Next Article in Journal
Unraveling the Aquaporin-3 Inhibitory Effect of Rottlerin by Experimental and Computational Approaches
Next Article in Special Issue
Valorisation of Whey Permeate in Sequential Bioprocesses towards Value-Added Products–Optimisation of Biphasic and Classical Batch Cultures of Kluyveromyces marxianus
Previous Article in Journal
Mitochondrial Metabolism and EV Cargo of Endothelial Cells Is Affected in Presence of EVs Derived from MSCs on Which HIF Is Activated
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 6
10.3390/ijms24066003
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Efficient Knocking Out of the Organophosphorus Insecticides Degradation Gene opdB in Cupriavidus nantongensis X1T via CRISPR/Cas9 with Red System

by
Yufei Zhang
1,
Yuehan Geng
1,
Shengyang Li
1,
Taozhong Shi
1,
Xin Ma
1,
Rimao Hua
1,2,* and
Liancheng Fang
1,2,*
1
Anhui Provincial Key Laboratory for Quality and Safety of Agri-Products, School of Resource & Environment, Anhui Agricultural University, Hefei 230036, China
2
Institute for Green Development, Anhui Agricultural University, Hefei 230036, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(6), 6003; https://doi.org/10.3390/ijms24066003
Submission received: 13 February 2023 / Revised: 17 March 2023 / Accepted: 20 March 2023 / Published: 22 March 2023
(This article belongs to the Special Issue Role of Microorganisms and Their Metabolites in Agriculture, Food and the Environment)
Browse Figures
Review Reports Versions Notes

Abstract

:
Cupriavidus nantongensis X1T is a type strain of the genus Cupriavidus, that can degrade eight kinds of organophosphorus insecticides (OPs). Conventional genetic manipulations in Cupriavidus species are time-consuming, difficult, and hard to control. The clustered regularly interspaced short palindromic repeat (CRISPR)/associated protein 9 (Cas9) system has emerged as a powerful tool for genome editing applied in prokaryotes and eukaryotes due to its simplicity, efficiency, and accuracy. Here, we combined CRISPR/Cas9 with the Red system to perform seamless genetic manipulation in the X1T strain. Two plasmids, pACasN and pDCRH were constructed. The pACasN plasmid contained Cas9 nuclease and Red recombinase, and the pDCRH plasmid contained the dual single-guide RNA (sgRNA) of organophosphorus hydrolase (OpdB) in the X1T strain. For gene editing, two plasmids were transferred to the X1T strain and a mutant strain in which genetic recombination had taken place, resulting in the targeted deletion of opdB. The incidence of homologous recombination was over 30%. Biodegradation experiments suggested that the opdB gene was responsible for the catabolism of organophosphorus insecticides. This study was the first to use the CRISPR/Cas9 system for gene targeting in the genus Cupriavidus, and it furthered our understanding of the process of degradation of organophosphorus insecticides in the X1T strain.

1. Introduction

The genus Cupriavidus is a class of Gram-negative bacteria that grows under chemoheterotrophic or chemolithotrophic conditions [1]. In recent years, several Cupriavidus species were isolated form soil, activated sludge, space equipment, root nodules of legumes, human clinical specimens and groundwater [2,3,4,5,6,7]. Heavy metal resistance is a representative characteristic of the genus Cupriavidus species [8]. Due to their significant prominence in pollutant bioremediation, biomineralization, symbiotic adaptation, biodetoxification, and the production of biodegradable polymers, Cupriavidus species have become a focus of scientific investigations [6,9,10,11,12]. For instance, Cupriavidus strains have been reported to degrade aromatic pollutants, including pesticides and halogenated phenols in various environments [13,14]. However, since there is not a model strain, efficient gene editing tools that are suitable for Cupriavidus species have rarely been reported, which has hindered the further exploration of the functions of these strains.
Traditional gene editing methods use a single recombinational insertion or allelic exchange of the flanking regions located upstream and downstream of the intergenic region to disrupt the open reading frames of the target gene in the genus Cupriavidus species [15,16,17,18,19]. However, complete biallelic knockouts can be achieved with relatively low mutation efficiency. The clustered regularly interspaced short palindromic repeat (CRISPR)/associated protein (Cas) system is an adaptive immune system in bacteria that works against mobile invading elements, such as phages and plasmids [20]. The CRISPR/Cas9 system is a recently emerged genome editing tool that has high efficiency for genome modification, and it can be used to cause the complete abolishment of gene functions through the deletion of entire sequences or genes via homologous recombination (HR) [21]. Compared to ZFNs (zinc finger nucleases) and TALENs (transcription activator-like effector nucleases), the CRISPR/Cas9 system is not time-consuming and labor-intensive to use [22]. CRISPR/Cas9 was found in Streptococcus pyogenes, which could use a maturation CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) to guide the protein of Cas9 nuclease to the target region [23]. With the dissociation of mature crRNA and tracrRNA, a chimeric single-guide RNA (sgRNA) can be created and used favorably in genome editing [24]. Large indels can be produced by using dual sgRNAs that target one gene-guided Cas9 nuclease to generate mutants in organisms, which would reduce the off-target rate and facilitate mutant screening through PCR [25,26,27]. In addition, Cas9 endonuclease requires a specific protospacer-adjacent motif (PAM) of the “NGG” nucleotide sequence at the 3′ end of the sgRNA binding site in order to generate a double-strand break at the locus of interest in the target DNA [23,24].
The CRISPR/Cas9 system has been used for genome editing in various bacterial species [28,29,30]. In the case of double strand breaks (DSBs) introduced by the CRISPR/Cas9 complex, non-homologous end joining (NHEJ) and homologous recombination (HR) can be used to repair them to introduce indels. However, the NHEJ recombination machinery is either absent or does not function efficiently in most bacteria [31]. For the efficient and precise repair of DSBs, HR is an error-free system that uses an engineered homologous template in bacteria [32]. Furthermore, CRISPR/Cas9 system combined with the λ-Red recombinant method can achieve multigene editing in E. coli simultaneously [33]. The efficiency of genome editing can be improved by using the λ-Red recombination system from phage recombinase-mediated homologous recombination [34]. The Red recombination system has a high homologous recombination efficiency because of its use of either single or double DNA fragments to introduce mutations into chromosomes, plasmids, and bacterial artificial chromosomes [35,36,37]. The Red system promotes the repair of double-strand breaks in DNA [38]. It consists of the Exo, Bet, and Gam proteins, which improve the frequency of insertions, deletions, and point mutations at the target locus specified by the flanking homology regions [35,37]. Exo is an exonuclease of the 5′-3′ end that cuts double-strand DNA (dsDNA). Bet stimulates the formation of joint molecules and strand exchange. When the system is stimulated by dsDNA ends, Gam can prevent DNA digestion of the λ phage and promote recombination so that Exo and Bet can approach the DNA ends [37].
In our previous study, a novel type of strain of the genus Cupriavidus, C. nantongensis X1T, was isolated and identified [39]. The X1T strain could degrade eight kinds of organophosphorus insecticides (profenofos, chlorpyrifos, methyl parathion, parathion, triazophos, phoxim, fenitrothion and isocarbophos) [40]. Meanwhile, an organophosphorus degradation gene opdB, which encodes organophosphate hydrolase, was found through complete genome sequencing [39,41]. Here, we explored a stable and efficient method for gene editing in the X1T strain by using CRISPR/Cas9 with the Red system. Two plasmids were constructed for gene editing in the X1T strain. The editing efficiency was evaluated by knocking out the organophosphorus insecticide degradation gene opdB. This may be a valuable genetic toolbox for the genus Cupriavidus.

2. Results

2.1. Construction and Screening of the CRISPR/Cas9-Based Genome Editing System in the X1T Strain

To develop an efficient and convenient genetic manipulation tool for the X1T strain, we introduced two plasmids into the X1T strain for genome editing by harnessing the CRISPR/Cas9-based genome editing method. The RNA-guided nuclease Cas9 from Streptococcus pyogenes formed the pACasN plasmid (Figure 1A). Then we combined dual spacers with homologous arms with a length of 600 bp in the pDCRH plasmid (Figure 1A) to assess the editing efficiency of the system in the X1T strain. As is indicated in Figure 1B, there was a distinct difference in the number of transformants when another plasmid is introduced into the host cell. We calculated the transformation efficiency of two successive plasmids in the period of stable growth of the X1T strain (Figure 1C). The transformation efficiency of pACasN was 86.1 ± 21.3 CFU/mg of donor. The transformation efficiency of pDCRH was 7.4 ± 1.9 CFU/mg of the donor. Another pDCRH plasmid assembled with dual sgRNAs and homologous repair arms was found to have a transformation efficiency that was 11.6-fold (86.1/7.4) lower than that when the pACasN plasmid bearing the cas9 gene was transferred into the X1T strain, which suggested that the plasmid-based expression of the Cas9 protein encoded by the cas9 gene had cleaved the target site in the plasmid of the X1T strain efficiently.

2.2. Evaluation of the Efficiency of Gene Knockout of opdB in the X1T Strain

To demonstrate the functionality of the CRISPR/Cas9 system in the X1T strain, we attempted to delete the whole ORF of opdB, which was 1.5 kb in length. As shown in Figure 2A, the sequence of the dual-sgRNA and homology repair arms was identified by bacteria solution PCR and Sanger sequencing. For the treatment of electroporation, the pACasN plasmid was transformed into the competent cells of the X1T strain. Positive transformants were identified by colony PCR and Sanger sequencing (Figure 2B). The plasmid pDCRH-UD was transformed into the competent cells of the X1T -pACasN strain. Positive transformants were identified by colony PCR and Sanger sequencing (Figure 2C). As indicated in Figure 2D, the PCR results indicated that the ΔopdB mutant strain was successfully obtained. The efficiency of knocking out opdB from the X1T strain was over 30% (7/23). As shown in Figure 2E, the PCR product was obtained in the mutant strain after curing two plasmids, indicating the opdB gene was successfully deleted. As shown in Figure A1 in Appendix, Sanger sequencing was performed to confirm the deletion of the mutant strains of X1T-ΔopdB.

2.3. Plasmid Curing

For the curing of two plasmids, 6% w/v sucrose was used to induce the expression of the sacB gene. Then, cells were cultured at 30 °C for three days. The results showed that the induction of 6% w/v sucrose for three days caused much fewer colonies to grow on the plate than in the absence of sucrose (Figure 3A). The colonies of X1T-ΔopdB containing two plasmids were picked from the plate with 6% w/v sucrose and grown on the plates containing 100 μg/mL tetracycline (Figure 3B) and 50 μg/mL neomycin (Figure 3C), respectively. Curing is a consequence of protoplast divisions in which chromosomes are correctly partitioned, but plasmids are not. In the absence of the two plasmids harboring resistance markers, the X1T-ΔopdB strain was sensitive to two kinds of antibiotics. Therefore, several colonies could not grow on the plate with antibiotics. The experimental results indicated that both the pACasN and pDCRH plasmids were successfully cured. The curing efficiency of plasmids of pACasN and pDCRH was 13/16 and 4/16, respectively.

2.4. Assessment of the Degradation Capacity of OPs in the X1T-ΔopdB Strain

The degradation of 20 mg/L of eight kinds of OPs was assessed separately in the strains of X1T and X1T-ΔopdB. It was found that eight kinds of OPs could be degraded and detected in 24 h by the X1T strain as compared to the negative control (Table 1). On the other hand, the X1T-ΔopdB strain was unable to degrade these OPs as compared to the positive control of the X1T strain, suggesting that the X1T-ΔopdB strain lost its functionality for degrading OPs. One-way ANOVA was used to compare the changes of eight kinds of organophosphorus insecticides residuals before and after the treatments of the strains of X1T and X1T-ΔopdB. There was no significant difference when the significance level exceeded 5%. Different letters indicate significant differences between organophosphorus insecticides. The results demonstrate that the degradation of OPs was influenced by the OpdB gene in the X1T strain.

3. Discussion

In this study, we report the development of the CRISPR/Cas9, an adaptive immune system from bacteria and archaea, has been widely used in genome editing in various species [28,29,42]. However, the expression of Cas9 proteins is highly toxic, which may limit the possibility of easy transformation and the success of genome editing in various bacteria [43]. In our experiments, the X1T strain with pACasN had stable characteristics that could be steadily inherited. This was enough to enable us to obtain desirable mutations and when two plasmids were transformed into the X1T strain. Meanwhile, the efficiency of genome editing can be improved by using a λ-Red recombination system [34]. The genes associated with proteins of Red recombination and the Cas9 nuclease expressed in the X1T strain were first installed into a plasmid. From the experience of others to achieve a successful editing by expressing proteins before being prepared as the electrocompetent cells [33,44], we failed to isolate mutants of strain X1T. Maybe the proteins of Red recombination and Cas9 nuclease are toxic that cannot exist in the X1T strain for a long time. Therefore, we adopted the method of inducing proteins expression after the electroporation of two plasmids. Besides, the choices of highly efficient sgRNAs and the repair template length might have an impact on the efficiency of genome editing. Although there are many computational resources that can be used to design specific sgRNAs and predict off-target effects, their efficiency cannot be confirmed. When a single sgRNA was used, the genome editing efficiency was evaluated in the context of the same number of transformants, as well as dual sgRNAs [25,26,27]. We used the CRISPR/Cas9 system in combination with a dual-sgRNA approach to target a gene simultaneously, which resulted in a loss of gene function and a minimization of possible off-target activity [26]. In addition, it was found there was no NHEJ repair mechanism in the X1T strain via PCR screening and sequencing analysis. Besides, we should take the experimental selection of promoters for the expression of the Cas9 nuclease and the sgRNA into consideration, so as to improve the deletion efficiency by more than 50% [45]. More detailed research will be carried out in further experiments.
It was previously reported that the X1T strain is well known to have a great ability to degrade eight kinds of organophosphorus insecticides [40,41,46]. Organophosphate pesticides (OPs) can be degraded by various enzymes expressed in micro-organisms and mammals, including OP acid anhydrolase (OPAA) from rabbit tissue samples, OP-degrading hydrolases (OPHs) such as phosphotriesterase (PTE) and organophosphorus degradation enzyme (OPD), methyl parathion hydrolase (MPH) and glycerophosphodiesterase (GpdQ) from soil-dwelling microorganisms [47]. OpdB is a member of the novel subclass of OPD. The domain analyzed that OpdB has a hydrolase domain and its sequence identity with OPD was 52%. Both crude and purified OpdB enzymes were capable of degrading OPs [40,41]. The mechanisms of several OPs from eight kinds of organophosphorus insecticides were previously researched in the X1T strain [40]. Due to the hydrolysis reaction of the initial step of the OPs in the X1T strain, the opdB gene encoding OP hydrolase was found and identified through metabolite structure analysis of OPs [40]. Furthermore, the phenomenon of the knockout of the opdB gene in strain X1T hindered the degradation of eight OPs, which further demonstrated that the opdB gene played an indispensable role. The results indicated that the CRISPR/Cas9 is an attractive and powerful tool that can replace the classical gene knockout methods in Cupriavidus species. We believe that the two-plasmid system will be more widely adopted for further meaningful research.

4. Material and Methods

4.1. Strains and Plasmids

The strains and plasmids used in this study are listed in Table 2. The optimal growth conditions for the X1T strain and all E. coli strains were Luria–Bertani medium at 37 °C.
The complete genome sequences of the X1T strain were previously sequenced and uploaded to GenBank database with the accession numbers of CP014844, CP014845 and CP014846.

4.2. Culture and Reagents

Ampicillin (50 μg/mL), tetracycline (100 μg/mL) and neomycin (50 μg/mL) were added as needed. The MSM medium contained 1.0 g/L NaCl, 0.1 g/L MgSO4·7H2O, 0.3 g/L KH2PO4 and 1.32 g/L K2HPO4. Standard samples of profenofos (purity 98.0%), chlorpyrifos (purity 99.6%), methyl parathion (purity 99.5%), parathion (purity 99.5%), triazophos (purity 96.13%), phoxim (purity 99.5%), fenitrothion (purity 99.5%) and isocarbophos (purity 99.0%) were all purchased from Dr. Ehrenstorfer (Augsburg, Germany).

4.3. Construction of the Prokaryotic Expression Vector

The sequence of primers used in this study is listed in Table A1. The sequence and target sites of sgRNAs used in this study are listed in Table A2. The construction of the pACasN plasmid was performed by using the following method. The cas9 gene was amplified from the pCas9 plasmid as previously reported [48]. The araB promoter (ParaB) and Red recombination system were amplified from pKD20 [49]. All of the above DNA fragments were reconstructed into the EcoRI/HindIII sites in a pDN19 plasmid with a T7 RNA polymerase promoter by using Gibson assembly [50]. The sacB gene, a widely used counter-selectable marker amplified from the pALB2 plasmid, was inserted into the ApaLI/XhoI sites of the preceding plasmid after editing [51]. The pACasN plasmid was constituted by these DNA fragments.
The pDCRH plasmid was constructed by using the following method. In the first step, a strong E. coli promoter (str) with the sgRNA and sacB gene was inserted into the KpnI/HindIII sites of the broad-host-range plasmid vector pAK1900 [52]. Then, a neomycin resistance cassette from pAK405 was inserted into the SaiI site [53]. The resulting plasmid was named pDCRH. Two plasmids were then transformed into E. coli DH5α competent strains and stored at −80 °C.
The sgRNAs were designed by the CRISPOR design tool (http://crispor.tefor.net/ accessed on May 13th, 2022) without genomic alterations when analyzing the predicted off-targets in the X1T strain [54]. The pDCRH plasmid that contained dual sgRNAs was constructed as described subsequently. Two oligonucleotides containing the dual-sgRNA arrays in the target gene of the X1T strain were synthesized by Sangon Biotech (Sangon, Shanghai, China). Then, phosphorylation of oligos was carried out as follows: 5 μL 10 × T4 DNA ligase buffer (Takara, Kusatsu, Japan), 2 μL of dsgRNA-F, 2 μL of dsgRNA-R, 1 μL of T4 polynucleotide kinase (Takara), and 40 μL of ddH2O were added, followed by incubation at 37 °C for 1 h. Next, 2 μL of 1 M NaCl was added to the aforementioned mixed samples. Annealing procedures were performed as follows: 95 °C for 5 min; 95 °C for 30 s; 85 °C for 30 s, repeating 30 cycles and each cycle down by 2 degrees; 25 °C for 1 min, repeating 10 cycles and each cycle down by 0.1 degrees. The last solution was diluted 20-fold and stored at 4 °C. The pDCRH-spacer plasmid was constructed by inserting the dual sgRNA into the BsaI site of pDCRH via Golden Gate assembly. The samples were mixed as follows: 1 μL of annealed oligos, 1 μL of pDCRH plasmid, 1 μL of T4 DNA ligase, 1 μL of 10 × T4 DNA ligase buffer, 1 μL of BsaI-HF, and 5 μL of ddH2O. The reaction protocol was carried out in a thermal cycler at 37 °C for 3 min, 16 °C for 4 min, repeating 30 cycles, enzymes were inactivated at 65 °C for 15 min and slowly cooled down to 4 °C. The Golden Gate assembly product was transferred into 50 μL of E. coli DH5α competent cells. The cells were recovered in LB medium for 2 h at 37 °C and plated on an agar plate containing 50 μg/mL neomycin. The colonies were identified by PCR and sequencing.
The 600 bp DNA sequences of the upstream and downstream from the opdB gene were amplified from the X1T strain by PCR. The PCR amplification was performed as follows: 95 °C for 3 min; 95 °C for 15 s, 58 °C for 15 s and 72 °C for 1.5 min, which was repeated for 34 cycles, followed by a final extension of 5 min at 72 °C and stored at 4 °C finally. The pDCRH-ΔUD plasmid was obtained by digesting the pDCRH-spacer plasmid with XbaI and XhoI endonucleases. The pDCRH-UD plasmid was constructed by inserting two homologous arms into the digested pDCRH-spacer plasmid through Gibson assembly. The steps of construction of pDCRH-UD followed the subsequent protocol. The reaction solution (1 μL upstream of the opdB gene, 1 μL downstream of the opdB gene, 5 μL of pDCRH-ΔUD plasmid, 3 μL of ddH2O, 10 μL of NEBuilder HiFi DNA Assembly Master Mix) was incubated at 50 °C for 30 min. The Gibson assembly product was transformed into 50 μL of E. coli DH5α competent cells. The cells were recovered in LB medium for 2 h at 37 °C and plated on an agar plate containing 50 μg/mL neomycin. The plasmid pDCRH assembled with the dual-sgRNA and homology arms was verified by PCR and sequencing.

4.4. Genome Editing

The competent cells of the X1T strain were prepared as follows. The strain was activated and cultured in 20% concentration of LB medium at 37 °C for 12 h. Then, a total of 1 mL of cells was added to another fresh LB medium and incubated in a rotary sharker at 37 °C until the optical density at 600 nm reached 0.5. The cells were harvested by centrifugation at 5000 rpm for 15 min at 4 °C. Cell sediment was collected and washed six times with sterile ice-cold 10% v/v glycerol. The obtained cells were suspended with 0.5 mL sterile ice-cold 10% v/v glycerol in the end. The mechanism of genome editing with the two-plasmid system via CRISPR/Cas9 is indicated in Figure 4. For electroporation, 90 μL of cells were mixed with 10 μL of pACasN series DNA at a concentration of 700 ng/μL and electroporation was performed in an ice-cold 2-mm Gene Pulser cuvette (Bio-Rad, Hercules, CA, USA) at 2.5 kV for 6 ms. Then, 500 μL of room-temperature LB medium was added and gently mixed. Cells were recovered at 30 °C for 3 h before being spread onto the LB plate (containing 100 mg/L tetracycline), and incubated at 30 °C for three days. Transformants were identified by PCR and sequencing. Next, a positive colony was picked from the plate and cultured in LB medium with a concentration of 20% at 30 °C until the optical density at 600 nm reached 0.5. The procedures for the preparation of X1T-pACasN competent cells were carried out according to the previous experimental methods. A total of 10 μL of pDCRH series DNA at a concentration of 700 ng/μL and 90 μL of X1T-pACasN competent cells were co-electroporated under the same circumstances. Cells were recovered at 30 °C for 3 h before being spread on the LB plate containing 100 mg/L tetracycline and 50 mg/L neomycin. Then, cells were incubated at 30 °C for eight days. Meanwhile, we attempted to perform Red induction by streaking the identified bacteria on LB plates containing L-arabinose (final concentration of 20 mM). Transformants were incubated at 30 °C for three days. The editing efficiency was calculated based on the number of mutant colonies divided by the number of colonies evaluated in the end.

4.5. Plasmid Curing

To cure the two-plasmid system after editing, the effects of sucrose concentration and incubation time were measured. Sucrose at a concentration of 6% w/v was chosen, and the incubation time was three days until the bacteria growth was evident. The identified bacteria were streaked onto LB plates containing tetracycline and neomycin and were cultured at 30 °C for 48 h. One colony from the X1T-ΔopdB strain containing pDCRH and pACasN was cultured in 2 mL of LB medium at 30 °C for 48 h. Then, 10 μL of cells were diluted 100× in fresh LB medium, and 100 μL of diluted culture was plated on the LB agar in the presence or absence of 6% w/v sucrose at 30 °C for 72 h. Sixteen colonies were randomly picked and streaked on three different LB plates with no antibiotics (culture collection, 100 μg/mL tetracycline, and 50 μg/mL neomycin). The efficiency of plasmid curing could be calculated by dividing the number of streaked colonies by the total number of colonies. The elimination of two plasmids was verified by bacteria solution PCR.

4.6. Degradation Experiments

The wild-type X1T strain was incubated in 100 mL LB medium at 37 °C and the mutant colony was cultured in the same conditions. Each overnight culture was diluted by 1:100 in 100 mL of adjustive LB medium and incubated at 37 °C for 8 h. The strains were harvested by centrifugation at 7000 rpm for 10 min and washed three times with MSM medium. Cultures were diluted to an OD600 of 0.6. Degradation experiments of 8 kinds of organophosphorus insecticides were performed in 25 mL glass tubes with secure tops. A total of 20% of the cells in 5 mL of culture were incubated in MSM at 37 °C. The samples were regularly sampled by adding 5 mL of acetonitrile to terminate the reaction and extract pesticides. The residuals of the OPs were measured via HPLC (Agilent 1260, Waldbronn, Germany) method previously reported [40].

5. Conclusions

This study first reported that the CRISPR/Cas9 coupled with Red homologous recombination can be used to perform genome editing in the genus Cupriavidus. The two-plasmid system is an efficient and accurate method to realize the specific manipulation of the genome in C. nantongensis X1T. The results showed that the editing efficiency was over 30%. The biodegradation experiments on OPs revealed that the opdB gene was responsible for the catabolism of OPs in the X1T strain. This method of using CRISPR/Cas9 in combination with the Red recombination system has laid the foundation for further research on Cupriavidus nantongensis X1T.

Author Contributions

Y.Z.: Data curation, Formal analysis, Writing Original draft preparation. Y.G.: Validation. S.L.: Validation. T.S.: Methodology. X.M.: Data curation. L.F.: Writing-Reviewing and Editing, Project administration. R.H.: Supervision, Project administration. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported in part by grants from the National Natural Science Foundation of China (31972314, 42207443), and High-level Talent Introduction Project of Anhui Agricultural University (rc522101).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors gratefully acknowledge Anhui Provincial Key Laboratory for Quality and Safety of Agri-Products, School of Resource & Environment, Anhui Agricultural University for the research facilities.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table
Table A1. Primers used in this study.
Table A1. Primers used in this study.
NameSequence (5′-3′)Purpose
OligosdsgRNA-Fgtgg ATTGAAGCCGTTCGCCCGGA
GGTCGCGGGCAAGTCGTATC		The dual sgRNA in CRISPR vector
dsgRNA-Raaac GATACGACTTGCCCGCGACC
TCCGGGCGAACGGCTTCAAT
T600-Ftgtccatacccatgg TCTAGA
TCCGAGTCCGCCAGGACAATGT		The upstream homology arm for opdB deletion
T600-Ractgaagaacttgaac
TGTTGTTTCCTTTGAATTTAGGAAAGG
B600-Fttcaaaggaaacaaca
GTTCAAGTTCTTCAGTTCGCTCC		The downstream homology arm for opdB deletion
B600-Rgggagtatgaaaagt CTCGAG
GTTTTCCCGCAAAGGAAACTCCGA
P1AGTAGAAACAGACGAAGAATCCATDetection of homology arms and sgRNA
P2TCTGAATGGCGGGAGTATGAAAAGT
opdB-FATGAAGACAAGCGTTCATCTCAGTTThe degradation gene of organophosphorus insecticides
opdB-RTTACTGTTGCAGAGCAGATGCCACA
Neo-FATGATTGAACAAGATGGATTGCANeomycin resistance gene in CRISPR vector
Neo-RTCAGAAGAACTCGTCAAGAAGGC
Cas9-FATGGATAAGAAATACTCAATAGGCTTAGExpression of Cas9 protein encoded by cas9 gene
Cas9-RTCAGTCACCTCCTAGCTGACTCAAA
Table
Table A2. The sequence and target sites of sgRNAs used in this study.
Table A2. The sequence and target sites of sgRNAs used in this study.
NameSequence (5′-3′)Position in an Original Plasmid pX1
SpacerssgRNA-188revATTGAAGCCGTTCGCCCGGA GGG7488–7466
sgRNA-1016fwGGTCGCGGGCAAGTCGTATC TGG8274–8296
Ijms 24 06003 g0a1 550
Figure A1. The deletion of the opdB gene in the X1T -ΔopdB strain was confirmed by Sanger sequencing.
Figure A1. The deletion of the opdB gene in the X1T -ΔopdB strain was confirmed by Sanger sequencing.
Ijms 24 06003 g0a1

References

  1. Vandamme, P.; Coenye, T. Taxonomy of the genus Cupriavidus: A tale of lost and found. Int. J. Syst. Evol. Microbiol. 2004, 54, 2285–2289. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Ray, J.; Waters, R.J.; Skerker, J.M.; Kuehl, J.V.; Price, M.N.; Huang, J.W.; Chakraborty, R.; Arkin, A.P.; Deutschbauer, A. Complete Genome Sequence of Cupriavidus basilensis 4G11, Isolated from the Oak Ridge Field Research Center Site. Genome Announc. 2015, 3, e00322-15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Poehlein, A.; Kusian, B.; Friedrich, B.; Daniel, R.; Bowien, B. Complete genome sequence of the type strain Cupriavidus necator N-1. J. Bacteriol. 2011, 193, 5017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Li, L.H.; Cai, L.; Zhang, T. Genome of Cupriavidus sp. HMR-1, a Heavy Metal-Resistant Bacterium. Genome Announc. 2013, 1, e00202-12. [Google Scholar] [CrossRef] [Green Version]
  5. Monsieurs, P.; Provoost, A.; Mijnendonckx, K.; Leys, N.; Gaudreau, C.; Houdt, R.V. Genome Sequence of Cupriavidus metallidurans Strain H1130, Isolated from an Invasive Human Infection. Genome Announc. 2013, 1, e00202-12. [Google Scholar] [CrossRef] [Green Version]
  6. Amadou, C.; Pascal, G.; Mangenot, S.; Glew, M.; Bontemps, C.; Capela, D.; Carrere, S.; Cruveiller, S.; Dossat, C.; Lajus, A.; et al. Genome sequence of the beta-rhizobium Cupriavidus taiwanensis and comparative genomics of rhizobia. Genome Res. 2008, 18, 1472–1483. [Google Scholar] [CrossRef] [Green Version]
  7. Monsieurs, P.; Mijnendonckx, K.; Provoost, A.; Venkateswaran, K.; Ott, C.M.; Leys, N.; Van Houdt, R. Genome Sequences of Cupriavidus metallidurans Strains NA1, NA4, and NE12, Isolated from Space Equipment. Genome Announc. 2014, 2, e00719-14. [Google Scholar] [CrossRef] [Green Version]
  8. Abbaszade, G.; Szabo, A.; Vajna, B.; Farkas, R.; Szabo, C.; Toth, E. Whole genome sequence analysis of Cupriavidus campinensis S14E4C, a heavy metal resistant bacterium. Mol. Biol. Rep. 2020, 47, 3973–3985. [Google Scholar] [CrossRef]
  9. AL-Nussairawi, M.; Risa, A.; Garai, E.; Varga, E.; Szabo, I.; Csenki-Bakos, Z.; Kriszt, B.; Cserhati, M. Mycotoxin Biodegradation Ability of the Cupriavidus Genus. Curr. Microbiol. 2020, 77, 2430–2440. [Google Scholar] [CrossRef]
  10. Butof, L.; Wiesemann, N.; Herzberg, M.; Altzschner, M.; Holleitner, A.; Reith, F.; Nies, D.H. Synergistic gold-copper detoxification at the core of gold biomineralisation in Cupriavidus metallidurans. Metallomics 2018, 10, 278–286. [Google Scholar] [CrossRef]
  11. Deshmukh, A.D.; Pawar, S.V.; Rathod, V.K. Ultrasound-assisted fermentative production of Polyhydroxybutyrate (PHB) in Cupriavidus necator. Chem. Eng. Process. Process Intensif. 2020, 153, 107923. [Google Scholar] [CrossRef]
  12. Tiwari, J.; Naoghare, P.; Sivanesan, S.; Bafana, A. Biodegradation and detoxification of chloronitroaromatic pollutant by Cupriavidus. Bioresour. Technol. 2017, 223, 184–191. [Google Scholar] [CrossRef]
  13. Lerch, T.Z.; Chenu, C.; Dignac, M.F.; Barriuso, E.; Mariotti, A. Biofilm vs. Planktonic Lifestyle: Consequences for Pesticide 2,4-D Metabolism by Cupriavidus necator JMP134. Front. Microbiol. 2017, 8, 904. [Google Scholar] [CrossRef]
  14. Min, J.; Xu, L.X.; Fang, S.Y.; Chen, W.W.; Hu, X.K. Microbial degradation kinetics and molecular mechanism of 2,6-dichloro-4-nitrophenol by a Cupriavidus strain. Environ. Pollut. 2020, 258, 113703. [Google Scholar] [CrossRef]
  15. Ledger, T.; Aceituno, F.; Gonzalez, B. 3-Chlorobenzoate is taken up by a chromosomally encoded transport system in Cupriavidus necator JMP134. Microbiology 2009, 155, 2757–2765. [Google Scholar] [CrossRef] [Green Version]
  16. Min, J.; Chen, W.W.; Hu, X.K. Biodegradation of 2,6-dibromo-4-nitrophenol by Cupriavidus sp. strain CNP-8: Kinetics, pathway, genetic and biochemical characterization. J. Hazard. Mater. 2019, 361, 10–18. [Google Scholar] [CrossRef]
  17. Basu, S.; Pal Chowdhury, P.; Deb, S.; Dutta, T.K. Degradation Pathways of 2- and 4-Nitrobenzoates in Cupriavidus sp. Strain ST-14 and Construction of a Recombinant Strain, ST-14::3NBA, Capable of Degrading 3-Nitrobenzoate. Appl. Environ. Microbiol. 2016, 82, 4253–4263. [Google Scholar] [CrossRef] [Green Version]
  18. Min, J.; Chen, W.W.; Wang, J.P.; Hu, X.K. Genetic and Biochemical Characterization of 2-Chloro-5-Nitrophenol Degradation in a Newly Isolated Bacterium, Cupriavidus sp. Strain CNP-8. Front. Microbiol. 2017, 8, 1778. [Google Scholar] [CrossRef]
  19. Arenas-Lopez, C.; Locker, J.; Orol, D.; Walter, F.; Busche, T.; Kalinowski, J.; Minton, N.P.; Kovacs, K.; Winzer, K. The genetic basis of 3-hydroxypropanoate metabolism in Cupriavidus necator H16. Biotechnol. Biofuels 2019, 12, 150. [Google Scholar] [CrossRef] [Green Version]
  20. Horvath, P.; Barrangou, R. CRISPR/Cas, the Immune System of Bacteria and Archaea. Science 2010, 327, 167–170. [Google Scholar] [CrossRef] [Green Version]
  21. Dalvie, N.C.; Lorgeree, T.; Biedermann, A.M.; Love, K.R.; Love, J.C. Simplified Gene Knockout by CRISPR-Cas9-Induced Homologous Recombination. ACS Synth. Biol. 2022, 11, 497–501. [Google Scholar] [CrossRef] [PubMed]
  22. Wood, A.J.; Lo, T.W.; Zeitler, B.; Pickle, C.S.; Ralston, E.J.; Lee, A.H.; Amora, R.; Miller, J.C.; Leung, E.; Meng, X.D.; et al. Targeted Genome Editing Across Species Using ZFNs and TALENs. Science 2011, 333, 307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Deltcheva, E.; Chylinski, K.; Sharma, C.M.; Gonzales, K.; Chao, Y.; Pirzada, Z.A.; Eckert, M.R.; Vogel, J.; Charpentier, E. CRISPR RNA maturation by trans -encoded small RNA and host factor RNase III. Nature 2011, 471, 602–607. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Charpentier, E.; Doudna, J.A.; Charpentier, E. A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef]
  25. Chen, X.Y.; Xu, F.; Zhu, C.M.; Ji, J.J.; Zhou, X.F.; Feng, X.Z.; Guang, S.H. Dual sgRNA-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis elegans. Sci. Rep. 2014, 4, 7581. [Google Scholar] [CrossRef] [Green Version]
  26. Pauwels, L.; De Clercq, R.; Goossens, J.; Inigo, S.; Williams, C.; Ron, M.; Britt, A.; Goossens, A. A Dual sgRNA Approach for Functional Genomics in Arabidopsis thaliana. G3 Genes Genomes Genet. 2018, 8, 2603–2615. [Google Scholar]
  27. Wang, L.; Xu, F.; Wang, G.S.; Wang, X.R.; Liang, A.J.; Huang, H.F.; Sun, F. C30F12.4 influences oogenesis, fat metabolism, and lifespan in C. elegans. Protein Cell 2016, 7, 714–721. [Google Scholar] [CrossRef] [Green Version]
  28. Oh, J.H.; van Pijkeren, J.P. CRISPR–Cas9-assisted recombineering in Lactobacillus reuteri. Nucleic Acids Res. 2014, 42, e131. [Google Scholar] [CrossRef]
  29. Cobb, R.E.; Wang, Y.J.; Zhao, H.M. High-Efficiency Multiplex Genome Editing of Streptomyces Species Using an Engineered CRISPR/Cas System. ACS Synth. Biol. 2015, 4, 723–728. [Google Scholar] [CrossRef] [Green Version]
  30. Wang, Y.; Zhang, Z.T.; Seo, S.O.; Choi, K.; Lu, T.; Jin, Y.S.; Blaschek, H.P. Markerless chromosomal gene deletion in Clostridium beijerinckii using CRISPR/Cas9 system. J. Biotechnol. 2015, 200, 1–5. [Google Scholar] [CrossRef] [Green Version]
  31. Shuman, S.; Glickman, M.S. Bacterial DNA repair by non-homologous end joining. Nat. Rev. Microbiol. 2007, 5, 852–861. [Google Scholar] [CrossRef]
  32. Cui, L.; Bikard, D. Consequences of Cas9 cleavage in the chromosome of Escherichia coli. Nucleic Acids Res. 2016, 44, 4243–4251. [Google Scholar] [CrossRef] [Green Version]
  33. Jiang, Y.; Chen, B.; Duan, C.L.; Sun, B.B.; Yang, J.J.; Yang, S. Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. Appl. Environ. Microbiol. 2015, 81, 2506–2514. [Google Scholar] [CrossRef] [Green Version]
  34. Yu, D.G.; Ellis, H.M.; Lee, E.C.; Jenkins, N.A.; Copeland, N.G.; Court, D.L. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. USA 2000, 97, 5978–5983. [Google Scholar] [CrossRef] [Green Version]
  35. Mosberg, J.A.; Gregg, C.J.; Lajoie, M.J.; Wang, H.H.; Church, G.M. Improving Lambda Red Genome Engineering in Escherichia coli via Rational Removal of Endogenous Nucleases. PLoS ONE 2012, 7, e44638. [Google Scholar] [CrossRef] [Green Version]
  36. Thomason, L.C.; Costantino, N.; Shaw, D.V.; Court, D.L. Multicopy Plasmid Modification with Phage lambda Red Recombineering. Plasmid 2007, 58, 148–158. [Google Scholar] [CrossRef] [Green Version]
  37. Murphy, K.C. Use of Bacteriophage λ Recombination Functions To Promote Gene Replacement in Escherichia coli. J. Bacteriol. 1998, 180, 2063–2071. [Google Scholar] [CrossRef] [Green Version]
  38. Takahashi, N.; Kobayashi, I. Evidence for the double-strand break repair model of bacteriophage λ recombination. Proc. Natl. Acad. Sci. USA 1990, 87, 2790–2794. [Google Scholar] [CrossRef] [Green Version]
  39. Fang, L.C.; Chen, Y.F.; Zhou, Y.L.; Wang, D.S.; Sun, L.N.; Tang, X.Y.; Hua, R.M. Complete genome sequence of a novel chlorpyrifos degrading bacterium, Cupriavidus nantongensis X1. J. Biotechnol. 2016, 227, 1–2. [Google Scholar] [CrossRef] [PubMed]
  40. Shi, T.Z.; Fang, L.C.; Qin, H.; Wu, X.W.; Li, Q.X.; Hua, R.M. Minute-Speed Biodegradation of Organophosphorus Insecticides by Cupriavidus nantongensis X1T. J. Agric. Food Chem. 2019, 67, 13558–13567. [Google Scholar] [CrossRef]
  41. Fang, L.C.; Shi, Q.Y.; Xu, L.Y.; Shi, T.Z.; Wu, X.W.; Li, Q.X.; Hua, R.M. Enantioselective Uptake Determines Degradation Selectivity of Chiral Profenofos in Cupriavidus nantongensis X1T. J. Agric. Food Chem. 2020, 68, 6493–6501. [Google Scholar] [CrossRef] [PubMed]
  42. Altenbuchner, J. Editing of the Bacillus subtilis Genome by the CRISPR-Cas9 System. Appl. Environ. Microbiol. 2016, 82, 5421–5427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Wang, Y.; Zhang, Z.T.; Seo, S.O.; Lynn, P.; Lu, T.; Jin, Y.S.; Blaschek, H.P. Bacterial Genome Editing with CRISPR-Cas9: Deletion, Integration, Single Nucleotide Modification, and Desirable “Clean” Mutant Selection in Clostridium beijerinckii as an Example. ACS Synth. Biol. 2016, 5, 721–732. [Google Scholar] [CrossRef] [PubMed]
  44. Pyne, M.E.; Moo-Young, M.; Chung, D.A.; Chou, C.P. Coupling the CRISPR/Cas9 System with Lambda Red Recombineering Enables Simplified Chromosomal Gene Replacement in Escherichia coli. Appl. Environ. Microbiol. 2015, 81, 5103–5114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Huang, H.; Chai, C.; Li, N.; Rowe, P.; Minton, N.P.; Yang, S.; Jiang, W.; Gu, Y. CRISPR/Cas9-Based Efficient Genome Editing in Clostridium ljungdahlii, an Autotrophic Gas-Fermenting Bacterium. ACS Synth. Biol. 2016, 5, 1355–1361. [Google Scholar] [CrossRef]
  46. Fang, L.C.; Xu, L.Y.; Zhang, N.; Shi, Q.Y.; Shi, T.Z.; Ma, X.; Wu, X.W.; Li, Q.X.; Hua, R.M. Enantioselective degradation of the organophosphorus insecticide isocarbophos in Cupriavidus nantongensis X1T: Characteristics, enantioselective regulation, degradation pathways, and toxicity assessment. J. Hazard. Mater. 2021, 417, 126024. [Google Scholar] [CrossRef]
  47. Schenk, G.; Mateen, I.; Ng, T.-K.; Pedroso, M.M.; Mitić, N.; Jafelicci, M.; Marques, R.F.C.; Gahan, L.R.; Ollis, D.L. Organophosphate-degrading metallohydrolases: Structure and function of potent catalysts for applications in bioremediation. Coord. Chem. Rev. 2016, 317, 122–131. [Google Scholar] [CrossRef] [Green Version]
  48. Jiang, W.; Bikard, D.; Cox, D.; Zhang, F.; Marraffini, L.A. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 2013, 31, 233–239. [Google Scholar] [CrossRef] [Green Version]
  49. Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [Green Version]
  50. Li, K.W.; Xu, C.; Jin, Y.X.; Sun, Z.Y.; Liu, C.; Shi, J.; Chen, G.K.; Chen, R.H.; Jin, S.G.; Wu, W. SuhB is a regulator of multiple virulence genes and essential for pathogenesis of Pseudomonas aeruginosa. mBio 2013, 4, e00419-13. [Google Scholar] [CrossRef] [Green Version]
  51. Schweizer, H.P.; Hoang, T.T. An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene 1995, 158, 15–22. [Google Scholar] [CrossRef]
  52. Lightfoot, J.; Lam, J.S. Chromosomal mapping, expression and synthesis of lipopolysaccharide in Pseudomonas aeruginosa: A role for guanosine diphospho (GDP)-D-mannose. Mol. Microbiol. 1993, 8, 771–782. [Google Scholar] [CrossRef]
  53. Kaczmarczyk, A.; Vorholt, J.A.; Francez-Charlot, A. Markerless gene deletion system for sphingomonads. Appl. Environ. Microbiol. 2012, 78, 3774–3777. [Google Scholar] [CrossRef] [Green Version]
  54. Concordet, J.P.; Haeussler, M. CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res. 2018, 46, W242–W245. [Google Scholar] [CrossRef] [Green Version]
Ijms 24 06003 g001 550
Figure 1. The transformation of two plasmids into strain X1T was performed by using electroporation. (A) Maps of two plasmids of pACasN and pDCRH. araB, an inducible promoter driven by the L-arabinose; SacB, a counter-selectable marker used for plasmid curing after editing; Tet, a tetracycline-resistance marker in the X1T strain; trc, a strong promoter to express the dual sgRNA; BsaI, used as the spacers via Golden Gate assembly; XbaI and XhoI, used as the homologous repair arms via Gibson assembly; Neo, a neomycin-resistance marker in the X1T strain. (B) The plasmid pACasN (Left) was electroporated into the strain X1T. The plasmid pDCRH (Right) was electroporated into the strain X1T-pACasN. (C) The transformation efficiency of two plasmids was assessed by the number of colonies of strain X1T.
Figure 1. The transformation of two plasmids into strain X1T was performed by using electroporation. (A) Maps of two plasmids of pACasN and pDCRH. araB, an inducible promoter driven by the L-arabinose; SacB, a counter-selectable marker used for plasmid curing after editing; Tet, a tetracycline-resistance marker in the X1T strain; trc, a strong promoter to express the dual sgRNA; BsaI, used as the spacers via Golden Gate assembly; XbaI and XhoI, used as the homologous repair arms via Gibson assembly; Neo, a neomycin-resistance marker in the X1T strain. (B) The plasmid pACasN (Left) was electroporated into the strain X1T. The plasmid pDCRH (Right) was electroporated into the strain X1T-pACasN. (C) The transformation efficiency of two plasmids was assessed by the number of colonies of strain X1T.
Ijms 24 06003 g001
Ijms 24 06003 g002 550
Figure 2. The two-plasmid system enabled the deletion of opdB in the X1T strain. (A) Accurate repair of DSBs was performed by binding the entire homology repair arms and the dual sgRNA with primers P1/P2 in the pDCRH plasmid. The length was 1.4 kb. (B) Following electroporation of the pACasN plasmid, the 4.1-kb DNA fragment of the cas9 gene was identified by the primer pair Cas9-F/R in the X1T strain. (C) A marker gene of Neo (neomycin resistance gene) of pDCRH was amplified by colony PCR using the primer pair Neo-F/R in the X1T strain harboring two plasmids. (D) CRISPR/Cas9-based disruption of the opdB gene in the X1T strain with primers opdB-F/R. The WT is a positive control. The efficiency of knocking out opdB from Cupriavidus nantongensis X1T was 7/23. (E) Verification of the opdB gene knockout with primers T600-F/B600-R in the strains of X1T and X1T-ΔopdB after curing two plasmids. The length of the deleted gene of opdB was 1.5 kb.
Figure 2. The two-plasmid system enabled the deletion of opdB in the X1T strain. (A) Accurate repair of DSBs was performed by binding the entire homology repair arms and the dual sgRNA with primers P1/P2 in the pDCRH plasmid. The length was 1.4 kb. (B) Following electroporation of the pACasN plasmid, the 4.1-kb DNA fragment of the cas9 gene was identified by the primer pair Cas9-F/R in the X1T strain. (C) A marker gene of Neo (neomycin resistance gene) of pDCRH was amplified by colony PCR using the primer pair Neo-F/R in the X1T strain harboring two plasmids. (D) CRISPR/Cas9-based disruption of the opdB gene in the X1T strain with primers opdB-F/R. The WT is a positive control. The efficiency of knocking out opdB from Cupriavidus nantongensis X1T was 7/23. (E) Verification of the opdB gene knockout with primers T600-F/B600-R in the strains of X1T and X1T-ΔopdB after curing two plasmids. The length of the deleted gene of opdB was 1.5 kb.
Ijms 24 06003 g002
Ijms 24 06003 g003 550
Figure 3. The pACasN/pDCRH system can be easily cured after editing. (A) Fewer colonies were survived in 6% w/v sucrose at 30 °C for 72 h in the presence of 6% w/v sucrose (right) than that in the absence of sucrose (left). (B) The plasmid pACasN was cured with an efficiency of 13/16. The yellow numbers represent the number of colonies that did not grow on plates with tetracycline. (C) The plasmid pDCRH was cured with an efficiency of 4/16. The yellow numbers represent the number of colonies that did not grow on plates with neomycin.
Figure 3. The pACasN/pDCRH system can be easily cured after editing. (A) Fewer colonies were survived in 6% w/v sucrose at 30 °C for 72 h in the presence of 6% w/v sucrose (right) than that in the absence of sucrose (left). (B) The plasmid pACasN was cured with an efficiency of 13/16. The yellow numbers represent the number of colonies that did not grow on plates with tetracycline. (C) The plasmid pDCRH was cured with an efficiency of 4/16. The yellow numbers represent the number of colonies that did not grow on plates with neomycin.
Ijms 24 06003 g003
Ijms 24 06003 g004 550
Figure 4. The mechanism of genome editing with the two-plasmid system via CRISPR/Cas9.
Figure 4. The mechanism of genome editing with the two-plasmid system via CRISPR/Cas9.
Ijms 24 06003 g004
Table
Table 1. Degradation of eight kinds of OPs at the concentration of 20 mg/L by the strains of X1T and X1T-ΔopdB.
Table 1. Degradation of eight kinds of OPs at the concentration of 20 mg/L by the strains of X1T and X1T-ΔopdB.
OPsConcentration of OPs after 24 h of Treatment (mg/L)
ControlC. nantongensis X1TC. nantongensis X1T-ΔopdB
Profenofos17.1 ± 0.4 c9.7 ± 0.2 a17.7 ± 0.3 c
Chlorpyrifos19.1 ± 0.1 abND19.4 ± 0.4 ab
Methyl parathion19.6 ± 0.0 aND19.7 ± 0.4 a
Parathion18.7 ± 0.5 bND18.7 ± 0.1 b
Triazophos18.6 ± 0.2 b1.4 ± 0.1 c18.6 ± 0.2 b
Phoxim18.5 ± 0.4 b1.0 ± 0.0 d18.7 ± 0.3 b
Fenitrothion17.6 ± 0.4 cND17.0 ± 0.4 c
Isocarbophos14.2 ± 0.3 d6.2 ± 0.1 b14.0 ± 0.2 d
ND: cannot detected, meaning that the value was below the detection limit. Different letters: meaning significant differences among eight kinds of OPs (p ≤ 0.05).
Table
Table 2. The bacterial strains and plasmids used in this study.
Table 2. The bacterial strains and plasmids used in this study.
Strains and PlasmidsDescriptionSource
E. coli DH5αsupE44ΔlacU169 (φ80 lacZΔM15) hsdR17 recA1 end A1 gyrA96 thi-1 relA1Solarbio
pMD19-TAprTakara
Cupriavidus nantongensis X1Tan aerobic, Gram-negative, motile Proteobacterium that forms circular coloniesLab store
pCas9Cmr, bacterial expression of Cas9 nuclease; a temperature sensitive vector in E. coli for genome editingBioSci
pKD20the Red recombination system and the arabinose-inducible ParaB promoterBioSci
pDN19Tcr, the P. aeruginosa shuttle cloning vectorBioSci
pALB2Tcr, SacBBioSci
pAK1900Apr, broad-host-range cloning vectorBioSci
pAK405Plasmid for allelic exchange and seamless gene deletions; NmrBioSci
pACasNA shuttle vector; Tcr, SacB, Cas9 nuclease and the Red recombination systemThis study
pDCRHA shuttle vector; Nmr; SacBThis study
pDCRH-spacerThe pDCRH plasmid with the dual sgRNAThis study
pDCRH-ΔUDDigested pDCRH-spacer plasmidThis study
pDCRH-UDThe pDCRH plasmid with the dual sgRNA and homologous armsThis study
X1-pACasNTcrThis study
X1-ΔopdBThe opdB gene deleted in Cupriavidus nantongensis X1TThis study
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Geng, Y.; Li, S.; Shi, T.; Ma, X.; Hua, R.; Fang, L. Efficient Knocking Out of the Organophosphorus Insecticides Degradation Gene opdB in Cupriavidus nantongensis X1T via CRISPR/Cas9 with Red System. Int. J. Mol. Sci. 2023, 24, 6003. https://doi.org/10.3390/ijms24066003

AMA Style

Zhang Y, Geng Y, Li S, Shi T, Ma X, Hua R, Fang L. Efficient Knocking Out of the Organophosphorus Insecticides Degradation Gene opdB in Cupriavidus nantongensis X1T via CRISPR/Cas9 with Red System. International Journal of Molecular Sciences. 2023; 24(6):6003. https://doi.org/10.3390/ijms24066003

Chicago/Turabian Style

Zhang, Yufei, Yuehan Geng, Shengyang Li, Taozhong Shi, Xin Ma, Rimao Hua, and Liancheng Fang. 2023. "Efficient Knocking Out of the Organophosphorus Insecticides Degradation Gene opdB in Cupriavidus nantongensis X1T via CRISPR/Cas9 with Red System" International Journal of Molecular Sciences 24, no. 6: 6003. https://doi.org/10.3390/ijms24066003

APA Style

Zhang, Y., Geng, Y., Li, S., Shi, T., Ma, X., Hua, R., & Fang, L. (2023). Efficient Knocking Out of the Organophosphorus Insecticides Degradation Gene opdB in Cupriavidus nantongensis X1T via CRISPR/Cas9 with Red System. International Journal of Molecular Sciences, 24(6), 6003. https://doi.org/10.3390/ijms24066003

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop