Next Article in Journal
Hemodynamic and Clinical Profiles of Pulmonary Arterial Hypertension Patients with GDF2 and BMPR2 Variants
Previous Article in Journal
Skin Anti-Aging Potential through Whitening and Wrinkle Improvement Using Fermented Oil Derived from Hermetia illucens Larvae
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 5
10.3390/ijms25052733
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Analysis of the Liriodendron chinense Hsf Gene Family under Abiotic Stress and Characterization of the LcHsfA2a Gene

by
Yun Yang
1,2,
Jianchao Yin
1,2,
Liming Zhu
1,2,
Lin Xu
1,2,
Weihuang Wu
1,2,
Ye Lu
1,2,
Jinhui Chen
1,2,
Jisen Shi
1,2,* and
Zhaodong Hao
1,2,*
1
State Key Laboratory of Tree Genetics and Breeding, Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China
2
Key Laboratory of Forest Genetics and Biotechnology of Ministry of Education, Nanjing Forestry University, Nanjing 210037, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(5), 2733; https://doi.org/10.3390/ijms25052733
Submission received: 13 November 2023 / Revised: 18 February 2024 / Accepted: 21 February 2024 / Published: 27 February 2024
(This article belongs to the Section Molecular Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Heat shock factors (Hsfs) play a crucial role in plant defense processes. However, the distribution and functional characteristics of Hsf genes in the relict plant Liriodendron chinense are still unclear. In this study, a total of 19 LcHsfs were identified and divided into three separate subgroups, comprising 10 LcHsfA, 7 LcHsfB, and 2 LcHsfC genes, respectively, based on their phylogenetic tree and the presence/absence of conserved protein domains. Whole-genome duplication and segmental duplication led to an expansion of the LhHsf gene family. The promoters of LcHsf genes are enriched for different types of cis-acting elements, including hormone responsive and abiotic-stress-responsive elements. The expression of LcHsfA3, LcHsfA4b, LcHsfA5, LcHsfB1b, and LcHsfB2b increased significantly as a result of both cold and drought treatments. LcHsfA2a, LcHsfA2b, and LcHsfA7 act as important genes whose expression levels correlate strongly with the expression of the LcHsp70, LcHsp110, and LcAPX genes under heat stress. In addition, we found that transiently transformed 35S:LcHsfA2a seedlings showed significantly lower levels of hydrogen peroxide (H2O2) after heat stress and showed a stronger thermotolerance. This study sheds light on the possible functions of LcHsf genes under abiotic stress and identifies potentially useful genes to target for molecular breeding, in order to develop more stress-resistant varieties.

1. Introduction

Plants frequently encounter unfavorable growth conditions such as intense heat, cold, and drought during their life span. These stresses may severely limit the distribution of plants, alter their development, reduce productivity, and lead to male sterility [1,2]. In response to abiotic stress, plants have evolved multiple gene-regulatory mechanisms, involving stress sensing, signal transduction, transcriptional regulation, etc. Hsfs are at the core of the response systems, triggering the expression of heat shock proteins (Hsps) [3,4]. Therefore, it is essential to study Hsf genes in order to understand how plants respond to stress.
The Hsf gene was first described in yeast in 1988 [5]. To date, Hsf gene homologues have been identified in the genome of most plant species, such as in Physcomitrella patens (8 genes), Picea abies (19), Amborella trichopoda (12) [6], Oryza sativa (25) [7], Zea mays (31) [8], Brachypodium distachyon (24) [9], Vitis vinifera (19) [10], Arabidopsis thaliana (21) [11], Populus trichocarpa (30) [12], Malus domestica (25) [13], Capsicum annuum (25) [14], Fagopyrum tataricum (29) [15], Juglans regia (29) [16], and Camellia sinensis (25) [17]. The aforementioned plants are classified as bryophytes, gymnosperma, basal angiosperms, monocots, and dicots, providing abundantly diverse resources for the study of LcHsfs. Typically, plant Hsf proteins consist of a DNA binding domain (DBD), an oligomerization domain (OD), and a nuclear localization signal domain (NLS). The Hsf family can be categorized into three subtypes, HsfA, HsfB, and HsfC, according to the characteristics of the OD [9]. Generally, HsfA proteins possess an activation domain (AHA), while HsfB proteins contain a repressor domain (RD) [18]. In Arabidopsis, HsfA have been shown to be transcriptional activators, while a number of HsfB transcription factors are likely to be transcriptional inhibitors [19].
Hsfs have been reported to play important roles in response to various stresses [20,21]. For example, the AtHsfA1a, AtHsfA1b, AtHsfA1d, and AtHsfA1e genes contribute to basal thermotolerance and also initiate the heat-stress response [22]. By contrast, cucumber (Cucumis sativus) CsHsfA1d knockdown lines are sensitive to cold stress [21]. Over-expression of AtHsfA2 increases tolerance to heat, salt, osmotic stress, and high light intensity in transgenic Arabidopsis [23]. AtHsfA3 expression is induced by a dehydration-responsive element-binding protein 2A (DREB2A) under heat stress [24]. Over-expression of HsfA4a increases salt tolerance and reduces H2O2 accumulation in transgenic plants [25]. Expression of AtHsfA6a is strongly induced by exogenous abscisic acid (ABA) [26]. The AtHsfA8 transcription factor (TF) is activated by H2O2 stimulation in protoplasts [27]. The TFs AtHsfB1 and AtHsfB2 repress the expression of heat-inducible Hsfs [19]. Hsfs have been well studied in model plants [12,17], but there have so far been few reports on their function in woody plants.
Liriodendron is an ancient relict plant, which belongs to the Liriodendron genus of the Magnoliaceae [28]. The Liriodendron genus consists of two distinct species: one East Asian species (L. chinense (Hemsley) Sargent) and one eastern North American (L. tulipifera Linn). A Liriodendron hybrid has been cultivated through the intraspecific hybridization between the aforementioned L. chinense and L. tulipifera [28]. It is used as a landscape tree species due to its unique leaf shape, gorgeous-looking flowers, and straight trunk. The Liriodendron hybrid was furthermore developed because of its excellent wood quality and fast growth [29]. However, as a perennial species, Liriodendron needs to adapt to seasonal variations and short-term environmental stresses. Liriodendron can tolerate mild drought and high temperatures. In sustained temperatures of 38 °C or higher, leaves may exhibit heat-damage symptoms, such as curling, yellowing, or even falling off. The Liriodendron genome sequence provides a foundation for molecular breeding strategies aiming to improve stress resistance [28]. In previous studies, the expression of LcWYRK, LcCKX (cytokinin oxidase/dehydrogenase), and LcSOD (superoxide dismutase) gene families were analyzed under various abiotic stresses [29,30,31]. However, a detailed study on the LcHsf genes family has not yet been reported and their transcriptional regulatory mechanism therefore remains to be elucidated.
The aim of this study is to identify the Hsf gene family in the Liriodendron genome and to analyze the characteristics of these genes. Phylogeny, a conserved domain and motif analysis, as well as gene duplication and synteny analysis, were all performed. To elucidate the function of LhHsf genes, their expression patterns in different tissues and under abiotic stresses were determined. Using these data, we constructed an inter relatedness model between LcHsf, LcHsp70, and redox genes in response to heat stress. Further comparative analyses, such as promoter cis-element characterization, yielded a comprehensive understanding of the origin and evolution of the Hsf genes in L. chinense. This study provides insight into the function of LcHsf in abiotic stress and the important genetic resources for the formulation of stress resistance breeding strategies in the future.

2. Results

2.1. Identification and Chromosomal Location of the L. chinense Hsf Gene Family

A total of 19 putative LcHsf family members were identified in the L. chinense genome and named according to their homologous Hsfs genes from Arabidopsis. We describe a number of basic characteristics of the LcHsf proteins in Table 1. Their amino acid lengths range between 193 and 514, with molecular weights (MWs) ranging from 22.36 kDa to 56.98 kDa, and theoretical isoelectric points (pIs) from 4.75 to 9.51. All LcHsfs are predicted to be localized in the nucleus. The 19 LcHsf gene locations are unevenly distributed across 11 chromosomes of L. chinense (Figure 1a). To further understand the LcHsf family, the gene structure of its members was analyzed (Figure 1b). The LcHsf gene size varies from 921 bp (HsfC1b, Lchi08814) to 17,660 bp (HsfA1a, Lchi08322). Their coding sequences (CDSs) are similar in length, but intron length varies greatly among the three groups.

2.2. Phylogenetic Analysis of Hsf Proteins

To evaluate the phylogenetic relationships within the Hsf family, we constructed a hierarchical cluster tree using the full-length protein sequences of five species, including L. chinense (Lc), A. trichopoda (AmTr), O. sativa (Os), V. vinifera (Vv,), and A. thaliana (At). All the Hsf proteins are divided into group A and group B, while group C and subgroup A3 cluster together (Figure 2). Among the 19 LcHsf members, 10 belong to the LcHsfA group and are relatively evenly distributed among subgroups A1–A8. There are seven members in the LcHsfB group and two members in the LcHsfC group. A total of 12 LcHsf proteins cluster in one group with AtHsf and VvHsf, while four LcHsf members are most closely related to their homologues from A. trichopoda: LcHsfA5, LcHsfB1b, LcHsfB2a, and LcHsfB5.

2.3. Conserved Domain and Protein Motif Analysis of LcHsf Subfamilies

All LcHsfs protein sequences contain a conserved DBD domain with an α1-β1-β2-α2-α3-β3-β4 structure, an OD domain, and an NLS domain (Figure 3a, Table 2). The LcHsf NLS domain has a typical sequence feature: NRR 5aa KKRR, RKRRLP, or KKRR. The nine LcHsfA proteins include an AHA domain, together with a nuclear export signal domain (NES). The LcHsfA AHA domains have characteristic amino acid residues (F, W), (I, L), and (E, D) at their C-terminus. For example, LcHsfA1a has an AHA domain with the sequence of “DSFWEQFLSA” (the underlines show the characteristic motifs of the domain and the following underlines are the same). The NES region of LcHsfA is rich in leucine; LcHsfB4, for example, has the typical NES sequence of “VLRKEDLGLNL” at its C-terminus. A hydrophobic, frequently leucine-rich NES at the C-terminus of Hsfs is required for the receptor-mediated nuclear export in complex with the NES receptor. Out of the six LcHsfB proteins, five possess an RD domain (the repressor structure -LFGV-), with the only exception of LcHsfB5. By contrast, the two LcHsfC members do not possess any domains in addition to the three domains shared by all LcHsf proteins (Table 2).
To better understand their protein structure, we searched for conserved motifs across all LcHsf proteins resulting in 10 individual identified protein motifs (Figure 3b). The majority of the LcHsf proteins contain motifs 1, 2, and 3 at their N-terminus. This can be attributed to the DBD domain being located near the N-terminus of all LcHsfs [9]. LcHsfA1b does not contain motifs 1 and 3, LcHsfA5 does not contain motif 2, while LcHsfC1b does not contain motif 3 due to the absence of several amino acids or the presence of a single nucleotide polymorphism site. Most LcHsfA proteins contain motifs 7, 8, and 9. On the contrary, LcHsfB proteins contain motif 5 at their C-terminus. As expected, more closely related proteins from the L. chinense phylogenetic tree have a similar motif composition.

2.4. LcHsf Gene Duplication and Synteny Analysis

To determine the extent of expansion of LcHsf genes in L. chinense, we performed intra-species synteny analysis (Figure 4a) and found six gene pairs. Next, we searched for LcHsf gene duplication events. First, we could find no tandem repeat events within the LcHsf family. Second, according to MCscanX classification results, 12 out of the 19 LcHsf family members might have originated from whole-genome duplication (WGD) or segmental duplication events (Table S1). This finding suggests that the LcHsf family has expanded by WGD or segmental duplication.
Since neofunctionalization of duplicated genes frequently is the result of natural selection pressure, we calculated Ka/Ks values (a non-synonymous/synonymous substitution ratio; Table 3). The Ka/Ks values of six LcHsf gene pairs were all less than 1. In addition, the Ka/Ks values of most of the L. chinense gene pairs are less than 1. The results are shown in Table S2 and Figure S1. To further explore the evolution of LcHsf gene families, we performed an interspecies synteny analysis of L. chinense, O. sativa, V. vinifera, and A. thaliana. These data show that there are 13 collinear gene pairs between O. sativa and L. chinense, 20 gene pairs between L. chinense and V. vinifera, and 18 gene pairs between L. chinense and A. thaliana (Figure 4b). These results indicate a close relationship of the LcHsf genes to their V. vinifera homologues.

2.5. LcHsf Gene Promoter Cis-Element Analysis

Cis-regulatory elements in the promoter region provide specific transcriptional binding sites that affect gene expression. Therefore, we analyzed the presence of cis-acting elements. We found the LcHsf gene promoters to be enriched for various types of cis-acting elements (Figure 5 and Figure S4) and show a summary of all features in detail in the Supplementary Materials (Table S3). The first category of enriched elements is composed of hormone-responsive elements, including auxin responsive elements (TGA- and AuxRR-core elements), an abscisic acid responsive element (ABRE-element), methyl jasmonate (MeJA)-responsive elements (TGACG- and CGTCA-motifs), a salicylic acid responsive element (TCA-element), and gibberellin-responsive elements (a GARE-motif, TATC-box, and P-box). The second category is represented by abiotic stress response elements, including a heat stress responsive element (HSE-element), a drought-inducible element (MBS-element), a low-temperature-responsive element (LTR-element), a wound-responsive element (WUN-motif), and an anaerobically induced element (ARE-element). The third category is made up of plant-development-related elements, such as light-responsive elements (G-box, Box4, and GT), a meristem expression element (CAT-box), an endosperm expression element (GCN4_motif), and a seed-specific regulation element (RY-element). These results suggest that LcHsf genes might respond to different hormones and could be involved in various abiotic stresses responses as well as plant development.

2.6. Expression Profiling of Hsf Genes in Different Tissues of the Liriodendron Hybrid

To investigate the spatial expression patterns of LcHsf genes, their expression profiles were extracted from previously generated RNA-seq data. Most LcHsf genes were differentially expressed in vegetative and reproductive organs of Liriodendron (Figure 6). The LcHsf genes are actively expressed at their highest level on average in bud and bark tissue, followed by leaf and stigma tissue. By contrast, LcHsf genes are hardly expressed in the phloem and xylem. The LcHsf genes therefore demonstrate a tissue-specific expression pattern. LcHsfB4 is highly expressed in the stigma and LcHsfB3 is highly expressed in the stamen. These results suggest that the LcHsf genes are differentially regulated in different tissues.

2.7. LcHsf Genes Show Diversified Expression Patterns under Heat, Cold, and Drought Stress

To explore the possible role of LcHsf genes in response to various abiotic stresses, such as has been found in other plant species, Medicago sativa L. [32], Panicum virgatum L. [33], Arachis hypogaea L. [34], and Populus trichocarpa [12], we analyzed their expression patterns under heat, cold, and drought stress conditions (see Methods). We found that LcHsf A class (LcHsfA2a, LcHsfA2b, LcHsfA3, and LcHsfA7) and LcHsf B class (LcHsf B1b, LcHsf B2a, and LcHsf B2b) genes are highly expressed after one hour of heat treatment (Figure 7a). Supplementary Materials Figure S2 shows another heatmap of the LcHsf genes under heat stress, which was generated by the FPKM values directly.
Previous studies in poplar and Arabidopsis found that Hsf gene expression can be detected after 15 or 30 min of heat stress [12,35]. We used quantitative reverse transcriptase PCR (qRT-PCR) to more closely follow the expression of LcHsf genes in Liriodendron seedlings leaf tissue (using the 166302 genotype) subjected to heat stress for various durations (Figure 8). We examined the expressions of four highly responsive genes (LcHsfA2a, LcHsfA2b, LcHsfA7, and LcHsfB2b) following heat stress treatment for 15 min, 30 min, and 1 h. The data indicate that all four LcHsf genes showed a significant increase in expression after 15 min of high-temperature stress and showed slowly decreasing but still elevated expression in the following 30 min and 1 h. Therefore, these LcHsf genes can be induced by heat stress in a short period of time.
When testing the response to cold-stress treatment, we found three LcHsf genes (LcHsfA3, LcHsfA5, and LcHsfC1b) to be strongly induced after one day of treatment, while a further six LcHsf genes (LcHsfA4b, LcHsfB1a, LcHsfB1b, LcHsfB3, LcHsfB5, and LcHsfB2b) need three days to show strong upregulation (Figure 7b).
Drought treatment induced the expression of different LcHsf family members at subsequent time points (Figure 7c). LcHsfA2a, LcHsfA2b, and LcHsfA7 are upregulated after six hours of drought, while LcHsfA1a and LhHsfB1a show upregulation after twelve hours of drought. The majority of the LcHsf genes (LcHsfA3, LcHsfA4b, LcHsfA5, LcHsfA8, LcHsfB1b, LcHsfB2a, LcHsfB2b, and LcHSfC1a) require one day of drought treatment to show upregulation. Overall, these results show that most LcHsf genes respond vigorously to high-temperature stress at 40 °C, while their response to cold and drought stresses occurs in general at a slower pace.

2.8. Transcriptional Correlation Networks between LcHsf, LcHsp70, and Redox Genes

Hsf TFs are responsible for the main heat-stress signal transduction network and regulate the expression of Hsp70 genes [12]. Reactive oxygen species (ROS) act as signaling molecules that induce a heat-resistance mechanism and participate in the transduction network of Hsf/Hsp70 [4]. Therefore, it is useful to study a gene interaction model of Hsf, Hsp70, ROS, and ROS scavengers. We used the Pearson’s correlation method to evaluate the regulatory relationship among LcHsf, LcHsp70, and redox-related genes. We found that LcHsfA2a, LcHsfA2b, LcHsfA7, LcHsfB1a, LcHsfB2bC, and LcHsfB5 act as the important genes of this network (Figure 9). LcHsf expression is highly positively correlated with the expression of LcHsp70, LcHsp110, LcGPX, LcSOD1-1, and the LcAPX gene family. Furthermore, the LcHsp70 genes serve as nodes connecting LcHsfA1b, LcHsfA3, and LcHsfB1a to the core network.
To better see the co-expression of LcHsf, LcHsp70, and redox genes, the weighted gene co-expression network analysis (WGCN) was carried out. The blue4 module of WGCN analysis contains the most LcHsf genes (Table S4). The blue4 module contains a total of 331,421 genes (Table S5). The edges of LcHsf genes with genes in the blue4 module are shown in Table S6. The result showed that, in the blue4 module, the LcHsfB2b gene had the most edges, 78 edges, with other genes, and there was a common edge with SOD3; LcHsfA7 had the second most edges, 32 edges, with other genes, and there were no edges with LcHsp70 and redox-related genes; LcHsfA2b had 6 edges with other genes; LcHsfC1 had 5 edges with other genes; and LcHsfA2a had 3 edges with other genes. LcHsfA2b has 6 edges with other genes; LcHsfC1 has 5 edges with other genes; LcHsfA2a has 3 edges with other genes. The co-expression network is shown in Figure S3. These results would indicate that LcHsfB2b and LcHsfA7 may play significant roles. Combined with the gene expression patterns and qRT-PCR results, the LcHsfA2a gene is also likely to be a factor in the regulation of heat stress.

2.9. LcHsfA2a Might Be Involved in Heat-Stress Response

Due to the important role of HsfA2 in heat-stress response [14,36], we evaluated the possible functions of LcHsfA2a in thermotolerance. We amplified the coding region (CDS) of LcHsfA2a and cloned it following a 35S promoter (see Section 4.7). Liriodendron plants were transformed with both the empty vector pBI121 and 35S:LcHsfA2a-iGUS (β-glucuronidase gene, with introns). To identify transiently transformed plants, we performed a GUS staining and qRT-PCR analysis of LcHsfA2a gene expression. The plants transformed with an empty vector displayed GUS staining in both the stem and leaf, while 35S:LcHsfA2a-iGUS transiently transformed plants exhibited stronger staining in the leaf (Figure 10a). At 48 h after transformation, plants growing under normal conditions were subjected to heat treatments for 0 h and 1 h, after which gene expression was analyzed. The expression level of LcHsfA2a in 35S:LcHsfA2a-iGUS transiently transformed plants was three–four times that of empty-vector-transformed plants (Figure 10b). The expression of LcHsfA2a was increased after heat stress for 1 h in both control and 35S:LcHsfA2a-iGUS.
To further understand the function of LcHsfA2a in heat-stress response, transiently transformed plants were treated with heat stress for 3 h; after which, nitrotetrazolium blue chloride (NBT), 3, 3′-Diaminobenzidine (DAB), and Evan’s Blue staining were performed to detect the content of O2−, H2O2, and cell damage. After a 3 h heat treatment, NBT staining showed that the leaves of 35S:LcHsfA2a plants were light blue, while the leaves of empty-vector-transformed plants were damaged and appeared brown (Figure 11a). This shows that the superoxide radical (O2−) content after heat treatment is higher in 35S:LcHsfA2a leaves, resulting in a healthier leaf overall. DAB staining showed the 35S:LcHsfA2a leaves to have a lighter brownish color to the naked eye, in comparison to the empty vector leaves, which appeared a darker brown. This result indicated that the H2O2 level after heat treatment is lower in 35S:LcHsfA2a leaves than in empty vector leaves (Figure 11b).
An Evan’s blue staining found that both types of transiently transformed plants showed no apparent cell death before heat stress. After heat treatment for 3 h, cell death was reduced in leaves of 35S:LcHsfA2a transiently transformed plants (Figure 11c). In addition, the H2O2 content in 35S:LcHsfA2a transiently transformed plants was significantly lower after 3 h of heat stress (Figure 11d). This might be caused by overexpression of LcHsfA2a triggering the ROS scavenging system during the previous 48 h of transformation.

3. Discussion

The widely studied Hsf transcription factors are important regulators in heat-stress signal transduction pathways, and additionally play a role in the response to other abiotic stresses [37,38]. Until not, a genome-wide identification of the Hsf gene family in Liriodendron has not been published. Here, we report the classification, gene structure, promoter cis-acting elements and collinearity of LhHsf genes, as well as their expression patterns during abiotic stress response. In the current research, a total of 19 LhHsf genes were identified in the Liriodendron genome. Liriodendron has fewer Hsf gene members compared to previously studied monocot and dicot plants (Table S7). A recent study showed that the number of Hsf genes detected in higher plants was significantly higher than that in lower plants, based on the genome data of 103 higher plants and 8 lower plants [39]. For instance, the Arabidopsis thaliana genome possesses 21 Hsf genes. The Arabidopsis lineage underwent three rounds of WGD, two of which are assumed to have occurred approximately 60–70 and 23–43 Myr ago [40,41]. Since then, most gene duplicates have been lost. In addition, the soybean (Glycine max L.) genome contains 52 Hsf genes. The soybean lineage went through two rounds of WGD, which occurred approximately 59 and 13 Myr ago [42]. Compared to Arabidopsis and soybean, Liriodendron chinense experienced fewer and more ancient WGD events. An MCscanX classification indicated that 11 of the 19 LcHsf family members might originate from WGD or segmental duplication. It is generally believed that, after duplication events, some duplicated genes are removed from the genome due to random mutations and some are retained due to functional differentiation. This expansion of the LcHsf family has an adaptive effect on stress resistance in the process of continuous evolution.
Cis-acting regulatory elements are necessary for TF regulation and target gene expression. Our work shows that more than 90% of the LcHsf promoters contain abscisic acid responsive and auxin responsive elements, while nearly 85% contain Me-JA-responsive elements and over 50% contain gibberellin- and salicylic-acid-responsive elements. Furthermore, approximately 60% of the LcHsf promoters contain drought-inducible and low-temperature-responsive elements. These conclusions are similar to the findings of cis-acting regulatory elements on Hsfs family promoters in perennial ryegrass (Lolium perenne), common bean (Phaseolus vulgaris), and Tartary buckwheat (Fagopyrum tataricum) [15,43,44]. The ryegrass Hsf promoters also contain the same types of cis-elements, and five LpHsfs showed significantly differential expression patterns under various abiotic stresses [43]. A. thaliana HsfA8, HsfB2a, HsfB2b, and HsfC1 are all responsive to abscisic acid treatment [23,25,45,46,47]. Previous studies have confirmed that their key cis-acting elements are highly related to abiotic stress response elements in plants [48]. Importantly, one article reported that DREB2A can induce AtHsfA3 by binding to DRE elements in the AtHsf3A promoter under heat stress [24]. Supplementary Materials Figure S5 shows the TFs that bind to the Hsf promoter region from published reports. We are therefore intrigued whether the LcHsf promoter elements can similarly perform a corresponding response. Our results provide a basis for validating the function of cis-acting regulatory elements of LhHsfs.
In this study, LhHsf gene expression in response to high temperature, drought, and low temperature was analyzed using RNA-seq. During heat treatment, the expression of seven LcHsf genes (LcHsfA2a, LcHsfA2b, LcHsfA3, LcHsfA7, LcHsfB1b, LcHsfB2a, and LcHsfB2b) was significantly upregulated. The expression of these genes then gradually decreased after one hour, but these seven genes retained a continuous expression for at least three days. In comparison to this study, HsfA2, HsfA3, HsfA7, HsfB1, and HsfB2 were stimulated by heat stress in A. thaliana, wheat (Triticum aestivum L.), maize (Zea mays L.), and tomato (Solanum lycopersicum L.) [36,49,50,51,52]. Concerning cold and drought stress, the major LcHsf genes (LcHsfA4b, LcHsfA5, LcHsfA8, LcHsfB2a, and LcHsfB2b) were upregulated on the first and third day. Similarly, several articles reported that HsfA4a can be induced by osmotic stress. Malus domestica MdHSfA8 is activated under drought stress [53]. Interestingly, the heat-stress response (HSE-element), drought inducibility (MBS-element), and low-temperature response (LTR-element) were found in the LcHsfs promoters of genes responding to such stimuli. Of 19 LcHsf genes, 12 respond to a certain stress, and they also have corresponding element in their promoter (Table S8). These meaningful findings provide a reference for our research. And these results suggest that the majority of LhHsf genes might be involved in heat-, cold-, and drought-stress response regulation.
The Hsf family is phylogenetically divided into three subfamilies: HsfA, HsfB, and HsfC. The LcHsf TF family contains 10 LcHsfA, 7 LcHsfB, and 2 LcHsfC homologues. It is reported that, in comparison to HsfB and HsfC, HsfA TFs play a more important role in responding to high temperature by rapidly activating thermal-dormancy-related gene expression, thereby helping plants to adapt to high-temperature stress [16]. In contrast, HsfB and HsfC TFs are more easily induced under low temperatures or other environmental constraints. This is in line with our research. Most LcHsfA genes are strongly expressed under heat coercion compared to LcHsfB and LcHsfC homologues. During the first hour of thermal coercion, the expression of LcHsfA2a increased by a maximum of 684 times, followed by an increase of 107 times of LcHsfA7 and a 99-fold increase in LcHsfA2b. qRT-PCR results showed that the expression level of LcHsfA2a is significantly increased by 80-fold after 15 min of high-temperature stress, which is maintained for the following 1 h.
In addition, plant HsfA homologues are involved in a network of protein–protein interactions, which add considerable complexity to their biological function under heat stress [54]. Network analysis based on RNA-seq data revealed that the expression of LcHsfA TFs is highly positively correlated with the expression of cHsp70, LcHsp110, LcGPX, LcSOD1-1, and LcAPX gene families. LcHsfA2a is the central regulatory factor under heat stress, as was shown in previously published research. We therefore selected it for further gene functional verification studies. The 35S:LcHsfA2a transiently transformed seedlings displayed a H2O2 lower content after 3 h heat stress, implying that LcHsfA2a increases tolerance to heat stress in Liriodendron. In a previous study, it was shown that the expression abundance of AtHsfA2 is more strongly induced by heat stress than the other Hsf homologues [23,55]. Overexpression of AtHsfA2 resulted in significant accumulation of Hsp and ROS scavenging transcripts, such as galactinol synthase (GOLS1 and GOLS2) and APX1 [56]. These findings provided an excellent reference for analyzing the function of the LcHsfA2 gene. LcHsfA2a might play a significant role in thermal adaptation and could be adopted for Liriodendron molecular breeding to improve such traits.

4. Materials and Methods

4.1. The Identification of the L. chinense Hsf Family

The gDNA, CDS, and protein sequences of Liriodendron were downloaded from the genome database (https://ftp.cngb.org/pub/CNSA/data1/CNP0000295/CNS0044063/CNA0002404/) (accessed on 26 September 2021). Candidate LcHsf protein sequences were searched via HMMER software (V3.0, Janelia Farm, Ashburn, VA, USA) using the Hsf Pfam number (PF00447). BLASTN similarity searches were performed with a threshold E-value of less than 1.0. In addition, all LcHsf proteins obtained were analyzed to detect specific protein domains using the conserved domains database (CDD) program (https://www.ncbi.nlm.nih.gov/cdd/) (accessed on 25 February 2022) [57]. The Hsf protein DBD domain “seqlogos” map was generated using Weblogo program of TBtool software (V2.001, South China Agricultural University, Guangzhou, China) [58]. The NLS domain amino acid sequence was detected using NLStradamus [59]. Basic protein properties, including protein length, molecular weight, isoelectric point, and molecular weight were determined using the ExPasy website (https://www.expasy.org/) (accessed on 25 February 2022) [60]. Subcellular localization was predicted via the WoLF PSORT program (https://wolfpsort.hgc.jp/) (accessed on 25 February 2022).

4.2. Phylogenetic Analysis and Identification of Gene Structures, Conserved Motifs, and Cis-Acting Elements

A phylogenetic tree was constructed using Hsf protein sequences of Liriodendron chinense, Arabidopsis thaliana, Amborella trichopoda, Oryza sativa, and Vitis vinifera. Their sequence IDs are listed (Table S9) and the sequences were downloaded from The Arabidopsis Information Resource (TAIR), Plant Transcription Factor Database (PlantTFDB V5.0) (https://planttfdb.gao-lab.org/) (accessed on 10 March 2022) , and Phytozome databases (v13, the Plant Comparative Genomics portal of the Department of Energy’s Joint Genome Institute, Washington, DC, America), respectively. Multiple sequence alignment was performed using ClustalX (V2.1, University College Dublin, Dublin, Ireland) software. Phylogenetic analysis was performed using BEAST (V2.6.4, University of Auckland, Auckland, New Zealand) with previously reported settings [30]. The iTOL website was used to visualize the phylogenetic tree (https://itol.embl.de/) (accessed on 14 January 2023) [61]. The exon–intron structure of LcHsf genes was analyzed by TBtool software (V2.001). Protein motifs were obtained from the MEME website (https://meme-suite.org/meme/) (accessed on 27 August 2022). The 2000 bp sequences upstream of the LcHsf transcription start sites were extracted by TBtool software (V2.001). Cis-acting elements were predicted using PlantCARE (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/) (accessed on 4 March 2022) [62]. Analysis results were visualized using TBtool software (V2.001) [63].

4.3. LcHsf Gene Chromosomal Location, Gene Duplication, and Synteny Analysis

All LcHsf genes were mapped to their corresponding physical locations on a chromosome or scaffold. The chromosomal locations and circos plot resulting from LcHsf micro-synteny analysis were visualized by TBtool (V2.001). Gene duplication events were examined via MCScanX software (V1.0, University of Georgia, Athens, GA, USA) [64]. Collinear relationship maps of homologous Hsf genes were obtained for L. chinense, O. sativa, V. vinifera, and A. thaliana and displayed using the synteny visualization function of the TBtools platform (V2.001, South China Agricultural University, Guangzhou, China). Ka/Ks values were predicted by a Ka/Ks calculator (V3.0, National Genomics Data Center, Beijing, China) [65].

4.4. Determination of Tissue Specific LcHsf Gene Expression Patterns and Abiotic Stress Treatment of Liriodendron Hybrid Seedlings

All experimental materials were obtained from Nanjing Forestry University (Nanjing, China). Gene expression was quantified using RNA-seq data generated from different tissues, including bud, leaf, bark, phloem, xylem, stigma, stamen, and sepal (Table S10). Gene expression was examined after heat, cold, and drought stress (Table S11): 3-month-old seedlings were transferred to a growth incubator in preparation for stress treatment (23 °C, 16 h light and 8 h dark culture). To simulate heat stress, seedlings were treated with 40 °C for 1 h, 3 h, 6 h, 12 h, 1 day, and 3 days, respectively. To simulate cold stress, seedlings were treated with 4 °C for 1 h, 3 h, 6 h, 12 h, 1 day, and 3 days. And to simulate drought stress, seedlings were treated with 15% PEG 6000 for 1 h, 3 h, 6 h, 12 h, 1 day, and 3 days, respectively. Leaves were then selected for RNA-seq analysis. The datasets are available at NCBI (PRJNA679089 and PRJNA679101).

4.5. Construction of a Correlation Network Based on Gene Expression after Heat Stress

A Pearson’s correlation analysis was used to calculate an adjacency matrix between all LcHsfs from RNA-seq data generated under heat stress. The LcHsf gene expression file was set as one group, and the related LcHsp70 and redox gene expression file was set as the second group. The LcHsp70 superfamily included cytosolic Hsp70s (cHsp70), ER-localized Hsp70s (BiP), mitochondrial Hsp70s (mtHsc70), chloroplast-localized Hsp70s (cpHsc70), and Hsp110/SSE family members. The redox-related genes include RBOH, PAO, PPOX, MPAO, SOD, NADPH, GPX, APX, and GSR genes. Their expression file under heat stress is listed in Table S12. FPKM gene expression values were normalized to a computable log2 (value + 1 × 10−6). The correlation network of the two groups was calculated using the following settings: the filtering threshold of the association analysis was set to 0.8 and the p-value ≤ 0.05 [66]. The filtered correlation result is shown in Table S13. This work was performed using the Metware Cloud (https://cloud.metware.cn) (accessed on 28 August 2022). Graphical representation of the network was performed using Cytoscape [67].
The co-expression of LcHsf, LcHsp70, and redox genes was determined. All gene expression data under heat stress are shown in Table S14. Genes with the edge weight higher than 0.60 in blue4 module were selected for visualization (Table S15).

4.6. RNA Isolation and qRT-PCR

For short-term heat stress, qRT-PCR was used to quantify gene expression within 1 h after heat treatment. The Liriodendron hybrid seedlings were treated at 40 °C for 15 min, 30 min, or 1 h. The untreated control was cultured at 23 °C. Total RNA extraction from leaf tissues, cDNA synthesis, and qRT-PCR were performed according to previously published methods [30]. A 20 μL PCR reaction was set up. The L. chinense 18s gene was selected as internal reference. The primer sequences used are listed (Table S16). The data were analyzed using a 2−ΔΔCT method. The raw qPCR data of four genes (LcHsfA2a, LcHsfA2b, LcHsfA7, and LcHsfB2b) are provided in Table S17.

4.7. Cloning of LcHsfA2a and Transient Transformation

To overexpress LcHsfA2a, its 1149 bp CDS was amplified from Liriodendron hybrid cDNA using specific primers (primer F: ATGAAATTTCACTTGCAGGAGAAGGC, and primer R: TCATGACTTTGACCCCAGAAAAC). The basic vector used was pBI121 without modification, which results in detectable GUS staining when transformed into Liriodendron seedlings. To ensure the accuracy of the transient transformation experiment, the iGUS gene (with introns) was cloned into pBI121 to replace the present GUS gene. The iGUS gene was cloned from the plant expression vector pcambia1301. The overexpression vector 35S:LcHsfA2a-iGUS was subsequently generated by Gibson Assembly. Transformation of Liriodendron hybrid plants was performed according to a previously published article [68]. In brief, plant seedlings were immersed in transformation solution (1.0 OD Agrobacterium tumefaciens, pH 5.6) while swaying in the dark at 25 °C, 95 rpm for 4 h. Seedlings were then cultured on 3/4 MS medium for 72 h before GUS staining. Transient transformation experiments were repeated 3 times. GUS staining was performed according to a method previously described [69]. Briefly, seedlings were soaked in pre-chilled 90% acetone for 20 min, then the seedlings were washed with X-Gluc-free staining solution after the acetone was removed. Next, the seedlings were evacuated by vacuum pump in staining solution. Finally, the seedlings were incubated at 37 °C for 24 h in the dark. After staining, the seedlings were mounted in a clearing solution for observation. Images of the seedlings were taken using a stereomicroscope (Leica M165, Danaher Corporation, Wetzlar, Germany).

4.8. Analysis of Transiently Transformed Plants under Heat Stress

After transient infection for 48 h, the plants were exposed to 40 °C for 0 h, 1 h, and 3 h. The plants were collected for histochemical staining (DAB, NBT, and Evans blue staining), expression analysis, and H2O2 measurement. H2O2 was detected by DAB staining while O2− was detected by NBT staining. The treated seedlings were immersed in DAB or NBT staining solution, respectively. The staining procedures were performed according to instructions [70]. Evans blue staining was performed according to a previously published article to detect cell damage [71]. Briefly, seedlings were vacuum infiltrated in 0.1% (w/v) Evans blue solution for 15 min. The seedlings were then immersed in absolute ethanol and heated in boiling water for 10 min to remove chlorophyll for better visualization of the staining. For H2O2 content measurement, 4 independent transformed samples were used. The experimental procedure was performed according to the manual accompanying the assay kit (micromethod) (Sangon, Shanghai, China). The raw data of the H2O2 content are shown in Table S18.

5. Conclusions

In this study, we conducted a comprehensive investigation of the L. chinense Hsf gene family. Nineteen LcHsf genes were identified and categorized into three groups. Hsf gene phylogeny showed an evolutionary relationship of LcHsfs close to A. thaliana and V. vinifera. The expansion of the LcHsf family has mainly occurred through WGD or segmental duplication and suffered from purifying selection, which might have resulted in a relatively small number of LcHsf homologues. Four LcHsfA and three LcHsfB genes are significantly upregulated under heat treatment. Under cold-stress treatment, one LcHsfA gene and five LcHsfB genes are upregulated after a three-day duration. Drought treatment induced the expression of LcHsfA and LcHsfB family homologues at different time points. Furthermore, the transient overexpression of LcHsfA2a in L. hybrid seedlings significantly reduced H2O2 levels. These data provide essential characterization of LcHsf genes and have identified possible candidate genes for improving stress tolerance in Liriodendron plants.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms25052733/s1. Refs. [72,73,74,75,76] are in the Supplementary.

Author Contributions

Conceptualization, Y.Y. and Z.H.; methodology, J.Y.; software, L.Z.; validation, Y.Y., Y.L. and L.X.; formal analysis, Y.Y.; investigation, W.W. and Y.L.; resources, J.C. and J.S.; data curation, Y.Y.; writing—original draft preparation, Y.Y.; writing—review and editing, Y.Y. and J.C.; visualization, Y.Y.; supervision, J.S.; project administration, Z.H.; funding acquisition, J.C. and Z.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Youth Foundation of the Natural Science Foundation of the Jiangsu Province (Grant No. BK20210614), the Natural Science Foundation of China (No. 32101546) and Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets are available at NCBI (PRJNA679089 and PRJNA679101).

Acknowledgments

The authors thank laboratory colleagues LuLu and Siqin Liu for technical support. The authors wish to thank the editor and reviewers for their helpful comments.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Shao, J.; Liu, P.; Zhao, B.; Zhang, J.; Zhao, X.; Ren, B. Combined effects of high temperature and waterlogging on yield and stem development of summer maize. Crop J. 2022, 11, 651–660. [Google Scholar] [CrossRef]
  2. Khan, A.H.; Min, L.; Ma, Y.; Zeeshan, M.; Jin, S.; Zhang, X. High-temperature stress in crops: Male sterility, yield loss, and potential remedy approaches. Plant Biotechnol. J. 2022, 21, 680–697. [Google Scholar] [CrossRef] [PubMed]
  3. Qian, R.; Hu, Q.; Ma, X.; Zhang, X.; Ye, Y.; Liu, H.; Gao, H.; Zheng, J. Comparative transcriptome analysis of heat stress responses of Clematis lanuginosa and Clematis crassifolia. BMC Plant Biol. 2022, 22, 138. [Google Scholar] [CrossRef] [PubMed]
  4. Jacob, P.; Hirt, H.; Bendahmane, A. The heat shock protein/chaperone network and multiple stress resistance. Plant Biotechnol. J. 2016, 15, 405–414. [Google Scholar] [CrossRef]
  5. Sorger, P.K.; Pelham, H.R.B. Yeast heat shock factor is an essential DNA-binding protein that exhibits temperature-dependent phosphorylation. Cell 1988, 54, 855–864. [Google Scholar] [CrossRef] [PubMed]
  6. Pérez-Rodríguez, P.; Riaño-Pachón, D.M.; Corrêa, L.G.; Rensing, S.A.; Kersten, B.; Mueller-Roeber, B. PlnTFDB: Updated content and new features of the plant transcription factor database. Nucleic Acids Res. 2010, 38, D822–D827. [Google Scholar] [CrossRef]
  7. Guo, J.; Wu, J.; Ji, Q.; Wang, C.; Luo, L.; Yuan, Y.; Wang, Y.; Wang, J. Genome-wide analysis of heat shock transcription factor families in rice and Arabidopsis. J. Genet. Genom. 2008, 35, 105–118. [Google Scholar] [CrossRef]
  8. Jiang, L.; Hu, W.; Qian, Y.; Ren, Q.; Zhang, J. Genome-wide identification, classification and expression analysis of the Hsf and Hsp70 gene families in maize. Gene 2021, 770, 145348. [Google Scholar] [CrossRef]
  9. Scharf, K.D.; Berberich, T.; Ebersberger, I.; Nover, L. The plant heat stress transcription factor (Hsf) family: Structure, function and evolution. Biochim. Biophys. Acta 2012, 1819, 104–119. [Google Scholar] [CrossRef]
  10. Huang, Y.; Li, M.-Y.; Wang, F.; Xu, Z.-S.; Huang, W.; Wang, G.-L.; Ma, J.; Xiong, A.-S. Heat shock factors in carrot: Genome-wide identification, classification, and expression profiles response to abiotic stress. Mol. Biol. Rep. 2015, 42, 893–905. [Google Scholar] [CrossRef]
  11. Rhee, S.Y.; Beavis, W.; Berardini, T.Z.; Chen, G.; Dixon, D.; Doyle, A.; Garcia-Hernandez, M.; Huala, E.; Lander, G.; Montoya, M.; et al. The Arabidopsis Information Resource (TAIR): A model organism database providing a centralized, curated gateway to Arabidopsis biology, research materials and community. Nucleic Acids Res. 2003, 31, 224–228. [Google Scholar] [CrossRef] [PubMed]
  12. Zhang, J.; Liu, B.; Li, J.; Zhang, L.; Wang, Y.; Zheng, H.; Lu, M.; Chen, J. Hsf and Hsp gene families in Populus: Genome-wide identification, organization and correlated expression during development and in stress responses. BMC Genom. 2015, 16, 181. [Google Scholar] [CrossRef] [PubMed]
  13. Giorno, F.; Guerriero, G.; Baric, S.; Mariani, C. Heat shock transcriptional factors in Malus domestica: Identification, classification and expression analysis. BMC Genom. 2012, 13, 639. [Google Scholar] [CrossRef] [PubMed]
  14. Guo, M.; Lu, J.P.; Zhai, Y.F.; Chai, W.G.; Gong, Z.H.; Lu, M.H. Genome-wide analysis, expression profile of heat shock factor gene family (CaHsfs) and characterisation of CaHsfA2 in pepper (Capsicum annuum L.). BMC Plant Biol. 2015, 15, 151. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, M.; Huang, Q.; Sun, W.; Ma, Z.; Huang, L.; Wu, Q.; Tang, Z.; Bu, T.; Li, C.; Chen, H. Genome-wide investigation of the heat shock transcription factor (Hsf) gene family in Tartary buckwheat (Fagopyrum tataricum). BMC Genom. 2019, 20, 871. [Google Scholar] [CrossRef] [PubMed]
  16. Liu, X.; Meng, P.; Yang, G.; Zhang, M.; Peng, S.; Zhai, M.Z. Genome-wide identification and transcript profiles of walnut heat stress transcription factor involved in abiotic stress. BMC Genom. 2020, 21, 474. [Google Scholar] [CrossRef] [PubMed]
  17. Zhang, X.; Xu, W.; Ni, D.; Wang, M.; Guo, G. Genome-wide characterization of tea plant (Camellia sinensis) Hsf transcription factor family and role of CsHsfA2 in heat tolerance. BMC Plant Biol. 2020, 20, 244. [Google Scholar] [CrossRef] [PubMed]
  18. Guo, M.; Liu, J.H.; Ma, X.; Luo, D.X.; Gong, Z.H.; Lu, M.H. The Plant Heat Stress Transcription Factors (HSFs): Structure, Regulation, and Function in Response to Abiotic Stresses. Front. Plant Sci. 2016, 7, 114. [Google Scholar] [CrossRef]
  19. Ikeda, M.; Mitsuda, N.; Ohme-Takagi, M. Arabidopsis HsfB1 and HsfB2b act as repressors of the expression of heat-inducible Hsfs but positively regulate the acquired thermotolerance. Plant Physiol. 2011, 157, 1243–1254. [Google Scholar] [CrossRef]
  20. Muszynski, M.G.; Moss-Taylor, L.; Chudalayandi, S.; Cahill, J.; Del Valle-Echevarria, A.R.; Alvarez-Castro, I.; Petefish, A.; Sakakibara, H.; Krivosheev, D.M.; Lomin, S.N.; et al. The Maize Hairy Sheath Frayed1 (Hsf1) Mutation Alters Leaf Patterning through Increased Cytokinin Signaling. Plant Cell 2020, 32, 1501–1518. [Google Scholar] [CrossRef]
  21. Qi, C.; Dong, D.; Li, Y.; Wang, X.; Guo, L.; Liu, L.; Dong, X.; Li, X.; Yuan, X.; Ren, S.; et al. Heat shock-induced cold acclimation in cucumber through CsHSFA1d-activated JA biosynthesis and signaling. Plant J. 2022, 111, 85–102. [Google Scholar] [CrossRef] [PubMed]
  22. Yoshida, T.; Ohama, N.; Nakajima, J.; Kidokoro, S.; Mizoi, J.; Nakashima, K.; Maruyama, K.; Kim, J.M.; Seki, M.; Todaka, D.; et al. Arabidopsis HsfA1 transcription factors function as the main positive regulators in heat shock-responsive gene expression. Mol. Genet. Genom. MGG 2011, 286, 321–332. [Google Scholar] [CrossRef] [PubMed]
  23. Ogawa, D.; Yamaguchi, K.; Nishiuchi, T. High-level overexpression of the Arabidopsis HsfA2 gene confers not only increased themotolerance but also salt/osmotic stress tolerance and enhanced callus growth. J. Exp. Bot. 2007, 58, 3373–3383. [Google Scholar] [CrossRef] [PubMed]
  24. Schramm, F.; Larkindale, J.; Kiehlmann, E.; Ganguli, A.; Englich, G.; Vierling, E.; Von Koskull-Döring, P. A cascade of transcription factor DREB2A and heat stress transcription factor HsfA3 regulates the heat stress response of Arabidopsis. Plant J. 2008, 53, 264–274. [Google Scholar] [CrossRef]
  25. Pérez-Salamó, I.; Papdi, C.; Rigó, G.; Zsigmond, L.; Vilela, B.; Lumbreras, V.; Nagy, I.; Horváth, B.; Domoki, M.; Darula, Z.; et al. The heat shock factor A4A confers salt tolerance and is regulated by oxidative stress and the mitogen-activated protein kinases MPK3 and MPK6. Plant Physiol. 2014, 165, 319–334. [Google Scholar] [CrossRef]
  26. Hwang, S.M.; Kim, D.W.; Woo, M.S.; Jeong, H.S.; Son, Y.S.; Akhter, S.; Choi, G.J.; Bahk, J.D. Functional characterization of Arabidopsis HsfA6a as a heat-shock transcription factor under high salinity and dehydration conditions. Plant Cell Environ. 2014, 37, 1202–1222. [Google Scholar] [CrossRef]
  27. Giesguth, M.; Sahm, A.; Simon, S.; Dietz, K.-J. Redox-dependent translocation of the heat shock transcription factor AtHSFA8 from the cytosol to the nucleus in Arabidopsis thaliana. FEBS Lett. 2015, 589, 718–725. [Google Scholar] [CrossRef]
  28. Chen, J.; Hao, Z.; Guang, X.; Zhao, C.; Wang, P.; Xue, L.; Zhu, Q.; Yang, L.; Sheng, Y.; Zhou, Y.; et al. Liriodendron genome sheds light on angiosperm phylogeny and species–pair differentiation. Nat. Plants 2019, 5, 18–25. [Google Scholar] [CrossRef]
  29. Sun, X.; Zhu, L.; Hao, Z.; Wu, W.; Xu, L.; Yang, Y.; Zhang, J.; Lu, Y.; Shi, J.; Chen, J. Genome-Wide Identification and Abiotic-Stress-Responsive Expression of CKX Gene Family in Liriodendron chinense. Plants 2023, 12, 2157. [Google Scholar] [CrossRef]
  30. Wu, W.; Zhu, S.; Xu, L.; Zhu, L.; Wang, D.; Liu, Y.; Liu, S.; Hao, Z.; Lu, Y.; Yang, L.; et al. Genome-wide identification of the Liriodendron chinense WRKY gene family and its diverse roles in response to multiple abiotic stress. BMC Plant Biol. 2022, 22, 25. [Google Scholar] [CrossRef]
  31. Chen, Y.; Wu, H.; Hao, Z.; Zhu, L.; Lu, L.; Shi, J.; Chen, J. The Identification and Expression Analysis of the Liriodendron chinense (Hemsl.) Sarg. SOD Gene Family. Forests 2023, 14, 628. [Google Scholar]
  32. Liu, H.; Li, X.; Zi, Y.; Zhao, G.; Zhu, L.; Hong, L.; Li, M.; Wang, S.; Long, R.; Kang, J.; et al. Characterization of the Heat Shock Transcription Factor Family in Medicago sativa L. and Its Potential Roles in Response to Abiotic Stresses. Int. J. Mol. Sci. 2023, 24, 12683. [Google Scholar] [CrossRef] [PubMed]
  33. Xie, K.; Guo, J.; Wang, S.; Ye, W.; Sun, F.; Zhang, C.; Xi, Y. Genome-wide identification, classification, and expression analysis of heat shock transcription factor family in switchgrass (Panicum virgatum L.). Plant Physiol. Biochem. PPB 2023, 201, 107848. [Google Scholar] [CrossRef] [PubMed]
  34. Wang, Q.; Zhang, Z.; Guo, C.; Zhao, X.; Li, Z.; Mou, Y.; Sun, Q.; Wang, J.; Yuan, C.; Li, C.; et al. Hsf transcription factor gene family in peanut (Arachis hypogaea L.): Genome-wide characterization and expression analysis under drought and salt stresses. Front. Plant Sci. 2023, 14, 1214732. [Google Scholar] [CrossRef] [PubMed]
  35. Evrard, A.; Kumar, M.; Lecourieux, D.; Lucks, J.; von Koskull-Döring, P.; Hirt, H. Regulation of the heat stress response in Arabidopsis by MPK6-targeted phosphorylation of the heat stress factor HsfA2. PeerJ 2013, 1, e59. [Google Scholar] [CrossRef] [PubMed]
  36. Friedrich, T.; Oberkofler, V.; Trindade, I.; Altmann, S.; Brzezinka, K.; Lämke, J.; Gorka, M.; Kappel, C.; Sokolowska, E.; Skirycz, A.; et al. Heteromeric HSFA2/HSFA3 complexes drive transcriptional memory after heat stress in Arabidopsis. Nat. Commun. 2021, 12, 3426. [Google Scholar] [CrossRef] [PubMed]
  37. Ji, Y.; Wu, H.; Zheng, X.; Zhu, L.; Zhu, Z.; Chen, Y.; Shi, J.; Zheng, R.; Chen, J. Full-Length Transcriptome Sequencing and Identification of Hsf Genes in Cunninghamia lanceolata (Lamb.) Hook. Forests 2023, 14, 684. [Google Scholar] [CrossRef]
  38. Yue, Y.; Jiang, H.; Du, J.; Shi, L.; Bin, Q.; Yang, X.; Wang, L. Variations in physiological response and expression profiles of proline metabolism-related genes and heat shock transcription factor genes in petunia subjected to heat stress. Sci. Hortic. 2019, 258, 108811. [Google Scholar] [CrossRef]
  39. Yu, T.; Bai, Y.; Liu, Z.; Wang, Z.; Yang, Q.; Wu, T.; Feng, S.; Zhang, Y.; Shen, S.; Li, Q.; et al. Large-scale analyses of heat shock transcription factors and database construction based on whole-genome genes in horticultural and representative plants. Hortic. Res. 2022, 9, uhac035. [Google Scholar] [CrossRef]
  40. Tang, H.; Wang, X.; Bowers, J.E.; Ming, R.; Alam, M.; Paterson, A.H. Unraveling ancient hexaploidy through multiply-aligned angiosperm gene maps. Genome Res. 2008, 18, 1944–1954. [Google Scholar] [CrossRef]
  41. Jiao, Y. Double the Genome, Double the Fun: Genome Duplications in Angiosperms. Mol. Plant 2018, 11, 357–358. [Google Scholar] [CrossRef] [PubMed]
  42. Schmutz, J.; Cannon, S.B.; Schlueter, J.; Ma, J.; Mitros, T.; Nelson, W.; Hyten, D.L.; Song, Q.; Thelen, J.J.; Cheng, J.; et al. Genome sequence of the palaeopolyploid soybean. Nature 2010, 463, 178–183. [Google Scholar] [CrossRef] [PubMed]
  43. Sun, T.; Wang, W.; Hu, X.; Fang, Z.; Wang, Y.; Xiang, L.; Chan, Z. Genome-wide identification of heat shock transcription factor families in perennial ryegrass highlights the role of LpHSFC2b in heat stress response. Physiol. Plant. 2022, 174, e13828. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, Q.; Geng, J.; Du, Y.; Zhao, Q.; Zhang, W.; Fang, Q.; Yin, Z.; Li, J.; Yuan, X.; Fan, Y.; et al. Heat shock transcription factor (Hsf) gene family in common bean (Phaseolus vulgaris): Genome-wide identification, phylogeny, evolutionary expansion and expression analyses at the sprout stage under abiotic stress. BMC Plant Biol. 2022, 22, 33. [Google Scholar] [CrossRef] [PubMed]
  45. Fujii, H.; Zhu, J.K. Arabidopsis mutant deficient in 3 abscisic acid-activated protein kinases reveals critical roles in growth, reproduction, and stress. Proc. Natl. Acad. Sci. USA 2009, 106, 8380–8385. [Google Scholar] [CrossRef] [PubMed]
  46. Swindell, W.R.; Huebner, M.; Weber, A.P. Transcriptional profiling of Arabidopsis heat shock proteins and transcription factors reveals extensive overlap between heat and non-heat stress response pathways. BMC Genom. 2007, 8, 125. [Google Scholar] [CrossRef] [PubMed]
  47. Umezawa, T.; Sugiyama, N.; Takahashi, F.; Anderson, J.C.; Ishihama, Y.; Peck, S.C.; Shinozaki, K. Genetics and phosphoproteomics reveal a protein phosphorylation network in the abscisic acid signaling pathway in Arabidopsis thaliana. Sci. Signal. 2013, 6, rs8. [Google Scholar] [CrossRef] [PubMed]
  48. Liu, J.-H.; Peng, T.; Dai, W. Critical cis-Acting Elements and Interacting Transcription Factors: Key Players Associated with Abiotic Stress Responses in Plants. Plant Mol. Biol. Rep. 2014, 32, 303–317. [Google Scholar] [CrossRef]
  49. Chauhan, H.; Khurana, N.; Agarwal, P.; Khurana, J.P.; Khurana, P. A seed preferential heat shock transcription factor from wheat provides abiotic stress tolerance and yield enhancement in transgenic Arabidopsis under heat stress environment. PLoS ONE 2013, 8, e79577. [Google Scholar] [CrossRef]
  50. Gu, L.; Jiang, T.; Zhang, C.; Li, X.; Wang, C.; Zhang, Y.; Li, T.; Dirk, L.M.A.; Downie, A.B.; Zhao, T. Maize HSFA2 and HSBP2 antagonistically modulate raffinose biosynthesis and heat tolerance in Arabidopsis. Plant J. 2019, 100, 128–142. [Google Scholar] [CrossRef]
  51. Chan-Schaminet, K.Y.; Baniwal, S.K.; Bublak, D.; Nover, L.; Scharf, K.D. Specific interaction between tomato HsfA1 and HsfA2 creates hetero-oligomeric superactivator complexes for synergistic activation of heat stress gene expression. J. Biol. Chem. 2009, 284, 20848–20857. [Google Scholar] [CrossRef] [PubMed]
  52. Mesihovic, A.; Ullrich, S.; Rosenkranz, R.R.E.; Gebhardt, P.; Bublak, D.; Eich, H.; Weber, D.; Berberich, T.; Scharf, K.D.; Schleiff, E.; et al. HsfA7 coordinates the transition from mild to strong heat stress response by controlling the activity of the master regulator HsfA1a in tomato. Cell Rep. 2022, 38, 110224. [Google Scholar] [CrossRef] [PubMed]
  53. Wang, N.; Liu, W.; Yu, L.; Guo, Z.; Chen, Z.; Jiang, S.; Xu, H.; Fang, H.; Wang, Y.; Zhang, Z.; et al. HEAT SHOCK FACTOR A8a Modulates Flavonoid Synthesis and Drought Tolerance. Plant Physiol. 2020, 184, 1273–1290. [Google Scholar] [CrossRef] [PubMed]
  54. Andrási, N.; Pettkó-Szandtner, A.; Szabados, L. Diversity of plant heat shock factors: Regulation, interactions, and functions. J. Exp. Bot. 2021, 72, 1558–1575. [Google Scholar] [CrossRef]
  55. Nishizawa, A.; Yabuta, Y.; Yoshida, E.; Maruta, T.; Yoshimura, K.; Shigeoka, S. Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. Plant J. 2006, 48, 535–547. [Google Scholar] [CrossRef] [PubMed]
  56. Banti, V.; Mafessoni, F.; Loreti, E.; Alpi, A.; Perata, P. The heat-inducible transcription factor HsfA2 enhances anoxia tolerance in Arabidopsis. Plant Physiol. 2010, 152, 1471–1483. [Google Scholar] [CrossRef] [PubMed]
  57. Lu, S.; Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; Gwadz, M.; Hurwitz, D.I.; Marchler, G.H.; Song, J.S.; et al. CDD/SPARCLE: The conserved domain database in 2020. Nucleic Acids Res. 2020, 48, D265–D268. [Google Scholar] [CrossRef]
  58. Crooks, G.E.; Hon, G.; Chandonia, J.M.; Brenner, S.E. WebLogo: A sequence logo generator. Genome Res. 2004, 14, 1188–1190. [Google Scholar] [CrossRef]
  59. Nguyen Ba, A.N.; Pogoutse, A.; Provart, N.; Moses, A.M. NLStradamus: A simple Hidden Markov Model for nuclear localization signal prediction. BMC Bioinform. 2009, 10, 202. [Google Scholar] [CrossRef]
  60. Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Williams, K.L.; Appel, R.D.; Hochstrasser, D.F. Protein identification and analysis tools in the ExPASy server. Methods Mol. Biol. 1999, 112, 531–552. [Google Scholar]
  61. Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
  62. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef] [PubMed]
  63. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  64. Wang, Y.; Tang, H.; Debarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [PubMed]
  65. Nekrutenko, A.; Makova, K.D.; Li, W.H. The K(A)/K(S) ratio test for assessing the protein-coding potential of genomic regions: An empirical and simulation study. Genome Res. 2002, 12, 198–202. [Google Scholar] [CrossRef]
  66. Bai, Y.; Yang, C.; Halitschke, R.; Paetz, C.; Kessler, D.; Burkard, K.; Gaquerel, E.; Baldwin, I.T.; Li, D. Natural history-guided omics reveals plant defensive chemistry against leafhopper pests. Science 2022, 375, eabm2948. [Google Scholar] [CrossRef] [PubMed]
  67. Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A Software Environment for Integrated Models of Biomolecular Interaction Networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
  68. Zang, D.; Wang, C.; Ji, X.; Wang, Y. Tamarix hispida zinc finger protein ThZFP1 participates in salt and osmotic stress tolerance by increasing proline content and SOD and POD activities. Plant Sci. 2015, 235, 111–121. [Google Scholar] [CrossRef]
  69. Yuan, T.T.; Xiang, Z.X.; Li, W.; Gao, X.; Lu, Y.T. Osmotic stress represses root growth by modulating the transcriptional regulation of PIN-FORMED3. New Phytol. 2021, 232, 1661–1673. [Google Scholar] [CrossRef]
  70. Kumar, D.; Yusuf, M.A.; Singh, P.; Sardar, M.; Sarin, N.B. Histochemical Detection of Superoxide and H2O2 Accumulation in Brassica juncea Seedlings. Bio-Protocol 2014, 4, e1108. [Google Scholar] [CrossRef]
  71. Kim, M.; Ahn, J.W.; Jin, U.H.; Choi, D.; Paek, K.H.; Pai, H.S. Paek, Activation of the Programmed Cell Death Pathway by Inhibition of Proteasome Function in Plants. J. Biol. Chem. 2003, 278, 19406–19415. [Google Scholar] [CrossRef]
  72. Huang, Y.C.; Niu, C.Y.; Yang, C.R.; Jinn, T.L. The Heat Stress Factor HSFA6b Connects ABA Signaling and ABA-Mediated Heat Responses. Plant Physiol. 2016, 172, 1182–1199. [Google Scholar]
  73. Yang, J.; Qu, X.; Li, T.; Gao, Y.; Du, H.; Zheng, L.; Ji, M.; Zhang, P.; Zhang, Y.; Hu, J.; et al. HY5-HDA9 orchestrates the transcription of HsfA2 to modulate salt stress response in Arabidopsis. J. Integr. Plant Biol. 2023, 65, 45–63. [Google Scholar]
  74. Kotak, S.; Vierling, E.; Bäumlein, H.; von Koskull-Döring, P. A novel transcriptional cascade regulating expression of heat stress proteins during seed development of Arabidopsis. Plant Cell 2007, 19, 182–195. [Google Scholar]
  75. Chen, H.; Hwang, J.E.; Lim, C.J.; Kim, D.Y.; Lee, S.Y.; Lim, C.O. Arabidopsis DREB2C functions as a transcriptional activator of HsfA3 during the heat stress response. Biochem. Biophys. Res. Commun. 2010, 401, 238–244. [Google Scholar]
  76. Li, M.; Berendzen, K.W.; Schöffl, F. Promoter specificity and interactions between early and late Arabidopsis heat shock factors. Plant Mol. Biol. 2010, 73, 559–567. [Google Scholar]
Ijms 25 02733 g001
Figure 1. LcHsf gene characteristics. (a) The LcHsfs gene chromosomal loci allocated on 11 of 19 chromosomes. The scale is in million bases (Mb). The block-color-deepness on chromosome represented the different density of gene distribution, the deeper, the more genes distributed. (b) LcHsf gene structure. The green and yellow boxes represent the coding sequence (CDS) and the untranslated regions (UTR), respectively.
Figure 1. LcHsf gene characteristics. (a) The LcHsfs gene chromosomal loci allocated on 11 of 19 chromosomes. The scale is in million bases (Mb). The block-color-deepness on chromosome represented the different density of gene distribution, the deeper, the more genes distributed. (b) LcHsf gene structure. The green and yellow boxes represent the coding sequence (CDS) and the untranslated regions (UTR), respectively.
Ijms 25 02733 g001
Ijms 25 02733 g002
Figure 2. Phylogenetic tree of the Hsf family in L. chinense (Lc), A. trichopoda (AmTr), O. sativa (Os), V. vinifera (Vv), and A. thaliana (At). Pink represents the HsfA group, blue-green represents the HsfB group, and light yellow represents the HsfC group. Posterior values are displayed on the branches, represented by a lavender circle (see legend).
Figure 2. Phylogenetic tree of the Hsf family in L. chinense (Lc), A. trichopoda (AmTr), O. sativa (Os), V. vinifera (Vv), and A. thaliana (At). Pink represents the HsfA group, blue-green represents the HsfB group, and light yellow represents the HsfC group. Posterior values are displayed on the branches, represented by a lavender circle (see legend).
Ijms 25 02733 g002
Ijms 25 02733 g003
Figure 3. LhHsf protein DBD domain structure and protein motif distribution. (a) The LcHsf protein DBD domain is made up out of a α1-β1-β2-α2-α3-β3-β4 folding structure. A multiple sequence alignment analysis of the DBD domain of 19 predicted LhHsf sequences using ClustalX2.1 is shown. The bits score represents the sequence conservation score of all positions in the sequence. The higher this value, the better conserved it is. (b) A phylogenetic tree of all LcHsf proteins was constructed using the TBtool software (V2.001) and displayed on the left. The middle panel shows the result of a protein motif analysis via the Gene Structure View menu of TBtool (V2.001), with the 10 different motifs represented by a unique color scheme (see legend). Below is the x-axis, representing protein amino acid length, running from the N- (5′) to the C-terminus (3′).
Figure 3. LhHsf protein DBD domain structure and protein motif distribution. (a) The LcHsf protein DBD domain is made up out of a α1-β1-β2-α2-α3-β3-β4 folding structure. A multiple sequence alignment analysis of the DBD domain of 19 predicted LhHsf sequences using ClustalX2.1 is shown. The bits score represents the sequence conservation score of all positions in the sequence. The higher this value, the better conserved it is. (b) A phylogenetic tree of all LcHsf proteins was constructed using the TBtool software (V2.001) and displayed on the left. The middle panel shows the result of a protein motif analysis via the Gene Structure View menu of TBtool (V2.001), with the 10 different motifs represented by a unique color scheme (see legend). Below is the x-axis, representing protein amino acid length, running from the N- (5′) to the C-terminus (3′).
Ijms 25 02733 g003
Ijms 25 02733 g004
Figure 4. Genome-wide synteny analysis comparing the L. chinense LcHsf gene family to three other plant species. (a) Micro-synteny analysis of L. chinense LcHsf genes. The circle shows the 19 numbered chromosomes with red lines connecting homologous gene pairs. (b) Synteny analysis of Hsf genes between L. chinense, O. sativa, V. vinifera, and A. thaliana. The gray lines in the background indicate the collinear regions in the genomes of these four species, while the highlighted blue lines indicate the collinear Hsf gene pairs.
Figure 4. Genome-wide synteny analysis comparing the L. chinense LcHsf gene family to three other plant species. (a) Micro-synteny analysis of L. chinense LcHsf genes. The circle shows the 19 numbered chromosomes with red lines connecting homologous gene pairs. (b) Synteny analysis of Hsf genes between L. chinense, O. sativa, V. vinifera, and A. thaliana. The gray lines in the background indicate the collinear regions in the genomes of these four species, while the highlighted blue lines indicate the collinear Hsf gene pairs.
Ijms 25 02733 g004
Ijms 25 02733 g005
Figure 5. Statistics on the type and number of cis-elements in the promoter region of LcHsfs genes. Different types of cis-elements are classified on the left side of the graph, and the numbers in the heatmap indicate the numbers of different promoter elements.
Figure 5. Statistics on the type and number of cis-elements in the promoter region of LcHsfs genes. Different types of cis-elements are classified on the left side of the graph, and the numbers in the heatmap indicate the numbers of different promoter elements.
Ijms 25 02733 g005
Ijms 25 02733 g006
Figure 6. Expression profiles of LcHsf genes in eight different Liriodendron hybrid tissues: phloem, xylem, stigma, bark, bud, leaf, stamen, stigma, and sepal. The heatmaps were generated based on gene expression levels. The gene expression of fragments per kilobase million (FPKM) values were normalized using the TBtool software (V2.001) Z-score method, according to the following formula:  Z = x − μ σ .  μ  refers to the data mean value,  σ  refers to the standard deviation value of the dataset and  x  refers to individual gene expression values. The legend bordering the heatmap shows the Z-value color code from −2.0 and +2.5. Genes with a high expression value are marked red, while those with a low expression value are marked blue.
Figure 6. Expression profiles of LcHsf genes in eight different Liriodendron hybrid tissues: phloem, xylem, stigma, bark, bud, leaf, stamen, stigma, and sepal. The heatmaps were generated based on gene expression levels. The gene expression of fragments per kilobase million (FPKM) values were normalized using the TBtool software (V2.001) Z-score method, according to the following formula:  Z = x − μ σ .  μ  refers to the data mean value,  σ  refers to the standard deviation value of the dataset and  x  refers to individual gene expression values. The legend bordering the heatmap shows the Z-value color code from −2.0 and +2.5. Genes with a high expression value are marked red, while those with a low expression value are marked blue.
Ijms 25 02733 g006
Ijms 25 02733 g007
Figure 7. LcHsf gene expression patterns under heat (a), cold (b), and drought (c) stress for 1 h, 3 h, 6 h, 12 h, 1 d, and 3 d in Liriodendron leaves. The transcript abundance level was normalized and then hierarchically clustered. The gene FPKM values were normalized using the Z-score method. Blue blocks represent reduced transcriptional expression, while red blocks represent increased transcriptional expression.
Figure 7. LcHsf gene expression patterns under heat (a), cold (b), and drought (c) stress for 1 h, 3 h, 6 h, 12 h, 1 d, and 3 d in Liriodendron leaves. The transcript abundance level was normalized and then hierarchically clustered. The gene FPKM values were normalized using the Z-score method. Blue blocks represent reduced transcriptional expression, while red blocks represent increased transcriptional expression.
Ijms 25 02733 g007
Ijms 25 02733 g008
Figure 8. qRT-PCR analysis of selected high-responsive LcHsf genes in leaf tissues under heat stress. The relative mRNA abundance was normalized to reference gene of 18S rRNA. Gene expression values of a single gene denoted with non-identical letters are significantly different when assessed using a Duncan’s multiple range test (p < 0.05).
Figure 8. qRT-PCR analysis of selected high-responsive LcHsf genes in leaf tissues under heat stress. The relative mRNA abundance was normalized to reference gene of 18S rRNA. Gene expression values of a single gene denoted with non-identical letters are significantly different when assessed using a Duncan’s multiple range test (p < 0.05).
Ijms 25 02733 g008
Ijms 25 02733 g009
Figure 9. Transcriptional correlation network between LcHsf and LcHsp70 genes. A connection represents a strong (r > 0.8) and significant (p < 0.05) correlation. The size of each circle is proportional to the number of connections. The higher the number of other points connecting a node, the larger the circle of the node. Red circles represent LcHsf genes while blue circles represent LcHsp70 and redox-related genes. Red lines indicate that the expression levels of the two connected genes are positively correlated, while blue lines indicate that the two connected genes show negatively correlated expression levels. The LcHsp70 superfamily includes cytosolic Hsp70s (cHsp70), ER-localized Hsp70s (BiP, Hsp70 homologs in the endoplasmic reticulum), mitochondrial Hsp70s (mtHsc70), chloroplast-localized Hsp70s (cpHsc70), and Hsp110/SSE family members. The redox-related genes include RBOH (respiratory burst oxidase), PAO (polyamine oxidase), PPOX (protoporphyrinogen/coproporphyrinogen III oxidase), MPAO (polyamine oxidase), SOD (superoxide dismutase), NADPH (monodehydroascorbate reductase), GPX (glutathione peroxidase), APX (L-ascorbate peroxidase), and GSR (glutathione reductase) genes.
Figure 9. Transcriptional correlation network between LcHsf and LcHsp70 genes. A connection represents a strong (r > 0.8) and significant (p < 0.05) correlation. The size of each circle is proportional to the number of connections. The higher the number of other points connecting a node, the larger the circle of the node. Red circles represent LcHsf genes while blue circles represent LcHsp70 and redox-related genes. Red lines indicate that the expression levels of the two connected genes are positively correlated, while blue lines indicate that the two connected genes show negatively correlated expression levels. The LcHsp70 superfamily includes cytosolic Hsp70s (cHsp70), ER-localized Hsp70s (BiP, Hsp70 homologs in the endoplasmic reticulum), mitochondrial Hsp70s (mtHsc70), chloroplast-localized Hsp70s (cpHsc70), and Hsp110/SSE family members. The redox-related genes include RBOH (respiratory burst oxidase), PAO (polyamine oxidase), PPOX (protoporphyrinogen/coproporphyrinogen III oxidase), MPAO (polyamine oxidase), SOD (superoxide dismutase), NADPH (monodehydroascorbate reductase), GPX (glutathione peroxidase), APX (L-ascorbate peroxidase), and GSR (glutathione reductase) genes.
Ijms 25 02733 g009
Ijms 25 02733 g010
Figure 10. GUS staining and qRT-PCR analysis of 35S:LcHsfA2 transiently transformed plants. (a) Representative micrograph of GUS staining performed on empty vector and 35S:LcHsfA2a transiently transformed plants. The scale bar is 2 mm. (b) Expression of LcHsfA2a in empty vector and 35S:LcHsfA2a-iGUS transiently transformed plants. The 0 h and 1 h refer to plants treated at 40 °C for 0 h and 1 h, respectively. Transgenic plants were transiently transformed for 48 h under normal conditions. The qPCR experiment uses technique replicates and biological replicates. The biological replicates form 3 separate transformation experiments.
Figure 10. GUS staining and qRT-PCR analysis of 35S:LcHsfA2 transiently transformed plants. (a) Representative micrograph of GUS staining performed on empty vector and 35S:LcHsfA2a transiently transformed plants. The scale bar is 2 mm. (b) Expression of LcHsfA2a in empty vector and 35S:LcHsfA2a-iGUS transiently transformed plants. The 0 h and 1 h refer to plants treated at 40 °C for 0 h and 1 h, respectively. Transgenic plants were transiently transformed for 48 h under normal conditions. The qPCR experiment uses technique replicates and biological replicates. The biological replicates form 3 separate transformation experiments.
Ijms 25 02733 g010
Ijms 25 02733 g011
Figure 11. LcHsfA2a might be involved in heat-stress response. (a–c) DAB, NBT, and Evans blue staining of 35S:LcHsfA2a and empty vector transiently transformed plants after 0 h or 3 h 40 °C heat stress treatment. NBT and DAB staining represent the accumulation of O2− and H2O2 levels, respectively, while Evans blue staining reveals cellular death rate. The scale bar is 0.5 mm. (d) H2O2 content determination via colorimetric assay. The data were analyzed using a t-test (https://www.spsspro.com/, accessed on 29 August 2023). The * indicates the level of significance p < 0.05, ns means no significance.
Figure 11. LcHsfA2a might be involved in heat-stress response. (a–c) DAB, NBT, and Evans blue staining of 35S:LcHsfA2a and empty vector transiently transformed plants after 0 h or 3 h 40 °C heat stress treatment. NBT and DAB staining represent the accumulation of O2− and H2O2 levels, respectively, while Evans blue staining reveals cellular death rate. The scale bar is 0.5 mm. (d) H2O2 content determination via colorimetric assay. The data were analyzed using a t-test (https://www.spsspro.com/, accessed on 29 August 2023). The * indicates the level of significance p < 0.05, ns means no significance.
Ijms 25 02733 g011
Table 1. Protein properties of LcHsf family in L. chinense.
Table 1. Protein properties of LcHsf family in L. chinense.
Gene IDArabidopsis Thaliana
Homologous Gene ID		Number of Amino
Acids		Molecular Weight (kDa)Theoretical pISubcellular
Localization Prediction
Lchi08322 (LcHsfA1a)At4g17750 (AtHsfA1a)51456.984.88Nucleus
Lchi01220 (LcHsfA1b)At5g16820 (AtHsfA1b)50653.645.35Nucleus
Lchi03447 (LcHsfA2a)At2g26150 (AtHsfA2)38243.134.83Nucleus
Lchi00789 (LcHsfA2b)37842.705.22Nucleus
Lchi25496 (LcHsfA3)At5g03720 (AtHsfA3)48754.344.89Nucleus
Lchi18071 (LcHsfA4a)At4g18880 (AtHsfA4a)44751.045.56Nucleus
Lchi03976 (LcHsfA4b)44449.195.79Nucleus
Lchi25374 (LcHsfA5)At4g13980 (AtHsfA5)50556.305.50Nucleus
Lchi25021 (LcHsfA7)At3g51910 (AtHsfA7a)39045.145.33Nucleus
Lchi19584 (LcHsfA8)At1g67970 (AtHsfA8)38844.354.75Nucleus
Lchi01929 (LcHsfB1a)At4g36990 (AtHsfB1)30834.495.74Nucleus
Lchi02207 (LcHsfB1b)28732.327.99Nucleus
Lchi04992 (LcHsfB2a)At5g62020 (AtHsfB2a)32536.335.44Nucleus
Lchi11893 (LcHsfB2b)At4g11660 (AtHsfB2b)31034.536.63Nucleus
Lchi17678 (LcHsfB3)At2g41690 (AtHsfB3)23326.678.24Nucleus
Lchi01911 (LcHsfB4)At1g46264 (AtHsfB4)36340.638.78Nucleus
Lchi28762 (LcHsfB5)-19322.369.51Nucleus
Lchi01028 (LcHsfC1a)At3g24520 (AtHsfC1)32336.706.62Nucleus
Lchi08814 (LcHsfC1b)27832.047.85Nucleus
Table 2. Conserved protein domain sequences of the L. chinense LcHsf gene family.
Table 2. Conserved protein domain sequences of the L. chinense LcHsf gene family.
ProteinDBD 1OD 2NLS 3AHA 4RD 5NES 6
LcHsfA1a23–115155–206(220) NRRITAVNKKRR(451) DSFWEQFLSAND 7(463) LAEQMGLL
LcHsfA1b53–90126–179(193) NRRIAGVNKKRR(425) DSFWEQFLSVND(475) LTEQMGLL
LcHsfA2a40–133162–213(237) RKRRLP(351) DVEVEDLADND(370) LAEQMGFL
LcHsfA2b33–126155–206(222) RKELGGVGKKRR(341) DVEVEDLAAKND(360) VLVEQMGFLGSKPSNL
LcHsfA336–141208–270(245) KRKFLK(421) DVWGNILND(468) NDLETQLGQL
LcHsfA4a11–103189–208(209) KRRLPKP(384) DVFWEQFLTEND(431) VDNLTEQMGQL
LcHsfA4b1–83118–169(187) KKRRLPKP(364) DVFWEQFLTEND(413) VDHLTEQMGQL
LcHsfA515–81143–194(218) KKRRLPK(452) DMFWEQFLTEND(499) DMEQLTL
LcHsfA773–166196–247(271) KKRRR(353) DFWDELMNEND(378) LTERLGYL
LcHsfA812–104140–191(215) KKRR(359) DVLTEQMGLLND(378) LTPKDKEL
LcHsfB1a25–117157–214(266) NKKKRND(317) LFGVND
LcHsfB1b24–116156–204(249) KKRARND(239) LFGVND
LcHsfB2a23–115160–208(217) VKRFRND(267) LFGVND
LcHsfB2b22–114158–201(212) EEKPPVKRFRND(256) LFGVND
LcHsfB323–116146–189(210) VQGEKKRKRND(202) LFGVND
LcHsfB422–114167–220(317) LFGVPLHSKKRND(317) LFGV(347) VLRKEDLGLNL
LcHsfB531–120143–184(185) EGRSNKNGPNDNDND
LcHsfC1a6–99115–166(185) LREKKRRNDNDND
LcHsfC1b1–8399–150(168) KRLAEKKRRNDNDND
1 DBD—DNA-binding domain; 2 OD—oligomerization domain (HR-A/B); 3 NLS—nuclear localization signal; 4 AHA—activator motifs; 5 RD—repressor domain; 6 NES—nuclear export signal; 7 ND—not found.
Table 3. The Ka/Ks values of six gene pairs in LcHsf.
Table 3. The Ka/Ks values of six gene pairs in LcHsf.
Gene FamilyGene PairKaKsKa/Ks 1
LcHsfLcHsfA1aLcHsfA1b0.27290.95390.2861
LcHsfA2aLcHsfA2b0.17192.09850.0819
LcHsfA4aLcHsfA4b0.15800.79650.1984
LcHsfB1aLcHsfB1b0.24840.99380.2500
LcHsfB2aLcHsfB2b0.18740.86140.2175
LcHsfC1aLcHsfC1b0.34001.37070.2481
1 Ka/Ks (also known as ω) is the ratio of the number of non-synonymous substitutions (Ka) per non-synonymous site to the number of synonymous substitutions (Ks) per synonymous site in a DNA or protein sequence. It is commonly used to estimate the selective pressure acting on a gene during evolution. A Ka/Ks ratio greater than 1 suggests positive selection, indicating adaptive evolution of a protein. A ratio equal to 1 indicates neutral selection, while a ratio less than 1 suggests purifying selection, indicating that natural selection is working to eliminate deleterious mutations.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, Y.; Yin, J.; Zhu, L.; Xu, L.; Wu, W.; Lu, Y.; Chen, J.; Shi, J.; Hao, Z. Genome-Wide Analysis of the Liriodendron chinense Hsf Gene Family under Abiotic Stress and Characterization of the LcHsfA2a Gene. Int. J. Mol. Sci. 2024, 25, 2733. https://doi.org/10.3390/ijms25052733

AMA Style

Yang Y, Yin J, Zhu L, Xu L, Wu W, Lu Y, Chen J, Shi J, Hao Z. Genome-Wide Analysis of the Liriodendron chinense Hsf Gene Family under Abiotic Stress and Characterization of the LcHsfA2a Gene. International Journal of Molecular Sciences. 2024; 25(5):2733. https://doi.org/10.3390/ijms25052733

Chicago/Turabian Style

Yang, Yun, Jianchao Yin, Liming Zhu, Lin Xu, Weihuang Wu, Ye Lu, Jinhui Chen, Jisen Shi, and Zhaodong Hao. 2024. "Genome-Wide Analysis of the Liriodendron chinense Hsf Gene Family under Abiotic Stress and Characterization of the LcHsfA2a Gene" International Journal of Molecular Sciences 25, no. 5: 2733. https://doi.org/10.3390/ijms25052733

APA Style

Yang, Y., Yin, J., Zhu, L., Xu, L., Wu, W., Lu, Y., Chen, J., Shi, J., & Hao, Z. (2024). Genome-Wide Analysis of the Liriodendron chinense Hsf Gene Family under Abiotic Stress and Characterization of the LcHsfA2a Gene. International Journal of Molecular Sciences, 25(5), 2733. https://doi.org/10.3390/ijms25052733

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop