Comprehensive Characterization of fucAO Operon Activation in Escherichia coli

Abstract

Wildtype Escherichia coli cells cannot grow on L-1,2-propanediol, as the fucAO operon within the fucose (fuc) regulon is thought to be silent in the absence of L-fucose. Little information is available concerning the transcriptional regulation of this operon. Here, we first confirm that fucAO operon expression is highly inducible by fucose and is primarily attributable to the upstream operon promoter, while the fucO promoter within the 3′-end of fucA is weak and uninducible. Using 5′RACE, we identify the actual transcriptional start site (TSS) of the main fucAO operon promoter, refuting the originally proposed TSS. Several lines of evidence are provided showing that the fucAO locus is within a transcriptionally repressed region on the chromosome. Operon activation is dependent on FucR and Crp but not SrsR. Two Crp-cAMP binding sites previously found in the regulatory region are validated, where the upstream site plays a more critical role than the downstream site in operon activation. Furthermore, two FucR binding sites are identified, where the downstream site near the first Crp site is more important than the upstream site. Operon transcription relies on Crp-cAMP to a greater degree than on FucR. Our data strongly suggest that FucR mainly functions to facilitate the binding of Crp to its upstream site, which in turn activates the fucAO promoter by efficiently recruiting RNA polymerase.

1. Introduction

1,2-propanediol (PPD) is a common industrial chemical that has been used in the mass production of important commercial products such as biodegradable plastics and polymer resins [1]. PPD is a naturally occurring three-carbon diol, usually derived from the microbial degradation of renewable resources [2]. It is abundantly present in the human gut as well [3]. Many bacteria are capable of growing on PPD [4,5]. However, wildtype E. coli K12 strains cannot utilize PPD as a carbon source for growth (PPD⁻), although they harbor the fucO gene encoding lactaldehyde:propanediol oxidoreductase (hereafter referred to as propanediol oxidoreductase).

The fucAO operon within the fuc regulon (Figure 1) encodes an L-fuculose-1-P aldolase (FucA) and a propanediol oxidoreductase (FucO). The aldolase catalyzes the cleavage of L-fuculose-1-P [(a metabolite from the fucose pathway mediated by three enzymes encoded by the fucPIK operon: the L-fucose permease (FucP), the L-fucose isomerase (FucI), and the L-fuculose kinase (FucK)], yielding dihydroxyacetone phosphate and L-lactaldehyde. This process is independent of the presence of oxygen.

Under aerobic conditions, L-lactaldehyde is oxidized to L-lactate by aldehyde oxidoreductase (AldA), which is further oxidized to pyruvate by an FAD-dependent dehydrogenase (LldD) prior to entry into central metabolism. The other 3-carbon intermediate, dihydroxyacetone-P, is converted to pyruvate, which feeds into the Krebs (TCA) cycle. However, under anaerobic conditions, L-lactaldehyde (an intermediate metabolite of both the L-fucose and the L-rhamnose catabolic pathways) is reduced to PPD by FucO, and PPD is then excreted from the cell as a waste product [6,7]. Conceivably, in the absence of oxygen, only dihydroxyacetone-P can be used as an energy source for growth. If PPD is present, the same PPD oxidoreductase, FucO, enables the oxidation of PPD back to L-lactaldehyde, which can be converted to L-lactate and then pyruvate prior to entry into the TCA cycle. However, wildtype E. coli strains fail to metabolize PPD because the fucAO operon is not expressed in the presence of PPD alone. In addition, as an iron (Fe²⁺)-dependent metalloenzyme, FucO is sensitive to oxygen [8,9].

Expression of the fucAO operon relies on the Crp-cAMP complex [10]. As part of the fuc regulon, the fucAO operon is regulated by the regulon regulator FucR as well [11,12,13]. FucR is first activated by its cofactor, fuculose-1-phosphate. FucR, with its cofactor binding, promotes transcription of both fucPIK and fucAO, and also self-activates. However, to date, the binding sites for Crp and FucR have not been identified within the fucAO regulatory region [12]. In addition to Crp and FucR, a recent publication reports that both fucPIK and fucAO operons are positively regulated by SrsR, a newly identified transcription factor. SrsR is involved in regulating gene expression, mainly during the stationary growth phase [14].

When PPD serves as the sole carbon source, the fucAO operon is not induced since fucR, encoding FucR, is insufficiently expressed, and no inducer (fuculose-1-phosphate) is synthesized. Although wildtype E. coli cells are PPD⁻, PPD⁺ (able to grow on PPD) mutants can readily arise after prolonged incubation with PPD. These PPD⁺ mutants carry an IS5 element inserted upstream of the fucAO promoter region. With this insertion, the fucAO operon expression is believed to be “constitutive,” while the fucPIK operon becomes inactive and non-inducible by L-fucose [13,15,16]. However, it is unknown as to the molecular mechanism by which IS5 activates the fucAO operon or whether any host regulatory proteins are involved in IS5 activation of the operon.

Using a predictive computational method, Huerta and Collado-Vides proposed the presence of a σ⁷⁰ promoter (P_fucAO.hc), including a −35 element, a −10 element, and the transcriptional start site (+1), upstream of the fucA start codon [17]. This putative promoter has an unusually long (165 bp) untranslated region (5′UTR) between +1 and the fucA start codon. However, this proposed fucAO operon promoter has never been experimentally verified. In addition to the operon promoter, the fucO gene is driven by a second promoter (P_fucO) nested in the 3′ end of fucA [18]. It is unknown how and to what extent this promoter contributes to fucO transcription; it is also unknown if it is inducible by fuculose-1-phosphate like the fucAO operon promoter.

Here, we first show that the predicted fucAO promoter (P_fucAO.hc) is not a true promoter and that the fucO promoter (P_fucO) is too weak to cause appreciable induction. Then we identify the actual transcriptional start site (+1) for the main fucAO promoter (P_fucAO) (using 5′RACE), which is located at the 63rd nucleotide upstream of the fucA start codon. The fucAO operon is embedded in a chromosomal region that is transcriptionally repressed. The newly identified promoter (P_fucAO) is highly induced by growth on fucose, and its activity depends on FucR and Crp but not SrsR, either during the logarithmic or the stationary growth phase. Two Crp binding sites and two FucR binding sites were identified and functionally validated. The upstream Crp binding site is more important for operon expression than the downstream site. The second FucR binding site, which is closer to the promoter and is upstream of the Crp binding site, plays a greater role in activating the operon. Although both Crp and FucR are needed for full activation of fucAO, we speculate that FucR’s primary function is to facilitate Crp binding, which in turn recruits RNA polymerase and thus initiates transcription.

2. Results

2.1. The fucAO Operon Activities under Both Non-Inducing and Inducing Conditions

We began our studies by determining the fucAO operon activity using a lacZ transcriptional reporter (Figure 2A). This reporter strain, ZZ204 (Table S1), has the lacZ gene with its own ribosome binding site (RBS) integrated downstream of fucO on the chromosome of strain BW25113 deleted for the native lacZ gene, yielding a new operon consisting of fucA, fucO, and lacZ. In this reporter strain, the β-galactosidase activities are proportional to the actual fucAO operon expression levels. This strain is still Fuc⁺, as the fuc regulon is intact.

To determine basal fucAO operon activity under non-inducing conditions, the strain was cultured in minimal M63 medium with glycerol as the sole carbon source. It exhibited 16.6 units of β-galactosidase activity (Figure 2B). This result confirms that the fucAO operon is expressed at low levels in the absence of fucose. On the other hand, fucAO expression is not “silent” (almost completely shut off) under non-inducing conditions since its expression is readily detectable. When the same strain was grown with fucose as the sole carbon source (inducing conditions), operon expression increased 62-fold to 1023 units of β-galactosidase activity (Figure 2B), confirming that the fucAO operon is highly inducible by growth with fucose.

2.2. The fucAO Operon Is Activated by Crp and FucR but Not SrsR

To examine how Crp, FucR, and SrsR affect fucAO operon expression, the transcriptional operon reporter was transferred to strains with △crp (Glp⁺, referring to glycerol positive), △fucR, and △srsR genetic backgrounds, respectively. These strains were cultured in glycerol minimal medium, and the operon activities are summarized in Figure 2C. A 5-fold further decrease in operon expression was seen in the absence of Crp, although the expression was already weak in wildtype cells. This observation reveals that the global regulator Crp is required to maintain even the low-level expression of the fucAO operon under non-inducing conditions. In the absence of FucR, a similar-to-wildtype activity was obtained, consistent with the notion that FucR only activates the fucAO operon under inducing conditions (that is, in the presence of fuculose-1-P). As the △crp strain and the △fucR strain are Fuc⁻, it is impossible to use these deletion strains to determine the effects of Crp and FucR under inducing conditions (Section 2.7 and Section 2.8).

As to SrsR’s effects on fucAO transcription, we first measured the operon activity in exponentially growing cells deleted for srsR. Under non-inducing conditions, fucAO expression was not observably affected as compared with the SrsR⁺ cells (Figure 2C). Under inducing conditions, the loss of SrsR had virtually no effect as well (Figure 2D). We next tested how SrsR impacted fucAO expression in the stationary phase since this regulator is reported to be more abundant in this growth stage. When the strains were cultured with glycerol or fucose for extended periods (at an OD₆₀₀ of 3 to 4), no distinct difference in promoter activity was seen between the wildtype and the ΔsrsR strain (last two columns of Figure 2D).

△srsR cells are Fuc⁺ while △fucR or △crp cells are Fuc⁻. To see if loss of SrsR reduced growth on fucose, growth rate was measured using fucose minimal media. As shown in Figure 2E, no detectable difference was found when SrsR was deleted. Summarizing these results, we conclude that SrsR is not a significant regulator of fucAO, at least under our experimental conditions.

2.3. P_fucAO and P_fucO but Not P_fucAO.hc Contribute to fucAO Operon Expression

As shown in Figure 2A, there are two promoters (P_fucAO and P_fucO) driving fucAO operon expression. To examine the activity of P_fucAO alone, the lacZ gene plus its own RBS was integrated downstream of the 10th codon of fucA. A stop codon was introduced immediately downstream of fucA’s 10th codon (Figure 3A). To determine P_fucO activity, a rrnB terminator (T1) was inserted between P_fucAO and fucA in the operon reporter strain ZZ204 (Table S1), blocking transcription from P_fucAO or any other upstream regions (hypothetical promoters) (Figure 3B). To see if the proposed fucAO promoter P_fucAO.hc had activity, the same lacZ cassette was used to replace the region between −147 and +2372 relative to the fucA start site, which included most of the 5′UTR for P_fucAO.hc and the entire fucAO operon (Figure 3C).

The activities of these three promoters were measured in cells cultured with glycerol. P_fucAO and P_fucO exhibit nearly identical β-galactosidase activities (about eight units per promoter), and both contribute about 50% of the operon activity (16.6 units). However, P_fucAO.hc alone did not show detectable activity (Figure 3D), suggesting that this predicted promoter may not be an actual promoter.

To further characterize these promoters, it was necessary to examine their activities under inducing conditions. Since the strains carrying these individual promoters cannot grow on fucose due to disruption of fucAO, the proposed experiment required the construction of new promoter/lacZ reporters at a different chromosomal locus while maintaining the native fuc regulon intact (Section 2.6).

To see if P_fucO is inducible like P_fucAO, a new P_fucO/lacZ reporter, harboring P_fucO plus fucO’s first 10 residues followed by a stop codon, was moved to the lac locus while the native fucAO was unaltered (Figure 3E). In the presence of fucose, no elevated P_fucO activity was observed (Figure 3F), indicating the fucO promoter present in the 3′ end of fucA is not inducible. As expected, the loss of FucR had no effect on P_fucO activity (Figure 3G). However, without Crp, the activity decreased eightfold in comparison to the wildtype (Figure 3G). Based on these results, we conclude that the fucO promoter (driving fucO only), P_fucO, is very weak and is Crp-dependent but FucR-independent.

Similarly, the P_fucAO.hc/lacZ cassette shown in Figure 3C was moved to the lac locus, leaving the fuc regulon intact. P_fucAO.hc refers to the entire fucPIK/fucAO intergenic region deleted for the 146 bp 3′ end segment (Figure 3H). When this new reporter strain was cultured with glycerol or fucose, P_fucAO.hc still did not display clear promoter activity (Figure 3I). With these results (Figure 3D,I), we conclude that the computer-predicted fucAO promoter, P_fucAO.hc, is not an active promoter.

2.4. Determination of the Transcriptional Start Site (TSS) for the fucAO Promoter

As described above, the promoter P_fucO appears unimportant for fucAO expression, while the formerly predicted fucAO promoter P_fucAO.hc is not an actual promoter. Our next studies focused on identifying and characterizing the true promoter region (P_fucAO) driving fucAO operon transcription, first by determining the transcriptional start site (TSS). To determine the fucA TSS, the wildtype strain, BW25113, was cultured in minimal M63 medium with fucose as the sole carbon source. mRNA and cDNA were prepared using the SMARTer^® RACE 5′/3′ kit (Takara Bio USA). The 5′ portion of the fucA cDNA was amplified using the primer fucA-GSP (Table S2) that specifically binds to the beginning of fucA and the universal primer mix. The PCR products were purified and sequenced using fucA-GSP. Part of the sequencing results are shown in Figure 4A. Instead of an “A” nucleotide (−166 bp from the fucA start codon), we observed that the fucA’s TSS is a “C” nucleotide, located −63 bp upstream of the fucA start codon (Figure 4B).

A σ70 promoter should harbor two well-defined short DNA elements that are situated at about 10 bps and 35 bps upstream of the TSS (the −10 element and the −35 element, respectively) [19]. The consensus sequences are TTGACA (for −35) and TATAAT (for −10), and the distances between these two elements are usually 17 to 18 bps [20]. Based on these features, we proposed two short sequences, “TTGtgA” (−96 to −91 relative to the fucA start codon; consensus nucleotides are capitalized) and “aATtAa” (−73 to −68) upstream of the TSS, to be the −35 element and the −10 element, respectively (Figure 4B). This newly identified fucAO operon promoter, named P_fucAO, includes the −35 element (TTGtgA), the −10 element (aATtAa), and the transcriptional start site +1(C).

There are four Crp-cAMP binding sites present in the fucPIK/fucAO intergenic region (Figure 4B). The first two sites (O_Crp0 and O_Crp1) are near the fucPIK promoter region and are important for Crp activation of this operon [11,21]. Another two Crp-cAMP binding sites (O_Crp2 and O_Crp3), proposed by Tan et al. [22] and Zheng et al. [23], are situated within the fucAO regulatory region. However, these two sites have not been experimentally validated. In a recent study, using a high-throughput binding assay with large amounts of regulatory proteins, Baumgart et al. proposed a FucR binding site (O_FucR2) present in the fucAO regulatory region [24]. Based on the consensus sequence, we found a second FucR binding site, O_FucR3. These putative Crp and FucR binding sites have been functionally validated (Section 2.7 and Section 2.8).

2.5. The fucAO Operon Is Located within a Transcriptionally Repressed Chromosomal Region

As described above, fucAO operon expression is abnormally low (about 16 LacZ units under non-inducing conditions and 1000 units under inducing conditions). To see if such low-level expression is chromosomal loci-dependent, the same P_fucAO/lacZ reporter as shown in Figure 3A was moved to the lac locus while the native fucAO remained unaltered (Figure 5A). Figure 5B shows the chromosomal positions of fucA and lacZ, which are located symmetrically on both sides of the chromosome at a similar distance (about 993 kb) from oriC.

When these reporter strains were cultured with glycerol, P_fucAO at the lac locus yielded 495 units of β-galactosidase activity (Figure 5C), which is 66-fold greater than the same promoter at the native fuc locus (that is, 7.5 units; Figure 3D), indicating that P_fucAO is a fairly “strong” promoter, even under non-inducing conditions. When cells were grown with fucose, the same promoter at the lac locus yielded over 14,500 units of β-galactosidase activity, a 14-fold increase over that obtained at the fuc locus (Figure 5D).

We next tested the activities of P_fucO at both locations. P_fucO plus the first 10 codons were substituted for P_fucAO and fucA’ in Figure 5A. When cultured with glycerol, P_fucO at the lac locus exhibited 5-fold higher activity than at the fuc locus (Figure 5E).

To determine if a promoter unrelated to the fuc regulon promoters behaved like P_fucAO and P_fucO, the strong constitutive promoter P_tet was used to drive lacZ individually at the same fuc and lac loci. As can be seen in Figure 5F, P_tet located at the lac locus exhibited about 3.5 times the activity of the same promoter at the fuc locus. Based on the results shown in Figure 5C–F, we conclude that the fucAO locus is within a chromosomal region that is transcriptionally repressed. The low-level expression at the fuc locus is not due to its distance from the oriC site since both loci (fuc and lac) have similar distances from this site (Figure 1B).

2.6. Defining the Minimal fucAO Regulatory Region Having Full Promoter Activity

From this section on, all the promoter activities were measured using the lacZ reporter situated at the lac locus with the native fuc regulon unchanged. Considering the chromosomal location effects on P_fucAO strengths, β-galactosidase activities obtained at the lac locus should be divided by the factor “66” (that is, 495/7.5) when tested strains were cultured under non-inducing conditions, or the factor “14” (that is, 14,519/1022) under inducing conditions (Figure 5). With such normalizations, the activities shown should reflect the actual promoter activities obtained when present at the fuc locus.

The fucPIK/fucAO intergenic region is 546 bp in length, and it carries two promoters and multiple potential binding sites for SrsR, Crp, and FucR. To delimit the essential region needed for full P_fucAO activity, various sizes of DNA fragments were deleted from the 5′ end of P_fucAO. As shown in Figure 6A, P_fucAO encompasses the entire 546 bp intergenic region while P_fucAO.V8 only carries 123 bp of the 3′ region. Each of these smaller regions was individually substituted for P_fucAO within the transcriptional P_fucAO-lacZ reporter at the lac location (Figure 6B).

The promoter activities of these shorter regions were measured using our standard approaches, as shown in Figure 2, Figure 3 and Figure 5. Under the non-inducing conditions (that is, growing the cells in M63+glycerol), P_fucAO.V2 to V7, which are truncated 60 to 380 bp from the 5′ end, still have similar promoter activities as P_fucAO. However, P_fucAO.V8 almost lost its promoter activity, probably due to the loss of one Crp binding site (O_Crp2).

Under inducing conditions (that is, growing the cells with fucose), P_fucAO.V2 to V5 still maintained promoter activities at levels like P_fucAO. P_fucAO.V6 lost about 30% of this activity, likely due to the missing FucR binding site O_FucR2. P_fucAO.V7, which lacked two FucR binding sites, lost most of its promoter activity. As expected, P_fucAO.V8 (missing both FucR binding sites and Crp binding site O_Crp2) (the last column of Figure 6D) had essentially no activity.

For P_fucAO (and versions V2 to V5), over 60-fold increased promoter activities were seen in the inducing cells compared with the noninducing cells (comparing individual columns in Figure 6C,D). This is consistent with operon expression patterns observed under both conditions (Figure 2B). Based on these results, we conclude: (1) The newly identified fucAO promoter, P_fucAO, is active and highly inducible; (2) P_fucAO.V5 (−270 to −1 relative to the fucA start codon) is the minimal DNA region that still has full promoter activity under both non-inducing and inducing conditions. This region carries the newly identified promoter and all putative FucR and Crp binding sites; (3) The SrsR binding site O_SrsR and the first two Crp binding sites, O_Crp0 and O_Crp1, are not relevant to fucAO promoter regulation; (4) FucR binding sites O_FucR2 and O_FucR3 and Crp binding sites O_Crp2 and O_Crp3 appear to be directly involved in P_fucAO activation.

2.7. Functionally Validating Crp-cAMP Binding Sites within P_fucAO

There are four Crp-cAMP binding sites (O_Crp0, O_Crp1, O_Crp2, and O_Crp3) upstream or downstream of the newly identified P_fucAO promoter (Figure 4B and Figure 6A). O_Crp0 and O_Crp1were shown not to be required for P_fucAO activation (Figure 6C,D). Instead, these sites are important for Crp regulation of the fucPIK operon [21]. The consensus sequences for Crp binding sites are “aaaTGTGAtctagaTCACAttt” (two binding motifs are in bold and capitalized). O_Crp2 with the sequence “ttagtTGAaccaggTCACAaaa” (nucleotides mismatched to the consensus in binding motifs are in the lower case) is located immediately upstream of the −35 element) while O_Crp3 (tagTGTGAaaggaacaACAtta) is situated in the 5′UTR of P_fucAO. These putative binding sites (O_Crp2 and O_Crp3) have never been functionally validated.

To see if O_Crp2 is important for Crp regulation in P_fucAO, we mutated this site by changing its sequence in P_fucAO.V5 to ttagtctaaccaggcgctgaaa (the altered nucleotides are underlined) (Figure 7A). The promoter activities were measured and recorded in Figure 7. When cultured with glycerol, mutation of O_Crp2 yielded a 14-fold reduced promoter activity, nearly abolishing the basal-level activity detected under noninducing conditions (Figure 7B). When cultured with fucose, the same observation was made with the O_Crp2 mutation, leading to a 350-fold reduction (Figure 7C). These results clearly show that Crp binding site O_Crp2 is a true and essential DNA binding site for Crp-cAMP activation of P_fucAO.

We next mutated the O_Crp3 site by changing its sequence to taggcctcaaggaacagattta (the altered nucleotides are underlined). With these alterations, a moderate 30% reduction in activity was observed under either non-inducing conditions (Figure 7B) or inducing conditions (Figure 7C). These results show that O_Crp3 is likely another Crp-cAMP binding site, but it is not as important as O_Crp2 in modulating P_fucAO activity. Interestingly, this O_Crp3 site is located within the 5′UTR of P_fucAO, an unusual feature (see Section 3).

2.8. Identifying and Validating FucR Binding Sites within P_fucAO

Using a high-throughput in vitro protein:DNA binding assay, Baumgart et al. (2021) proposed the binding motif for FucR with the consensus sequence: G(A)C(T)C(G)A(C)A(G)A(TC)A(T)CGGT(G)CAT(A)T(CG), where the bold nucleotides CGG and CA are most conserved [24]. This approach involves protein:DNA binding assays using a large amount of each transcriptional factor of interest and a mixture of genomic DNA fragments. A putative FucR binding site, O_FucR2, was identified (Figure 4B and Figure 6A) [24]. Based on the consensus sequences, we found a second FucR binding site, O_FucR3, upstream of P_fucAO (Figure 4B and Figure 6A). These two putative FucR binding sites had not been functionally characterized.

To determine whether O_FucR2 and O_FucR3 upstream of P_fucAO are true binding sites for FucR, we first mutated O_FucR2 by changing its sequence (CCGAAAACGGTCATT) to CCGAAACGTTTGCTT (the altered nucleotides are underlined) in P_fucAO.V5 (Figure 8A). With such alterations, the promoter activity was negligibly changed when the strains were grown with glycerol as the carbon source, and this was expected since the fucR gene was not appreciably transcribed and the cofactor L-fuculose-1-P is not available in the absence of fucose. When the cells were cultured with fucose, the promoter activity was moderately (about 30%) decreased as compared with the wildtype promoter. These results show that O_FucR2 is a true binding site for FucR but does not play a major role in fucAO regulation under the conditions used here.

Next, we determined the role of the binding site O_FucR3 in regulating P_fucAO. The sequence (TTAAGAGCGGTCATT) of this site was changed to TTAAGAGGTTCGCTT (the altered nucleotides are underlined; Figure 8A). As expected, the loss of O_FucR3 was essentially without effect on promoter activity when the cells were grown on glycerol (Figure 8B). However, when the cells were grown with fucose, the same mutation dramatically lowered the promoter activity by over 50-fold (Figure 8C). These results show that the binding of cofactor-bound FucR to the second site, O_FucR3, is more important than to the first site, O_FucR2, for the activation of P_fucAO. It is worthwhile to note that the FucR binding site, O_FucR3, is closer to the Crp binding site, O_Crp2, that is essential for Crp activation of P_fucAO.

3. Discussion

The fucAO operon encodes two important enzymes: a fuculose aldolase and a propanediol oxidoreductase, both of which are involved in the bacterial utilization of L-fucose and L-1,2-propanediol. Contrary to the fucPIK operon (the other operon within the fuc regulon) and many other sugar metabolic operons in E. coli, the fucAO operon has not been well studied, especially with respect to its transcriptional regulation. We know that its expression relies on the presence of L-fuculose-1-P, the fuc regulon regulator, FucR, and the global activator, Crp. However, little is known as to the actual promoter region and how these regulators activate the fucAO operon. In this work, we identified and confirmed the true primary promoter (P_fucAO), driving fucAO operon transcription, while refuting the hypothetical promoter (P_fucAO.hc), predicted by a computer program, which has long been used by ecocyc.org. Meanwhile, we found that the fucO promoter nested within the fucA gene is weak and uninducible, thus being unimportant for operon expression. Two Crp-cAMP binding sites and two FucR binding sites were functionally validated. The second FucR binding site and the first Crp binding site (adjacent to each other) are essential for operon expression, while the other two FucR and Crp sites are needed only for maximal operon expression. Furthermore, we provided evidence that the fucAO operon is located within a chromosomal region that is transcriptionally repressed.

Wildtype strains of E. coli commonly used in laboratories are unable to utilize propanediol for aerobic growth (PPD⁻) because the fucAO operon has long been thought to be “silent” when only PPD is present as a carbon source [12,17]. However, using a sensitive transcriptional operon lacZ reporter, we showed that the operon is expressed at a detectable level (over 16 units of β-galactosidase activity yielded from both P_fucAO and P_fucO) in the absence of fucose in the growth medium (i.e., noninducing conditions). Compared with the silent bglGFB operon (<1 unit of β-galactosidase activity) [25,26,27], the fucAO operon is not “silent.” To aerobically grow on PPD, propanediol oxidoreductase (FucO) is needed in large amounts. This iron (Fe²⁺)-dependent enzyme is only catalytically active under anaerobic conditions due to the loss of Fe²⁺ in the presence of oxygen [10,28]. The negative aerobic growth of wildtype cells on PPD may not only result from the low amount of propanediol oxidoreductase synthesized but also from the catalytic inactivation of the enzyme by oxidation. IS5 insertional mutants are capable of aerobic growth on PPD minimal agar plates, probably due to the presence of a large amount of the oxidoreductase, which is still adequate for cellular growth after being partially inactivated by metal-catalyzed oxidation. In addition, it is known that growing bacterial cells on agar plates can readily generate local anaerobic or micro-anaerobic conditions inside the colony [29,30]. On the other hand, leaky expression might be physiologically relevant, as the cells are always prepared for the presence of fucose or IS5 insertional activation of the fucAO operon when PPD is the only carbon source present.

The fucAO promoter (Figure 4B), long used by ecocyc.org, was predicted by a computer program [1]. We showed that this promoter has no activity under either inducing or noninducing conditions (Figure 3). The first two Crp binding sites (O_Crp0 and O_Crp1) upstream of the predicted promoter are not relevant to fucAO operon activation (Figure 6). The other two Crp binding sites (O_Crp2 and O_Crp3), confirmed to be important for Crp activation of the operon as revealed by this study, are unusually located in the 5′UTR of the predicted promoter used in EcoCyc. In addition, the second FucR binding site, O_FucR3, overlaps the -35 element. Based on these features, it appears impossible for Crp and FucR to activate the fucAO operon by binding to these functionally validated sites, consistent with our conclusion that the predicted promoter indicated in EcoCys is not a true promoter.

In this work, we confirmed that FucR and Crp are strong dominant regulators that activate the fucAO operon. Meanwhile, our data disprove that SrsR directly regulates the operon in either exponentially growing cells or stationary-phase starving cells. Huerta and Collado-Vides [1] found a SrsR binding site present in the 5′UTR of the fucPIK promoter (Figure 4B). However, the presence of this site had not been functionally verified. If this is a valid SrsR binding site, it is unknown how it can elevate the transcription of the fuc regulon. Nevertheless, we cannot completely rule out the possibility that SrsR directly or indirectly affects the expression of both or one of the fucPIK and/or fucAO operons under certain unknown conditions. In the case that SrsR does enhance the fucPIK operon expression, it may indirectly impact the fucAO operon in the presence of fucose since part of fucR expression is driven by the fucPIK promoter.

As described above, the fucAO operon is not “silent,” even in the absence of fucose. In the current study, we showed that this leaky expression is attributed to the presence of Crp, not FucR, since the loss of Crp abolished expression while the loss of FucR had essentially no effect. In the presence of fucose, it is known that fuculose-1-P bound to FucR dramatically elevates operon expression, but our data indicate such an activation is dependent on Crp. When the upstream Crp binding site was mutated, the same activated FucR failed to promote operon expression (Figure 7), indicating that the presence of Crp bound to P_fucAO is essential for FucR activation of the operon.

Crp regulates at least 180 promoters by binding to one or more 22-bp symmetrical sites with the consensus core half-site TGTGA [23,31,32,33]. Once bound to DNA, Crp directly recruits RNA polymerase to promoters via the formation of the “Crp-αCTD-DNA complex,” thereby initiating transcription [34,35,36,37]. Many Crp-dependent promoters are co-regulated by one or more other factors bound to DNA sites near Crp sites. These coregulators affect Crp binding, either by modifying the local DNA conformation or by increasing the local Crp concentration through direct protein-protein contacts [23,38,39]. In the case of P_fucAO, the binding of FucR likely facilitates the binding of Crp to its sites, which in turn recruits RNA polymerase to the promoter region. Without FucR bound to the nearby upstream region, Crp appears to occupy its sites less efficiently, probably due to the presence of a local DNA structure. Alternatively, DNA-bound FucR might recruit Crp to P_fucAO by direct binding.

Based on these observations, we propose a modulation mechanism as follows: Crp-cAMP is the deterministic regulator, dictating the expression of the fucAO operon under both noninducing and inducing conditions. In the absence of fucose, FucR is scarce and has no DNA binding capability due to the lack of the cofactor, fuculose-1-P. In this case, Crp inefficiently binds to P_fucAO due to a local DNA conformation and maintains operon transcription at a basal level. In the presence of fucose, FucR is abundant and activated. When bound to the DNA, FucR facilitates Crp binding to P_fucAO via alteration of the local DNA conformation or direct protein-protein interactions, which in turn recruits RNAP to P_fucAO to initiate transcription.

Our work showed that Crp binding to the upstream O_Crp2 site was vital for fucAO transcription, as mutations of this site abolished operon expression. As shown in Figure 4B, a second binding site, O_Crp3, is present downstream of P_fucAO. When this site was mutated, operon expression only slightly decreased, by about 30%. These results indicate that this downstream binding site is not essential for operon transcription, but simultaneous bindings of Crp to both sites are required for maximal transcription. In addition, we showed that Crp binding to this downstream site alone (in the absence of the upstream site) did not affect operon activity, suggesting that this downstream site only plays an accessory role and that its function depends on Crp binding to the upstream site. Another possibility is that Crp is incapable of binding to O_Crp3 in the absence of Crp bound to the upstream site, probably due to an intrinsic DNA structure. It is unknown why Crp can promote fucAO expression by binding to a downstream site and how Crp maximizes operon expression by binding to these two sites flanking P_fucAO. In some cases, Crp is able to activate promoters by binding to a downstream 5′UTR region [38,40,41]. Similarly, several other global transcriptional factors, such as ArcA and SoxR, have been reported to activate gene expression by binding to one or more regions downstream of their promoters [42,43]. Alternatively, Crp binding to O_Crp3 located at 5′UTR might have enhanced the mRNA stability, thereby increasing translation efficiency.

Two FucR binding sites were identified and functionally validated in this study. The second site, O_FucR3, is critical, as the loss of this site terminates FucR-mediated induction of the fucAO operon. The first site, O_FucR2, located upstream of O_FucR3, plays a secondary role in operon induction, as its mutation only leads to a 30% reduction in operon expression. As shown in Figure 4B, O_FucR3 is adjacent to the upstream Crp binding site O_Crp2, while O_FucR2 is far away. Conceivably bound to O_FucR3, FucR more readily recruits Crp to P_fucAO. Simultaneous bindings of either FucR or Crp to their two sites in P_fucAO are needed in order to further promote operon transcription.

Our study revealed that the same fucAO promoter was significantly more active at the lac locus than its native locus under both noninducing and inducing conditions. Similar observations were made when using the promoter P_fucO (a weak native promoter) and the promoter P_tet (a strong constitutive promoter). Genes near the origin of replication (oriC) generally have higher expression levels due to increased dosages [44,45,46]. However, the different activities for P_fucAO appear not to be due to the distance of these two loci from the oriC (Figure 5). The E. coli nucleoid is highly compact, and its organization is mediated by DNA supercoiling, macromolecular abundance, and six major nucleoid-associated proteins (NAPs), leading to the formation of multiple topologically isolated loops [47,48,49,50]. Vora et al. reported the presence of transcriptionally silent domains distributed across the chromosome, and these domains overlap with the genomic regions densely bound by NAPs [49]. Furthermore, gene silencing within these regions is predominantly attributed to the abnormally low levels of transcription mediated by DNA structuring proteins (that is, not due to weak promoters) [51]. The fucAO operon may be situated within such a transcriptionally silent chromosomal domain. As a major NAP, H-NS has been reported to impede fucAO operon expression [52]. H-NS preferentially binds to AT-rich DNA regions. The strong repression might be attributed to the direct binding of H-NS to the fucAO regulatory region, which is highly A/T rich (64.3% AT content for the fucPIK/fucAO intergenic region and 67.5% for the fucAO regulatory region from −276 to −34 with respect to +1). H-NS exerts its repressive effect on transcription by reinforcing supercoiled structures of local chromosomal DNA by simultaneously binding to two or multiple target sites and subsequently looping them together, thus trapping RNAP at or excluding it from the promoter [27,53,54,55]. This could be the case for H-NS repression of the fucAO operon. More studies are needed to examine how the fucAO locus is transcriptionally silenced.

In conclusion, we have provided a detailed study on transcriptional regulation of the fucAO operon by identifying and validating the true primary promoter and the binding sites for two major activators, Crp and FucR. Operon expression is exclusively dependent on Crp, while FucR, once activated and bound to DNA, appears to favor the binding of Crp to the promoter, thus recruiting RNA polymerase to initiate transcription. Further studies are needed to answer why Crp must bind to both upstream and downstream sites to maximize operon expression, to see if Crp binding to the downstream O_Crp3 site promotes mRNA stability, and to examine the molecular mechanisms by which Crp and FucR coordinate each other’s effects in activating the fucAO promoter. Furthermore, it will be of interest to investigate how the fucAO operon is silenced at its native locus since the promoter is more active at another chromosomal location.

4. Materials and Methods

4.1. E. coli Strains and Growth Conditions

Bacterial strains and plasmids used in this study are described in Supplementary Table S1. All test strains were derived from E. coli K12 strain BW25113 [56]. Using the Lambda-Red recombination system [56], the chromosomal region carrying the lacI, lacZ, and lacY genes was first replaced by a kanamycin marker (km^r) that was subsequently flipped out by pCP20, yielding strain ZZ200. Similarly, the fucR gene and the srsR gene were deleted from ZZ200, yielding strains ZZ201 and ΔZZ202, respectively. The lacIZY mutation was transferred to strain Δcrp Glp⁺ (able to utilize glycerol) [57], yielding strain ZZ203. The primers used in this study are listed in Supplementary Table S2.

To genetically modify E. coli strains, they were routinely cultured in LB media with one or two appropriate antibiotics at 30 °C or 37 °C. To measure the fucAO promoter or operon activities, test strains were cultured in M63 minimal media with either 0.5% (w/v) glycerol or 0.5% (w/v) L-fucose as the carbon source. The 10× M63 salt solution contains 15 mM (NH₄)₂SO₄, 100 mM KH₂PO₄, and 0.02 mM FeSO₄·7H₂O. After diluting to 1× M63 medium, it was supplemented with 10⁻⁴% thiamine (w/v) and 1.7 mM MgSO₄. When necessary, ampicillin, kanamycin, and chloramphenicol were added to the media at 100 μg/mL, 25 μg/mL, and 10 μg/mL, respectively.

4.2. Construction of the fucAO Operon Transcriptional LacZ Reporter at the fuc Locus

The lacZ structural gene plus its upstream ribosome binding site (RBS), which is CACAGGAAACAGCT, was amplified from the genomic DNA of strain MG1655. A cat gene (encoding chloramphenicol resistance) with its constitutive promoter (P_cat) was amplified from pZA31 [58]. Using fusion PCR, these two fragments were combined by fusing the 3′ end of lacZ to the 5′ end of P_cat, yielding a fusion fragment “lacZ:cat” (note: lacZ has its own RBS and cat has its own promoter). Using the Lambda-Red system, the “lacZ:cat” cassette was chromosomally integrated downstream of fucO in strain ZZ200 to substitute for a 15-bp region (tgatgtgataatgcc) between the 5th and the 22nd nucleotides relative to the fucO stop codon. This yielded the transcriptional reporter strain ZZ204, in which fucA, fucO, and lacZ form an operon driven by the fucAO operon promoter (P_fucAO) upstream of the fucA gene. In addition, among this “fucA:fucO:lacZ” operon reporter, genes fucO and lacZ are driven by the fucO promoter (P_fucO) located in the 3′ end of fucA [18] as well (Figure 2A). As expected, the reporter strain remains fucose-positive (Fuc⁺) since the fuc regulon was unchanged.

To test the dependence of fucAO expression on Crp, FucR, and SrsR, the fucAO transcriptional operon reporter was individually transferred to deletion mutants Δcrp Glp⁺ [57], ΔfucR, and ΔsrsR, yielding strains ZZ205, ZZ206, and ZZ207, respectively.

4.3. Construction of Chromosomal Promoter-LacZ Reporters at the fuc Locus

To determine the activity of the main promoter (P_fucAO) driving expression of the fucAO operon, the “lacZ:cat” cassette (note: lacZ has its own RBS) was moved immediately downstream of the 10th codon of fucA (referred to as fucA’) while the remaining part of fucAO was deleted. A stop codon, TAA, was introduced between fucA’ and lacZ. This yielded strain ZZ208, in which fucA’ and lacZ form an operon driven by P_fucAO alone at the native fuc locus (Figure 3A).

To test the activity of P_fucO alone, a rrnB terminator (T1) was inserted between P_fucAO and fucA. Briefly, the region for km^r and T1 was amplified from plasmid pKDT [26]. The PCR products were gel purified and subsequently integrated immediately upstream of the beginning of fucA in strain ZZ204. The km^r gene was flipped out, yielding strain ZZ209, in which fucO and lacZ are driven only by P_fucO since P_fucAO is blocked by the rrnB terminator T1 (Figure 3B).

To see if the proposed fucAO promoter P_fucAO.hc is active, the same “lacZ:cat” cassette was substituted for the region of −147 to +2372 with respect to the fucA start site, including most parts of the 5′UTR and the entire fucAO operon. This yielded strain ZZ210, in which P_fucAO.hc alone drives lacZ at the fuc locus (Figure 3C). It is worthwhile to note that these three promoter lacZ reporters are Fuc⁻ due to the lack of the fucAO operon.

4.4. Construction of Chromosomal Promoter-LacZ Reporters at the lac Locus

To further characterize these promoters, the same three promoter lacZ transcriptional reporters described in Section 4.3 were individually moved to the lac locus while leaving the native fuc regulon intact. With these strains, promoter activities can be examined under both noninducing and inducing conditions. To construct P_fucAO driving lacZ at the lac locus, the cassette “P_fucAO-fucA’-lacZ” shown in Figure 3A was moved to the lac locus. Briefly, the entire fucPIK/fucAO intergenic region plus the first 10 codons of fucA (that is, −546 to +30 with respect to the fucA start site) followed by a stop codon was cloned into pKDT, yielding pKDT-P_fucAO (Table S1). The “km^r:T:P_fucAO” cassette (containing the first 10 fucA codons and a stop codon) was integrated upstream of the 14th nucleotide with respect to the lacZ translational start site in strain MG1655 deleted for lacY [59], replacing the lacI gene and the lacZ promoter. The reporter was transferred to BW25113, yielding strain ZZ211, in which P_fucAO alone drives lacZ transcription at the lac locus while the native fuc regulon is unchanged (Figure 5A).

Similarly, seven shorter promoter versions (−480 to +30, −377 to +30, −339 to +30, −270 to +30, −206 to +30, −166 to +30, and −123 to +30 relative to the fucA start site) with various truncations from the 5′ end of P_fucAO were individually substituted for P_fucAO in the P_fucAO-lacZ reporter cassette at the lac locus, yielding strains ZZ212, ZZ213, ZZ214, ZZ215, ZZ216, ZZ217, and ZZ218, respectively. These resultant strains harbor promoters P_AO.V2, P_AO.V3, P_AO.V4, P_AO.V5, P_AO.V6, P_AO.V7, and P_AO.V8 that individually drive lacZ at the lac locus (Figure 6A,B).

To construct P_fucO driving lacZ at the lac locus, the region of −449 to +30 with respect to the fucA start site (carrying P_fucO and the first 10 codons of fucO followed by a stop codon) was cloned into pKDT, yielding pKDT_P_fucO (Table S1). The “km^r:T:P_fucO” cassette was inserted into the same position as ZZ211 in strain MG1655ΔlacY and subsequently transferred to BW25113, yielding strain ZZ219, in which P_fucO alone drives lacZ transcription at the lac locus (Figure 3E).

To construct P_fucAO.hc driving lacZ at the lac locus, the region from −546 to −147 relative to the fucA translational site was amplified from pKDT_P_fucAO and then inserted into the same lac position as for P_fucAO in ZZ211. The reporter was transferred to BW25113, yielding strain ZZ220, in which P_fucAO.hc alone drives lacZ at the lac locus.

4.5. Determining Transcriptional Start Sites Using SMARTer^® RACE 5′/3′ Kit

To prepare total RNA, strain BW25113 was shaken at 37 °C in M63 minimal media with 0.5% fucose as the sole carbon source. At OD₆₀₀ of about 1.0, a 600 μL culture was vortexed with 1.2 mL RNAprotectTM Bacteria Reagent (Qiagen, Hilden, Germany) in a 2.0 mL microcentrifuge tube. After 5 min of incubation at room temperature, the mixture was centrifuged at 5000 rpm for 10 min, and the pellet was air dried for 5 min before being frozen at −20 °C. A NucleoSpin^® RNA Kit (Takara Bio, San Jose, USA) was used to extract total RNA from the frozen cell pellet. The pellet was first lysed with lysozyme (1 mg/mL) and subsequently bound to the NucleoSpin Filter. The NucleoSpin filter was desalted, treated with the provided rDNase (to remove residual DNA), washed, and dried prior to RNA elution with RNase-free deionized water. The eluted total RNA samples were stored at −80 °C, and the absorbance ratios 260/280 and 260/230 of the eluted RNA samples were measured using a NanoDrop 1000 (Thermo Fisher, Waltham, USA) to ensure RNA purity.

mRNA was extracted using a MICROBExpress^TM Bacterial mRNA Purification Kit (Invitrogen). The total RNA sample was thawed slowly on ice, mixed with 100% ethanol, and centrifuged (12,000 rpm for 30 min) at 4 °C. The resulting RNA pellet was washed three times using 70% ethanol, air dried, and dissolved in 15 μL TE buffer (containing 10 mM Tris-HCl and 1 mM EDTA at pH 8.0). RNA was then introduced to the provided binding buffer with Capture Oligo Mix. The mixture was incubated at 70 °C for 10 min and 37 °C for 30 min to denature the 16S and 23S rRNAs and facilitate hybridization of the rRNAs to capture oligonucleotides. The mixture was combined with the MagBeads and incubated for 15 min at 37 °C to allow the MagBeads to anneal to the hybridized oligonucleotides bound to the rRNA. The MagBead slurry was then placed in a magnetic stand to draw the MagBeads from the solution, leaving supernatant. The mRNA present in the supernatant was precipitated using 5 mg/mL glycogen, 3M sodium acetate, and 100% ethanol. After centrifugation (13 K rpm, 30 min), the mRNA pellet was washed (with 70% ethanol), air dried briefly, and dissolved in nuclease-free deionized water. The concentration and purity of the mRNA samples were determined by measuring their absorbance ratios 260/280 and 260/230 before storing them at −80 °C.

5′RACE was performed using the SMARTer^® RACE 5′/3′ kit (Takara Bio USA). First, to synthesize first-strand cDNA, the extracted mRNA sample was combined with a random hexamer mixture that binds to the mRNA. The mixture was incubated at 72 °C for 3 min and then 42 °C for 2 min. A buffer containing RNase inhibitor, Reverse Transcriptase, and SMARTer II Oligonucleotide (all provided) was added to the mixture which was subsequently incubated at 42 °C for 90 min and then 70 °C for 10 min. The resulting mixture (first-strand cDNA) was diluted with tricine-EDTA buffer. After dilution, the first-strand cDNA was combined with a PCR master mix, 5′ gene-specific primer (that is, GSP-fucA-R) (Table S2), and the universal primer mix for amplification. PCR products (that is, amplified cDNA) were purified by gel electrophoresis, and the purified cDNA was subsequently submitted for sequencing. The first nucleotide immediately downstream of the SMARTer II Oligonucleotide sequence is the transcriptional start site (+1) of the target gene.

4.6. Alteration of Crp and FucR Binding Sites within the fucAO Regulatory Region

Crp and FucR are the primary regulators activating fucAO operon expression. There are two Crp binding sites (O_Crp2 and O_Crp3) and two FucR binding sites (O_FucR2 and O_FucR3) identified within the fucAO regulatory region (Figure 4B and Figure 6A). Thus far, these binding sites have not been validated. The “P_AO.V5-lacZ” reporter cassette harbored in strain ZZ214 was employed for examining the functions of these binding sites, as the promoter P_AO.V5 carries all the binding sites and has full promoter activity under both noninducing and inducing conditions. Fusion PCR was used to mutate these sites by changing some key nucleotides within the binding motifs. P_AO.V5 was divided into two separate fragments with a short (about 30 bp) overlapped region in between. The nucleotides to be altered were included in the overlapped region. These two fragments were ligated by fusion PCR, yielding a fusion product with the desired altered nucleotides on the binding sites.

The consensus sequence for Crp binding sites is “aaaTGTGAtctagaTCACAttt” (two binding motifs are in bold and capitalized). To mutate O_Crp2 with the sequence “ttagtTGAaccaggTCACAaaa” (the motif nucleotides matching the consensus ones are capitalized), 8 nucleotides within two binding motifs were replaced by other nucleotides, resulting in the sequence “ttagtctaaccaggcgctgaaa” (the altered bases are underlined). To mutate O_Crp3, its sequence “tagTGTGAaaggaacaACAtta” was changed to “taggcctcaaggaacagattta,” in which 8 nucleotides were altered. These two modified P_AO.V5 versions with mutated O_Crp2 and O_Crp3 were substituted for P_AO.V5, first in plasmid pKDT-P_AO.V5 and then in strain ZZ215, yielding strains ZZ221 and ZZ222, in which lacZ is exclusively driven by P_AO.V5 with mutated O_Crp2 (for ZZ221) or O_Crp3 (for ZZ222).

The proposed binding motif for FucR has the consensus sequence “G(A)C(T)C(G)A(C)A(G)A(TC)A(T)CGGT(G)CAT(A)T(CG)”, where the bold nucleotides CGG and CA are most conserved [24]. Based on this consensus sequence, two FucR binding sites (O_FucR2 and O_FucR3) were identified with respective sequences as “ccgaaaaCGGtCAtt” and “ttaagagCGGtCAtt” (Figure 4B). Using the same strategy as above, these binding sites were altered by respectively changing their sequences to ccgaaacgtttgctt and ttaagaggttcgctt (the altered nucleotides are underlined) in P_AO.V5. These modified P_AO.V5 with the mutated FucR binding sites were substituted for P_AO.V5 in strain ZZ215, yielding strains ZZ223 and ZZ224, in which lacZ is exclusively driven by P_AO.V5 with mutated O_FucR2 (for ZZ223) or O_FucR3 (for ZZ224).

4.7. β-Galactosidase (LacZ) Activity Assay

To prepare samples for β-galactosidase (LacZ) assay, a fresh colony from the reporter strain of interest was cultured in 5 mL of LB media at 37 °C with shaking for about 6 h. 30 μL of the culture was transferred to another tube containing 3 mL of collection media. In this study, the collection media used were M63 minimal media with 0.5% glycerol (noninducing conditions) and M63 minimal media with 0.5% fucose (inducing conditions). The M63 culture was then left to grow overnight at 37 °C with shaking. The next day, a specific amount of overnight culture (preculture) was inoculated into 5 mL of the same collection medium to OD₆₀₀ of 0.02, and the new culture was grown at 37 °C with shaking. During the exponential growth phase, at least four samples were collected at OD₆₀₀ between 0.2 and 1.0. Collected samples were immediately frozen at −20 °C prior to the assay.

To measure the β-galactosidase (LacZ) activities, the previously collected samples were first thawed to room temperature. Then 200 μL of sample, 800 μL of Z-Buffer, and 25 μL of chloroform were combined in a small glass tube and vortexed twice at 10 s each. The sample tubes were placed into a water bath incubator and warmed to 37 °C. To initiate the reaction, 200 μL of prewarmed o-nitrophenyl-β-D-galactopyranoside (β-ONPG) at 4 mg/mL was added to each sample. After a yellow color was visibly developed, 0.5 mL of 1M sodium carbonate was added to each sample and vortexed to stop the reaction. The reaction mixture was appropriately diluted and then centrifuged for 2.5 min at 15,000 rpm. Absorbance values of the prepared reaction mixtures were measured at 420 nm and 550 nm. The β-galactosidase activity (Miller units) for each sample was then calculated using the formula: [1000 × (OD₄₂₀ − 1.75 × OD₅₅₀) x Dilution factor]/[Time of reaction (min) × Volume of sample (mL)] [60]. The slope of LacZ activities in Miller units versus ≥4 collected OD₆₀₀ values represented the reporter strain activity. The final β-galactosidase activity for each strain was the average of at least three repeats (that is, at least 12 samples per strain).

4.8. Growth Rate Measurement

One fresh colony of the test strain was cultured in LB with shaking for 8 h. 20 μL of the culture was transferred to 3 mL M63 minimal medium with 0.5% fucose. After overnight growth with shaking at 37 °C, an appropriate amount of the culture was inoculated into 5 mL of the same M63 + fucose medium within a glass tube at the initial OD₆₀₀ of 0.01. The tube was shaken (250 rpm) at 37 °C. In the range of OD₆₀₀ from 0.1 to 1, five or more samples were taken at various time intervals for OD₆₀₀ measurements. The slope of OD₆₀₀ in log values versus time (minutes) represents the growth rate (that is, time per doubling).

4.9. Statistical Analysis

All β-galactosidase activity data are expressed as mean ± standard deviation (SD). Statistical significance was tested by either two-sample t-test (for 2 treatments) or 1-way ANOVA followed by Tukey Kramer’s post hoc test (for ≥3 treatments). All figures and β-galactosidase activities were generated using Microsoft Excel (Version 16.66.1) or RStudio (Version 2023.12.0 + 369 “Ocean Storm” Release for Windows). Details of the statistical tests used are indicated in the figure legends. Sample size details are described in Section 4.7 and the legend of Figure 2. Between each of two treatments shown in figures dealing with ≥3 treatments, different lowercase letters marked above the bar graphs represent statistically significant differences at p-values < 0.05, while the same letters represent no significant differences at p-values > 0.05.