390/ijms232112999

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop