Next Article in Journal
HPV16-Genotyper: A Computational Tool for Risk-Assessment, Lineage Genotyping and Recombination Detection in HPV16 Sequences, Based on a Large-Scale Evolutionary Analysis
Previous Article in Journal
Experimental Evaluation of δ2H, δ13C and δ15N Variability in Blood and Feathers of Wild and Captive Birds: Implications for Interspecific Food Web Studies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 13
Issue 10
10.3390/d13100496
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Haplogroup Distribution of 309 Thais from Admixed Populations across the Country by HVI and HVII Sanger-Type Sequencing

by
Prapatsorn Areesirisuk
1,2,†,
Kornsorn Srikulnath
2,3,4,†,
Preyaporn Onsod
1,
Juthamas Jaroensuk
5 and
Budsaba Rerkamnuaychoke
1,*
1
Human Genetic Laboratory, Department of Pathology, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok 10400, Thailand
2
Animal Genomics and Bioresource Research Center (AGB Research Center), Faculty of Science, Kasetsart University, Bangkok 10900, Thailand
3
Special Research Unit for Wildlife Genomics (SRUWG), Department of Forest Biology, Faculty of Forestry, Kasetsart University, Bangkok 10900, Thailand
4
National Primate Research Center of Thailand, Chulalongkorn University (NPRCT-CU), Saraburi 18100, Thailand
5
School of Biomolecular Science and Engineering, Vidyasirimedhi Institute of Science and Technology (VISTEC), Rayong 21210, Thailand
*
Author to whom correspondence should be addressed.
†
Prapatsorn Areesirisuk and Kornsorn Srikulnath are joint first authors.
Diversity 2021, 13(10), 496; https://doi.org/10.3390/d13100496
Submission received: 30 August 2021 / Revised: 11 October 2021 / Accepted: 12 October 2021 / Published: 14 October 2021
Browse Figures
Versions Notes

Abstract

:
The mitochondrial DNA (mtDNA) control region sequences for the hypervariable regions I (HVI) and II (HVII) of 309 Thai citizens were investigated using Sanger-type sequencing to generate an mtDNA reference dataset for forensic casework, and the haplogroup distribution within geographically proximal Asian populations was analyzed. The population sample set contained 264 distinct haplotypes and showed high haplotype diversity, low matching probability, and high powers of discrimination, at 0.9985, 0.4744%, and 0.9953, respectively, compared with previous reports. Subhaplogroup F1a showed the highest frequency in the Thai population, similar to Southeast Asian populations. The haplotype frequencies in the northern, northeastern, and southern populations of Thailand illustrate the relevance of social, religious, and historical factors in the biogeographical origin of the admixed Thai population as a whole. The HVI and HVII reference datasets will be useful for forensic casework applications, with improved genetic information content and discriminatory power compared to currently available techniques.

1. Introduction

The analysis of human mitochondrial DNA (mtDNA) has been conducted globally in recent years, following the standard forensic casework guidelines using Sanger-type sequencing (STS) [1,2,3,4,5]. Compared with the nuclear genome, high copy numbers of mtDNA are observed within the cell, leading to an increased likelihood of recovering useable mtDNA data [3,6]. The mtDNA typing of hairs, saliva, and bone samples collected at crime scenes is frequently used as the DNA-based testing option [1,3,7,8,9,10]. The power of mtDNA typing to discriminate between individuals based on maternal inheritance is limited, with a lack of recombination, but mtDNA is frequently applied in routine forensic applications [7,11]. The noncoding control region is most suited for mtDNA typing and shows a high degree of genetic variability at the population level [8]. Historically, mtDNA typing has focused on the 342 bp (16,024–16,385) hypervariable region I (HVI), and the 268 bp (73–340) HVII, with reference to the human mtDNA genome sequence (GenBank accession number: NC_012920.1) [3,12,13,14,15]. The probability of previously reported mtDNA from two random individuals matching in these regions is between 1 and 2% [8,16,17]. The Tsunami disaster on December 24, 2004 resulted in the deaths of nearly 5400 people in Southern Thailand [18]. Identification of the victims was conducted based on HVI and HVII sequences, with a success rate of 51% [18]. The HVI and HVII regions have also been used to identify the remains of Italian and Austrian soldiers killed during World War I, which are found occasionally during excavations [19]. mtDNA techniques have been adopted as the global standard forensic protocols by the International Society for Forensic Genetics [20], while an mtDNA dataset has been developed and applied to examine the compatibility between individuals as a reference database in several countries [8,16,21,22,23,24,25,26,27]. The polymorphisms of both HVI and HVII are also useful for addressing human evolution, migration, and the history of population descent by direct comparison with a haplogroup database [28,29].
Four macro haplogroups (L, M, N, and R), and 25 major haplogroups (L0, L1, L5, L2, L6, L4, L3*, M*, M7, M8, M9, G, D, N*, N1, N2, N9, A, X, R*, R0, JT, R9, B and U) comprise a total of more than 5400 haplogroups, with over 5000 subhaplogroups [30]. The distribution of macro haplogroup L, and the major haplogroups, L0, L1, L2 and L3, were reported in Africa [24]. The majority of the haplogroups in Asian populations are the macro haplogroups M and N, with subhaplogroups. F1a was found in Chinese and Southeast Asian populations, while M9a and D4 were predominantly detected in Chinese and Korean populations [31,32,33]. B4, B5a, and M9a were present in Southeast Asian populations [24,34,35,36].
The geographic location of the Kingdom of Thailand, incorporating the upland and lowland areas in the center of mainland Southeast Asia (or Indochina), is a critical factor in facilitating multicultural diversity. The Thai census recorded 66.5 million people in 2020 (http://www.moi.go.th/, acessed on 15 June 2020). Recent analyses of HVI and HVII revealed three macro haplogroups—M (D4 and M7b), N (A), and R (B4, B5a, F1a, and R9b)—in mainland Southeast Asia [23,34,36,37,38,39,40,41,42]. The majority of residents in this region use languages that belong to the Tai linguistic group, including Yuan, Lue, Yong, Tai Yai (Shan), and Khuen, from northern Thailand, associated with the subhaplogroups F1a, B6a, B5a, M7b, and R9b, Isan and Phuthai from the northeast with F1 and B5, and Malayu from the south with B5a, F1a, and M [38,43,44,45]. This haplogroup information correlates with classification in accordance with linguistic family distributions and is important for understanding the results of archaeological studies [43]. However, according to historical records, several foreign migrations of the Daic, Khmuic, Lao, Shan, Yuan, and Malayu peoples occurred and they intermixed with local Thai groups [16,44,46], resulting in genetic admixture in the current Thai population [16,45,47]. Multidirectional cross-cultural marriages are guided by social, religious, and historical conditions that vary significantly for each distinct geographical region [28,29,48]. Given this scenario, we hypothesize that the modern Thai population shows a high degree of genetic admixture, resulting from historically interracial marriages [38,45,47,49]. However, no reference mtDNA haplogroup data are available for the current Thai population. Such data would be advantageous for forensic casework and human migration mtDNA analysis, which require relevant and reliable databases to estimate the probability of a given haplotype in a population. This study estimated HVI and HVII diversity, using the STS approach, for 309 randomly selected Thai individuals. This report aims to establish a reference mtDNA dataset of modern Thai individuals to calculate statistical values that will benefit forensic casework investigation in the Kingdom of Thailand.

2. Materials and Methods

2.1. DNA Samples and Extraction

Blood samples were collected from 309 unrelated individuals across Thailand. The families of each individual had lived in the respective area for at least three generations (Table 1). Subjects were recruited from the northern (N) (17°10′0″ N, 20°27′0″ N, 97°10′0″ N, 101°10′0″ E) (n = 93), northeastern (NE) (14°8′18″ N, 18°26′33″ N) (n = 61), central (C) (13°15′0″ N, 17°45′0″ N, 98°55′0″ E, 101°35′0″ E) (n = 92), and southern (S) (5°37′0″ N, 11°32′0″ N, 98°13′0″ E, 102°52′0″ E) (n = 63) populations. The study focus is concentrated on single-source reference specimens for the Thai population. This research was approved by the Ethical Clearance Committee on Human Rights related to research involving human subjects, and the Faculty of Medicine, Ramathibodi Hospital, Mahidol University (COA. MURA2020/825). Blood samples were collected as a source of DNA, from which genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (Qiagen GmbH, Hilden, Germany). DNA quantity was determined using the spectrophotometry approach (NanoDrop, Thermo Fisher Scientific, Waltham, MA, USA).

2.2. Amplification and Sequencing of HVI and HVII by STS

The nucleotide sequences of HVI (16,024‒16,365) and HVII (73‒340) [13] of the mtDNA control region were amplified using primers (HV1F, 5′‒CTCCACCATTAGCACCCAA‒3′; HV1R, 5′‒ATTTCACGGAGGATGGTG‒3′; HV2F, 5′‒CACCCTATTAACCACTCACG‒3′; and HV2R, 5′‒CTGTTAAAAGTGCATACCGC‒3′) specifically designed for the study. PCR amplification total volumes were performed using 25 μL Master Mix, consisting of 10X Taq buffer, containing 1.5 mM MgCl2, 0.2 mM dNTPs, 5.0 μM primers, 0.5 U AmpliTaq Gold DNA Polymerase (Life Technologies, Foster City, CA, USA), and 25 ng genomic DNA. In the PCR reaction tube, each primer pair was amplified individually. The amplification conditions of both primer pairs were: initial denaturation at 95 °C for 10 min, followed by 35 cycles of 94 °C for 20 s, 55 °C for 20 s, and 72 °C for 30 s, with a final extension at 72 °C for 10 min. The PCR products were separated by electrophoresis in 1% agarose gel and treated with ExoSAP-IT (USB, Cleveland, OH, USA) to eliminate the primers and unused dNTPs. Sequencing reactions were performed with BigDye Terminator version 1.1 (Applied Biosystems, Foster City, CA, USA), in accordance with the manufacturer’s instructions, and purified using the DyeEx 2.0 Spin Kit (Qiagen). All reactions were sequenced using a 3130 Genetic Analyzer (Applied Biosystems), and the results were analyzed using SeqScape version 2.5 software (Applied Biosystems). The consensus sequences were aligned and compared with the revised Cambridge Reference Sequence (rCRS, NC_012920.1) following the nomenclature guidelines for mtDNA typing [13,50,51].

2.3. Data Analysis of mtDNA HVI and HVII

The summary statistics (number of haplotypes, haplotype diversity, matching probability, and power of discrimination) for combinations of HVI and HVII were based on pairwise comparisons of Thai populations. The matching probability (P) was calculated using the equation P = ∑   x 2 . The power discrimination (PD) was determined using the equation PD = 1 − ∑   x 2 . The haplotype diversity HD was determined using the equation HD = ( 1 − ∑   x 2 ) n n − 1 , where x is the frequency of each mtDNA haplotype, and n is the total number of samples [52,53,54].
We analyzed the differentiation among Thai populations based on the administrative regions (N, NE, C, and S), using a pairwise FST with the “stamppFst” function in the StAMPP package in R [55], following the method proposed by Wright [56], and updated by Weir and Cockerham [57]. Empirical p-values were obtained by comparing the observed value of Fst with 1000 bootstrapping pseudoreplicates. The principal component analysis (PCA) was also performed on the dataset, using the function “prcomp” in the “stats” package in R [58]. The results from the PCA were visualized using the function “fviz_pac_ind” in the package “factoextra” in R [59].

2.4. Classification of mtDNA Haplogroup and Data Analysis

The MtDNA haplotypes were affiliated to the haplogroups based on the patterns of the shared haplogroup-specific nucleotide polymorphisms, using HaploGrep2 with PhyloTree 17 [60], and the MITOMAP (https://www.mitomap.org, acessed on 15 March 2020) and EMPOP (https://www.empop.online, acessed on 15 March 2020) [61] online databases, based on HVI and HVII sequences. All generated data were deposited in the EMPOP database as rCRS variations, under reference number EMP00840 [62]. Haplogroup frequencies were visualized using the “ggplot” function [63] and analyzed for significant differentiation among the regions using the chi-square test in the “stats” package in R [58]. The workflow graphic from the 309 sampling processes for data evaluation are shown in Figure S1.

3. Results

A total of 264 different haplotypes were observed, comprising 231 unique haplotypes (74.76%), and 33 haplotypes that shared more than one individual. One shared haplotype also resulted from the varied numbers of 2–5 individuals in 78 unrelated individuals (25.24%) (Table 1).
The number of haplotypes was estimated in relation to four continental Thai groups, namely, the northern, northeastern, central, and southern populations (Table S1). The haplotype diversity of the HVI/HVII combinations was 0.9985, and the matching probability and power of discrimination were 0.4744% and 0.9953, respectively (Table 1). The first two dimensions of the principal component analysis (PCA) of the SNP data accounted for 22.4% of the variation. The PCA showed slight differentiation among the populations of the four regions (Figure 1).
We analyzed differentiation among the Thai population based on the administrative regions (N, NE, C and S). The pairwise FST values among the populations were approximately zero and did not differ significantly from the random (p-value ≥ 0.715), suggesting little differentiation among the populations. (Table 2).
All 264 haplotypes were subsequently classified into 82 haplogroups using HaploGrep2 with PhyloTree 17 and EMPOP [54]. The most frequent haplogroups were: F1a (13.92%, n = 43); B5a (8.41%, n = 26); M7b (6.47%, n = 20); R9b (5.83%, n = 18); and B4c (3.56%, n = 11) (Table 3, Figure 2).
The haplogroup frequencies based on the HVI and HVII SNP data of the Thai population showed some degree of separation among the populations of different regions (Figure 3).
However, the proportion of haplogroup frequencies did not differ significantly from the random (chi-square test, p = 1.00). In this study, haplogroup frequencies were compared with the 12 neighboring countries in Southeast Asia, South Asia, and East Asia (Figure 4). The results show that the frequencies of haplogroups in Thailand are similar to the data from Southeast Asia, while the Thai population shows a slight differentiation from other Asian countries (Figure 4; chi-square test, p = 1.00). However, almost all of the Southeast Asian countries had higher frequencies of the F1a haplogroup compared to the other regions (Figure 4).
The first two PCAs of the haplogroup frequencies accounted for 55.3% of the variation and show that Southeast Asian populations appear more similar to each other than to countries from the other regions (Figure 5).

4. Discussion

Forensic genetic analyses provide useful information, as biological evidence found at crime scenes, for the identification of missing people after mass disasters, or for inferring the cause and manner of death. The STS approach is accepted as the standard method for mtDNA typing using HVI and HVII [2,3]. However, this approach is labor-intensive, time-consuming, and costly as an analytical method. An alternative choice is required for practical mtDNA sequencing. Accurate human identification analysis is extremely important and a reference database for an individual country can be used by forensic laboratories to report casework precisely. To establish a reference mtDNA database in forensic casework for Thailand, we compiled a high-quality HVI and HVII sequence dataset for 309 Thai individuals. A total of 264 haplotypes showed 0.9985 diversity. This diversity was higher than recorded in the datasets of Thai populations (n = 190, 0.989; n = 124, 0.9958; n = 100, 0.9859) reported in previous studies [28,61,62,66], as well as in datasets for the Lao (n = 214, 0.790), Vietnam (n = 187, 0.991), and Singapore (n = 205, 0.9961) populations [15,23,67,68,69]. Previous studies of the random matching probability and the power of discrimination in a unique ethnic group from Chiang Mai, located in the north of Thailand, (Tai, Mon-Khmer), were 0.9980 and 0.9906, respectively [28,54]. Modern Thai individuals, comprising an admixed population, demonstrated random matching probability, and the powers of discrimination were 0.4744% and 0.9985, respectively. These findings suggest that the present mtDNA dataset exhibited high haplotype variation and was suitable for human identification as a reference dataset.
In this study, information on the single-nucleotide polymorphisms (SNPs) of HVI and HVII was classified into haplogroups. These groups may provide valuable information for determining the patterns of variation and population structures of maternal lineages to support human identification [36]. In Thailand, human identification is commonly performed using autosomal STR (short tandem repeat) markers, but this method is sometimes unsuccessful in skeletal-remains identification. Therefore, to improve the results, we applied mtDNA haplogroups for additional supporting evidence. The majority of haplotypes detected in Thai populations belong to the M and N macro haplogroups, and comprise three major haplogroups (M7, R9, and B), as also observed in Asian populations [15,21,36]. The subhaplogroup F1a showed the highest prevalence in Thai populations (13.92%), consistent with other Southeast Asian populations (Table S2) [16,36,68,69,70] (Figure 2 and Figure 5). This finding concurs with historical and geographical details, given that Thailand has a long tradition of granting political asylum to refugees from neighboring countries who have been persecuted as a result of their religion or ethnicity. Thailand is the only Southeast Asian country that has never been colonized by a European power [71,72]. For centuries, Vietnamese Christians, the Mon ethnic group from Myanmar, and political dissidents from Cambodia, have all sought and received shelter in Thailand [71]. Many ethnic groups are resident in Thailand, including Malays, Mon, Khmer, and various hill tribes, as a result of the historic migrations of those fleeing civil wars and economic crises [15,71]. By contrast, Chinese, and other East Asian populations, contain a high proportion of subhaplogroup D4, whereas the majority of populations in South Asian countries, such as Nepal and India, contain subhaplogroup G2a [73,74] (Table S2). These results collectively suggest that subhaplogroup proportions can be used to determine the geographic origin of human populations.
In order to shed more light on the genetic admixture of haplogroups in Thailand, we compared the current samples, organized into four distinct geographic groups, with various Asian populations (Figure 3). For the migration of various ethnic groups, originating from distinct geopolitical regions, into the same geographical area, dynamic gene flow was observed in India, Indonesia, Australia, Sweden, Macedonia, Brazil, and the USA [75,76,77,78,79]. Although F1a was the predominant subhaplogroup detected in Thailand, distinctively high proportions of F1a, and other subhaplogroups, were observed in the northern and northeastern populations compared with the central population. The Kingdom of Lan Na captures the cultural development of the northern Thai people, which originated more than 650 years ago, coincident with successive Kingdoms of Thailand [80]. The northern population of hill tribes was also impacted by sex-specific migration and cultural factors [46]. The predominant subhaplogroup of the northern population is F1a, which differs substantially from the other subhaplogroups in the population. Over 200 years ago, Burma expanded its influence to the Lan Na Kingdom, and Burmese populations contain a high proportion of F1a [36]. This suggests the possibility of genetic exchange between the two kingdoms, in accordance with the Lan Na territorial occupation dynamic. The Lan Na Kingdom merged with the Kingdom of Thailand 88 years ago [80], and the distinctively high proportion of F1a remains. These results concur with the general distribution of maternal lineages in the northern population of Thailand, observed by Kampuansai et al., and Kriengchutima et al. [47,54], whereas in the northeastern population, the frequencies of F1a and B5a were consistent with the proportion of subhaplogroups in Lao, in accordance with historic migration, as determined by Bodner et al. [16]. By contrast, the subhaplogroups in the southern population became isolated, as exemplified by the absence of B5a and B4 from the majority of the Thai population. This result agrees with the most frequent subhaplogroup in populations on the Malay Peninsula, as recorded by Tabbada et al. [39], and Maruyama et al. [40]. Religion possibly influenced marriage because, in southern areas, the majority of residents are Muslims, similar to Malay populations [40]. It is likely that multidirectional cross-cultural marriages were influenced by social and historical conditions that varied significantly for each distinct geographical area. The modern Thai population reflects a high degree of genetic admixture as a result of recurrent historically interracial marriage events, as also observed in similar proportions in the subhaplogroups of the central population (Figure 1) [45,47].
During the twelfth and thirteenth centuries, Thai people were subjugated under the Khmers (in the area now known as Cambodia), leading to mtDNA exchange between the Tai-Kadai and Khmer groups throughout the central part of Thailand [29]. This might also reflect the proportion of haplogroups in the central and northeastern regions of Thailand, which show high frequencies of the subhaplogroups F1a and B5a, similar to the subhaplogroup distribution in Cambodia (Figure 4) [41]. One subhaplogroup M7b lineage was also detected several times in the northern and northeastern populations of the dataset and is also observed in southern China [21]. The Chinese colonization of Thailand occurred during the nineteenth and twentieth centuries, with the migration from South China into Southeast Asia of those fleeing national economic and political unrest [16,81]. This suggests that the emergence of subhaplogroup M7b was caused by Chinese migration to Southeast Asia (Figure 4). However, a high proportion of the population retains haplogroup F1a. This result is consistent with a significant gender bias and contribution imbalance reported for parental lineages in the Chinese-Thai population caused by traditional ethnicity, together with maternal contribution [16]. Alternatively, Chinese colonization had a notable gender bias toward masculine contributions. Such migrant men interbred with local Thai residents, especially during the initial colonization phases [46]. mtDNA markers display a more asymmetrical distribution of ancestral population contributions to the current genetic pool [12]. The historical and cultural factors that motivated the admixture mechanisms in Thailand have resulted in the current admixed population. Such diverse biogeographical groups shaped the current Thai population, forging a genetically and culturally diverse, highly admixed country [70].
This study evaluated the utility of mtDNA HVI and HVII in the Thai population to develop a national reference database for real forensic casework using 309 specimens collected across the country. Diversity indices and other relevant forensic statistical parameters indicated a high degree of polymorphism suitable for human identification purposes. Workflow automation should also be considered when casework volumes are high or a backlog exists. The construction of a representative forensic national database is also essential, with the addition of a substantial number of specimens to evaluate possible genetic regional or ethnic stratification in the Thai population. However, in particular situations, HVI and HVII data do not provide sufficient discriminatory information to resolve distinct maternal lineages. A recent study examining individuals from across the USA determined HVI and HVII information, with a discrimination of 0.9942, and a matching probability of 0.96% for specimen haplotypes [79]. Complete mtGenome (mitogenome) data allowed for identification at almost full resolution, with higher discrimination at 0.9999, and matching probability at 0.39%, for the US population [79]. Therefore, mitogenomic data are required to improve human identification by mtDNA testing in Thailand. A reference mtDNA database is also needed to develop the entire mitogenome reference population data suitable for forensic comparison. Such a database would supply additional information, with special consideration for the high ethnic diversity and admixed populations in Thailand. The investigatory unit might seek to resolve missing person cases, in which more than one reference family share the same HVI and HVII haplotype, using the mitogenome, thereby increasing statistical support when exclusionary references are unavailable [81,82,83]. This approach can lead to the correction of haplotype classification and the identification of undescribed subclades. STS processing is labor-intensive, costly, and time-consuming; however, routine work still follows this technique in local units across Thailand. These days, parallel sequencing technology is an efficient high-throughput tool, and further reports of mitogenomic sequencing should be challenged in Thai mtDNA datasets.

5. Conclusions

The HVI and HVII sequences analyzed in this study were generated in accordance with high-quality laboratory standards. The frequencies of the identified haplogroups were characterized for the admixed Thai population. The F1a, B5a, M7b, and R9b subhaplogroups showed high frequencies in the population database. The establishment of regional databases is necessary, especially for forensic database searches, in order to obtain reliable frequency estimates. Additional sequences from such haplotypes must be collected and genotyped in order for the mitogenome to expand the Thai population database. The haplotypes reported in this study will be available from the EMPOP database (https://www.empop.org, acessed on 21 December 2020) upon publication.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/d13100496/s1. Figure S1: Workflow graphic from 309 sampling processes for data evaluation; Table S1: Haplogroup diversity in the Thai population (based on classification of HVI and HVII sequence data); Table S2: Haplogroup frequencies in Thailand and other Asian populations.

Author Contributions

Conceptualization, P.A., K.S. and B.R.; methodology, P.A., K.S., P.O., J.J. and B.R.; project administration, B.R.; writing—original draft, P.A., K.S. and B.R.; writing—review and editing, P.A., K.S., P.O., J.J. and B.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Mahidol University, Thailand Research Fund: RSA60I0035; and the National Research Council of Thailand: 2560096003012.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Ethics Committee of Faculty of Medicine Ramathibodi Hospital, Mahidol University (COA. MURA2020/825 and date of approval on 22 May 2020).

Informed Consent Statement

Patient consent was waived due to using not re-identifiable data from the laboratory results.

Data Availability Statement

The data can be found in the supplementary material.

Acknowledgments

We would like to thank Ekaphan Kraichak (Kasetsart University) for providing statistical analyses, and Worapong Singchat and Thitipong Panthum (Kasetsart University) for supporting the graphic design.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Melton, T.; Dimick, G.; Higgins, B.; Yon, M.; Holland, C. Mitochondrial DNA analysis of 114 hairs measuring less than 1 Cm from a 19-year-old homicide. Investig. Genet. 2012, 3, 12. [Google Scholar] [CrossRef] [Green Version]
  2. Fridman, C.; Gonzalez, R.S.; Pereira, A.C.; Cardena, M.M.S.G. Haplotype diversity in mitochondrial DNA hypervariable region in a population of southeastern Brazil. Int. J. Leg. Med. 2014, 128, 589–593. [Google Scholar] [CrossRef]
  3. Amorim, A.; Fernandes, T.; Taveira, N. Mitochondrial DNA in human identification: A Review. PeerJ 2019, 7, e7314. [Google Scholar] [CrossRef] [PubMed]
  4. Lebo, M.S.; Hao, L.; Lin, C.-F.; Singh, A. Bioinformatics in Clinical Genomic Sequencing. Clin. Lab. Med. 2020, 40, 163–187. [Google Scholar] [CrossRef] [PubMed]
  5. Alexovič, M.; Urban, P.L.; Tabani, H.; Sabo, J. Recent advances in robotic protein sample preparation for clinical analysis and other biomedical applications. Clin. Chim. Acta. 2020, 507, 104–116. [Google Scholar] [CrossRef] [PubMed]
  6. Samehsalari, S.; Reddy, K.R. Application control region of human mitochondrial DNA in forensic anthropology. Int. J. Mod. Anthropol. 2018, 2, 233–248. [Google Scholar] [CrossRef] [Green Version]
  7. Budowle, B.; Allard, M.W.; Wilson, M.R.; Chakraborty, R. Forensics and mitochondrial DNA: Applications, debates, and foundations. Annu. Rev. Genom. Hum. Genet. 2003, 4, 119–141. [Google Scholar] [CrossRef] [Green Version]
  8. Hayat, S.; Akhtar, T.; Siddiqi, M.H. Human mitochondrial DNA characterization and its applications. Eur. J. Pharm. Med. Res. 2016, 3, 206–214. [Google Scholar]
  9. Piccinini, A.; Coco, S.; Parson, W.; Cattaneo, C.; Gaudio, D.; Barbazza, R.; Galassi, A. World war one Italian and Austrian soldier identification project: DNA results of the first case. Forensic Sci. Int. Genet. 2010, 4, 329–333. [Google Scholar] [CrossRef]
  10. Mahajan, V.B.; Padale, V.; Kudekar, D.Y.; More, B.P.; Kulkarni, K.V. Hair—A Good Source of DNA to Solve the Crime. Arch Clin. Biomed Res. 2019, 3, 287–295. [Google Scholar] [CrossRef] [Green Version]
  11. Ambers, A.D.; Churchill, J.D.; King, J.L.; Stoljarova, M.; Gill-King, H.; Assidi, M.; Abu-Elmagd, M.; Buhmeida, A.; Al-Qahtani, M.; Budowle, B. More comprehensive forensic genetic marker analyses for accurate human remains identification using massively parallel DNA sequencing. BMC Genom. 2016, 17, 750. [Google Scholar] [CrossRef] [Green Version]
  12. Greenberg, B.D.; Newbold, J.E.; Sugino, A. Intraspecific nucleotide sequence variability surrounding the origin of replication in human mitochondrial DNA. Gene 1983, 21, 33–49. [Google Scholar] [CrossRef]
  13. Andrews, R.M.; Kubacka, I.; Chinnery, P.F.; Lightowlers, R.N.; Turnbull, D.M.; Howell, N. Reanalysis and revision of the Cambridge Reference Sequence for Human Mitochondrial DNA. Nat. Genet. 1999, 23, 147. [Google Scholar] [CrossRef]
  14. Fridman, C.; Gonzalez, R.S. HVIII discrimination power to distinguish HVI and HVII common sequence. Forensic Sci. Int. Genet. 2009, 2, 320–321. [Google Scholar] [CrossRef]
  15. Bodner, M.; Zimmermann, B.; Röck, A.; Kloss-Brandstätter, A.; Horst, D.; Horst, B.; Sengchanh, S.; Sanguansermsri, T.; Horst, J.; Krämer, T.; et al. Southeast Asian diversity: First insights into the complex mtDNA structure of Laos. BMC Evol. Biol. 2011, 11, 49. [Google Scholar] [CrossRef] [Green Version]
  16. Li, H.; Cai, X.; Winograd-Cort, E.R.; Wen, B.; Cheng, X.; Qin, Z.; Liu, W.; Liu, Y.; Pan, S.; Qian, J.; et al. Mitochondrial DNA diversity and population differentiation in southern East Asia. Am. J. Phys. Anthropol. 2007, 134, 481–488. [Google Scholar] [CrossRef] [PubMed]
  17. Sultana, G.N.N.; Tuli, J.F.; Begum, R.; Tamang, R. Mitochondrial DNA control region variation from Bangladesh: Sequence analysis for the establishment of a forensic database. Forensic Med. Anat. Res. 2014, 2, 95–100. [Google Scholar] [CrossRef] [Green Version]
  18. Deng, Y.J.; Li, Y.-Z.; Yu, X.-G.; Li, L.; Wu, D.-Y.; Zhou, J.; Man, T.-Y.; Yang, G.; Yan, J.-W.; Cai, D.-Q.; et al. Preliminary DNA identification for the Tsunami victims in Thailand. GPB 2005, 3, 143–157. [Google Scholar] [CrossRef] [Green Version]
  19. Maruyama, S.; Komuro, T.; Izawa, H.; Tsutsumi, H. Analysis of human mitochondrial DNA polymorphisms in the Japanese population. Biochem. Genet. 2013, 51, 33–70. [Google Scholar] [CrossRef] [PubMed]
  20. Goodwin, W.H. The use of forensic DNA analysis in humanitarian forensic action: The development of a set of international standards. Forensic Sci. Int. 2017, 278, 221–227. [Google Scholar] [CrossRef]
  21. Yao, Y.-G.; Kong, Q.-P.; Bandelt, H.-J.; Kivisild, T.; Zhang, Y.-P. Phylogeographic differentiation of mitochondrial DNA in Han Chinese. Am. J. Hum. Genet. 2002, 70, 635–651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Pereira, L.; Richards, M.; Goios, A.; Alonso, A.; Albarrán, C.; Garcia, O.; Behar, D.M.; Gölge, M.; Hatina, J.; Al-Gazali, L.; et al. High-resolution mtDNA evidence for the late-glacial resettlement of Europe from an Iberian refugium. Genome Res. 2005, 15, 19–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Lee, H.Y.; Yoo, J.E.; Park, M.J.; Chung, U.; Shin, K.J. Mitochondrial DNA control region sequences in Koreans: Identification of useful variable sites and phylogenetic analysis for mtDNA data quality control. Int. J. Leg. Med. 2006, 120, 5–14. [Google Scholar] [CrossRef] [PubMed]
  24. Pereira, L.; Freitas, F.; Fernandes, V.; Pereira, J.B.; Costa, M.D.; Costa, S.; Máximo, V.; Macaulay, V.; Rocha, R.; Samuels, D.C. The diversity present in 5140 human mitochondrial genomes. Am. J. Hum. Genet. 2009, 84, 628–640. [Google Scholar] [CrossRef] [Green Version]
  25. Zarei, F.; Alipanah, H. Mitochondrial DNA variation, genetic structure and demographic history of Iranian populations. Mol. Biol. Res. Commun. 2014, 3, 45–65. [Google Scholar]
  26. Siddiqi, M.H.; Akhtar, T.; Rakha, A.; Abbas, G.; Ali, A.; Haider, N.; Ali, A.; Hayat, S.; Masooma, S.; Ahmad, J.; et al. Genetic characterization of the Makrani people of Pakistan from mitochondrial DNA control-region data. Leg. Med. 2015, 17, 134–139. [Google Scholar] [CrossRef]
  27. Rusu, I.; Modi, A.; Vai, S.; Pilli, E.; Mircea, C.; Radu, C.; Urduzia, C.; Pinter, Z.K.; Bodolică, V.; Dobrinescu, C.; et al. Maternal DNA lineages at the gate of Europe in the 10th Century AD. PLoS ONE 2018, 13, e0193578. [Google Scholar] [CrossRef] [Green Version]
  28. Zimmermann, B.; Bodner, M.; Amory, S.; Fendt, L.; Röck, A.; Horst, D.; Horst, B.; Sanguansermsri, T.; Parson, W.; Brandstätter, A. Forensic and phylogeographic characterization of mtDNA lineages from Northern Thailand (Chiang Mai). Int. J. Leg. Med. 2009, 123, 495–501. [Google Scholar] [CrossRef]
  29. Kutanan, W.; Ghirotto, S.; Bertorelle, G.; Srithawong, S.; Srithongdaeng, K.; Pontham, N.; Kangwanpong, D. Geography has more influence than language on maternal genetic structure of various Northeastern Thai ethnicities. J. Hum. Genet. 2014, 59, 512–520. [Google Scholar] [CrossRef]
  30. van Oven, M.; Kayser, M. Updated comprehensive phylogenetic tree of global human mitochondrial DNA variation. Hum. Mutat. 2009, 30, E386–E394. [Google Scholar] [CrossRef]
  31. Peng, M.-S.; Palanichamy, M.; Yao, Y.-G.; Mitra, B.; Cheng, Y.-T.; Zhao, M.; Liu, J.; Wang, H.-W.; Pan, H.; Wang, W.; et al. Inland post-glacial dispersal in East Asia revealed by mitochondrial haplogroup M9a’b. BMC Biol. 2011, 9, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Li, Y.-C.; Ye, W.-J.; Jiang, C.-G.; Zeng, Z.; Tian, J.-Y.; Yang, L.-Q.; Liu, K.-J.; Kong, Q.-P. River Valleys Shaped the Maternal Genetic Landscape of Han Chinese. Mol. Biol. Evol. 2019, 36, 1643–1652. [Google Scholar] [CrossRef] [PubMed]
  33. Chen, C.; Li, Y.; Tao, R.; Jin, X.; Guo, Y.; Cui, W.; Chen, A.; Yang, Y.; Zhang, X.; Zhang, J.; et al. The Genetic Structure of Chinese Hui Ethnic Group Revealed by Complete Mitochondrial Genome Analyses Using Massively Parallel Sequencing. Genes 2020, 11, 352. [Google Scholar] [CrossRef] [PubMed]
  34. Kong, Q.P.; Sun, C.; Wang, H.-W.; Zhao, M.; Wang, W.-Z.; Zhong, L.; Hao, X.-D.; Pan, H.; Wang, S.-Y.; Cheng, Y.-T.; et al. Large-scale mtDNA screening reveals a surprising matrilineal complexity in East Asia and its implications to the peopling of the region. Mol. Biol. Evol. 2011, 28, 513–522. [Google Scholar] [CrossRef] [Green Version]
  35. Hong, S.B.; Kim, K.C.; Kim, W. Mitochondrial DNA haplogroups and homogeneity in the Korean population. Genes Genom. 2014, 36, 583–590. [Google Scholar] [CrossRef]
  36. Summerer, M.; Horst, J.; Erhart, G.; Weißensteiner, H.; Schönherr, S.; Pacher, D.; Forer, L.; Horst, D.; Manhart, A.; Horst, B.; et al. Large-scale mitochondrial DNA analysis in Southeast Asia reveals evolutionary effects of cultural isolation in the multi-ethnic population of Myanmar. BMC Evol. Biol. 2014, 14, 17. [Google Scholar] [CrossRef] [Green Version]
  37. Tanaka, M.; Cabrera, V.M.; González, A.M.; Larruga, J.M.; Takeyasu, T.; Fuku, N.; Guo, L.-J.; Hirose, R.; Fujita, Y.; Kurata, M.; et al. Mitochondrial genome variation in Eastern Asia and the peopling of Japan. Genome Res. 2004, 14, 1832–1850. [Google Scholar] [CrossRef] [Green Version]
  38. Hill, C.; Soares, P.; Mormina, M.; Macaulay, V.; Clarke, D.; Blumbach, P.B.; Vizuete-Forster, M.; Forster, P.; Bulbeck, D.; Oppenheimer, S.; et al. Mitochondrial stratigraphy for island southeast Asia. Am. J. Hum. Genet. 2007, 80, 29–43. [Google Scholar] [CrossRef] [Green Version]
  39. Tabbada, K.A.; Trejaut, J.; Loo, J.-H.; Chen, Y.-M.; Lin, M.; Mirazon-Lahr, M.; Kivisild, T.; De Ungria, M.C.A. Philippine mitochondrial DNA diversity: A populated viaduct between Taiwan and Indonesia? Mol. Biol. Evol. 2010, 27, 21–31. [Google Scholar] [CrossRef] [Green Version]
  40. Maruyama, S.; Nohira-Koike, C.; Minaguchi, K.; Nambiar, P. MtDNA control region sequence polymorphisms and phylogenetic analysis of Malay population living in or around Kuala Lumpur in Malaysia. Int. J. Leg. Med. 2010, 124, 165–170. [Google Scholar] [CrossRef]
  41. Zhang, X.; Qi, X.; Yang, Z.; Serey, B.; Sovannary, T.; Bunnath, L.; Seang Aun, H.; Samnom, H.; Zhang, H.; Lin, Q.; et al. Analysis of mitochondrial genome diversity identifies new and ancient maternal lineages in Cambodian aborigines. Nat. Commun. 2013, 4, 2599. [Google Scholar] [CrossRef] [Green Version]
  42. Shee, C.-Y.; Chong, M.S.M.; Ng, I.; Chia, T.-F. Mitochondrial DNA hypervariable region 1 polymorphism in Singapore Chinese population. Leg. Med. 2005, 7, 127–133. [Google Scholar] [CrossRef]
  43. Kampuansai, J.; Bertorelle, G.; Castri, L.; Nakbunlung, S.; Seielstade, M.; Kangwanponga, D. Mitochondrial DNA variation of Tai speaking peoples in Northern Thailand. Sci. Asia 2007, 33, 443–448. [Google Scholar] [CrossRef]
  44. Kutanan, W.; Kampuansai, J.; Colonna, V.; Nakbunlung, S.; Lertvicha, P.; Seielstad, M.; Bertorelle, G.; Kangwanpong, D. Genetic affinity and admixture of Northern Thai people along their migration route in Northern Thailand: Evidence from autosomal STR Loci. J. Hum. Genet. 2011, 56, 130–137. [Google Scholar] [CrossRef] [Green Version]
  45. Kutanan, W.; Kampuansai, J.; Srikummool, M.; Brunelli, A.; Ghirotto, S.; Arias, L.; Macholdt, E.; Hübner, A.; Schröder, R.; Stoneking, M. Contrasting paternal and maternal genetic histories of Thai and Lao populations. Mol. Biol. Evol. 2019, 36, 1490–1506. [Google Scholar] [CrossRef] [PubMed]
  46. Besaggio, D.; Fuselli, S.; Srikummool, M.; Kampuansai, J.; Castrì, L.; Tyler-Smith, C.; Seielstad, M.; Kangwanpong, D.; Bertorelle, G. Genetic variation in Northern Thailand Hill Tribes: Origins and relationships with social structure and linguistic differences. BMC Evol. Biol. 2007, 7, S12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Kampuansai, J.; Kutanan, W.; Phuphanitcharoenkul, S.; Kangwanpong, D.A. A suggested Khmuic origin of the hunter-gatherer Mlabri in Northern Thailand: Evidence from maternal DNA lineages. Thai J. Genet. 2012, 5, 203–215. [Google Scholar] [CrossRef]
  48. Arauna, L.R.; Mendoza-Revilla, J.; Mas-Sandoval, A.; Izaabel, H.; Bekada, A.; Benhamamouch, S.; Fadhlaoui-Zid, K.; Zalloua, P.; Hellenthal, G.; Comas, D. Recent historical migrations have shaped the gene pool of Arabs and Berbers in North Africa. Mol. Biol. Evol. 2017, 34, 318–329. [Google Scholar] [CrossRef] [Green Version]
  49. Fucharoen, G.; Fucharoen, S.; Horai, S. Mitochondrial DNA polymorphisms in Thailand. J. Hum. Genet. 2001, 46, 115–125. [Google Scholar] [CrossRef] [Green Version]
  50. Anderson, S.; Bankier, A.T.; Barrell, B.G.; de Bruijn, M.H.L.; Coulson, A.R.; Drouin, J.; Eperon, I.C.; Nierlich, D.P.; Roe, B.A.; Sanger, F.; et al. Sequence and organization of the human mitochondrial genome. Nature 1981, 290, 457–465. [Google Scholar] [CrossRef]
  51. Budowle, B.; Polanskey, D.; Fisher, C.L.; Den Hartog, B.K.; Kepler, R.B.; Elling, J.W. Automated alignment and nomenclature for consistent treatment of polymorphisms in the human mitochondrial DNA control region. J. Forensic Sci. 2010, 55, 1190–1195. [Google Scholar] [CrossRef]
  52. Tajima, F. Evolutionary relationship of DNA sequences in finite populations. Genetics 1983, 105, 437–460. [Google Scholar] [CrossRef] [PubMed]
  53. Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
  54. Kriengchutima, C.; Rodrussamee, N.; Kutanan, W.; Kampuansai, J. Increasing the discrimination power of a mitochondrial DNA control region by using hypervariable region 2 polymorphisms, as illustrated in Tai populations of Northern Thailand. Sci. Asia 2015, 41, 108. [Google Scholar] [CrossRef]
  55. Pembleton, L.W.; Cogan, N.O.I.; Forster, J.W. StAMPP: An R package for calculation of genetic differentiation and structure of mixed-ploidy level populations. Mol. Ecol. Resour. 2013, 13, 946–952. [Google Scholar] [CrossRef] [PubMed]
  56. Wright, S. The Genetical Structure of Populations. Ann. Hum. Genet. 1949, 15, 323–354. [Google Scholar] [CrossRef] [PubMed]
  57. Weir, B.S.; Cockerham, C.C. Estimating F-Statistics for the Analysis of Population-Structure. Evolution 1984, 38, 1358–1370. [Google Scholar] [CrossRef]
  58. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2020; Available online: https://www.R-project.org/ (accessed on 18 September 2021).
  59. Alboukadel Kassambara and Fabian Mundt. Factoextra: Extract and Visualize the Results of Multivariate Data Analyses. R Package Version 1.0.7. 2020. Available online: https://CRAN.R-project.org/package=factoextra (accessed on 18 September 2021).
  60. Weissensteiner, H.; Pacher, D.; Kloss-Brandstätter, A.; Forer, L.; Specht, G.; Bandelt, H.-J.; Kronenberg, F.; Salas, A.; Schönherr, S. HaploGrep 2: Mitochondrial haplogroup classification in the era of high-throughput sequencing. Nucleic Acids Res. 2016, 44, W58–W63. [Google Scholar] [CrossRef]
  61. Röck, A.W.; Dür, A.; van Oven, M.; Parson, W. Concept for estimating mitochondrial DNA haplogroups using a maximum likelihood approach (EMMA). Forensic Sci. Int. Genet. 2013, 7, 601–609. [Google Scholar] [CrossRef] [Green Version]
  62. Parson, W.; Gusmão, L.; Hares, D.R.; Irwin, J.A.; Mayr, W.R.; Morling, N.; Pokorak, E.; Prinz, M.; Salas, A.; Schneider, P.M.; et al. DNA Commission of the International Society for Forensic Genetics: Revised and extended guidelines for mitochondrial DNA typing. Forensic Sci Int Genet. 2014, 13, 134–142. [Google Scholar] [CrossRef]
  63. Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016. [Google Scholar]
  64. Fornarino, S.; Pala, M.; Battaglia, V.; Maranta, R.; Achilli, A.; Modiano, G.; Torroni, A.; Semino, O.; Santachiara-Benerecetti, S.A. Mitochondrial and Y-chromosome diversity of the Tharus (Nepal): A reservoir of genetic variation. BMC Evol. Biol. 2009, 9, 154. [Google Scholar] [CrossRef] [Green Version]
  65. Mona, S.; Grunz, K.E.; Brauer, S.; Pakendorf, B.; Castrì, L.; Sudoyo, H.; Marzuki, S.; Barnes, R.H.; Schmidtke, J.; Stoneking, M. Genetic admixture history of Eastern Indonesia as revealed by Y-chromosome and mitochondrial DNA analysis. Mol. Biol. Evol. 2009, 26, 1865–1877. [Google Scholar] [CrossRef] [Green Version]
  66. Sangthong, P.; Thongngam, P.; Leewattanapasuk, W.; Bhoopat, T. Nucleotide sequence analysis of mitochondrial DNA hypervariable region II and inter HVR in Thais. Aust. J. Forensic Sci. 2019, 1–9. [Google Scholar] [CrossRef]
  67. Imaizumi, K.; Parsons, T.J.; Yoshino, M.; Holland, M.M. A new database of mitochondrial DNA hypervariable regions I and II sequences from 162 Japanese individuals. Int. J. Leg. Med. 2002, 116, 68–73. [Google Scholar] [CrossRef]
  68. Wong, H.Y.; Tang, J.S.W.; Budowle, B.; Allard, M.W.; Syn, C.K.C.; Tan-Siew, W.F.; Chow, S.T. Sequence polymorphism of the mitochondrial DNA hypervariable regions I and II in 205 Singapore Malays. Leg. Med. 2007, 9, 33–37. [Google Scholar] [CrossRef]
  69. Irwin, J.A.; Saunier, J.L.; Strouss, K.M.; Diegoli, T.M.; Sturk, K.A.; O’Callaghan, J.E.; Paintner, C.D.; Hohoff, C.; Brinkmann, B.; Parsons, T.J. Mitochondrial control region sequences from a Vietnamese population sample. Int. J. Leg. Med. 2008, 122, 257–259. [Google Scholar] [CrossRef]
  70. Kutanan, W.; Kampuansai, J.; Srikummool, M.; Kangwanpong, D.; Ghirotto, S.; Brunelli, A.; Stoneking, M. Complete mitochondrial genomes of Thai and Lao populations indicate an ancient origin of Austroasiatic groups and demic diffusion in the spread of Tai–Kadai languages. Hum. Genet. 2017, 136, 85–98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  71. Jackson, P. Autonomy and subordination in Thai history: The case for semicolonial analysis. Inter-Asia Cult. Stud. 2007, 8, 329–348. [Google Scholar] [CrossRef]
  72. Hasan, S. European colonization and the Muslim majority countries: Antecedents, approaches, and impacts. In The Muslim World in the 21st Century: Space, Power, and Human Development; Springer: Dordrecht, The Netherlands, 2012; pp. 133–157. [Google Scholar] [CrossRef]
  73. Nohira, C.; Maruyama, S.; Minaguchi, K. Phylogenetic classification of Japanese mtDNA assisted by complete mitochondrial DNA sequences. Int. J. Leg. Med. 2010, 124, 7–12. [Google Scholar] [CrossRef] [PubMed]
  74. Liu, C.; Wang, S.-Y.; Zhao, M.; Xu, Z.-Y.; Hu, Y.-H.; Chen, F.; Zhang, R.-Z.; Gao, G.-F.; Yu, Y.-S.; Kong, Q.-P. Mitochondrial DNA polymorphisms in Gelao ethnic group residing in Southwest China. Forensic Sci. Int. Genet. 2011, 5, e4–e10. [Google Scholar] [CrossRef]
  75. Basu, A.; Mukherjee, N.; Roy, S.; Sengupta, S.; Banerjee, S.; Chakraborty, M.; Dey, B.; Roy, M.; Roy, B.; Bhattacharyya, N.P.; et al. Ethnic India: A genomic view, with special reference to peopling and structure. Genome Res. 2003, 13, 2277–2290. [Google Scholar] [CrossRef] [Green Version]
  76. Koleth, E. Multiculturalism: A Review of Australian Policy Statements and Recent Debates in Australia and Overseas; Department of Parliamentary Services, Parliamentary Library: Canberra, Australia, 2010.
  77. Lembring, M.; van Oven, M.; Montelius, M.; Allen, M. Mitochondrial DNA analysis of Swedish population samples. Int. J. Leg. Med. 2013, 127, 1097–1099. [Google Scholar] [CrossRef]
  78. Jankova-Ajanovska, R.; Zimmermann, B.; Huber, G.; Röck, A.W.; Bodner, M.; Jakovski, Z.; Janeska, B.; Duma, A.; Parson, W. Mitochondrial DNA control region analysis of three ethnic groups in the Republic of Macedonia. Forensic Sci. Int. Genet. 2014, 13, 1–2. [Google Scholar] [CrossRef] [Green Version]
  79. Just, R.S.; Scheible, M.K.; Fast, S.A.; Sturk-Andreaggi, K.; Röck, A.W.; Bush, J.M.; Higginbotham, J.L.; Peck, M.A.; Ring, J.D.; Huber, G.E.; et al. Full mtGenome reference data: Development and characterization of 588 forensic-quality haplotypes representing three U.S. populations. Forensic Sci. Int. Genet. 2015, 14, 141–155. [Google Scholar] [CrossRef] [Green Version]
  80. Khrouthongkhieo, N.; Chularatana, J. The Siamese state and Lanna, 1874-1933. Int. J. Human Soc. Sci. Res. 2014, 6, 63–77. [Google Scholar]
  81. McKeown, A. Chinese emigration in global context, 1850–1940. J. Glob. Hist. 2010, 5, 95–124. [Google Scholar] [CrossRef]
  82. Parson, W.; Strobl, C.; Huber, G.; Zimmermann, B.; Gomes, S.M.; Souto, L.; Fendt, L.; Delport, R.; Langit, R.; Wootton, S.; et al. Evaluation of next generation mtGenome sequencing using the Ion Torrent Personal Genome Machine (PGM). Forensic Sci. Int. Genet. 2013, 7, 543–549. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. McElhoe, J.A.; Holland, M.M.; Makova, K.D.; Su, M.S.-W.; Paul, I.M.; Baker, C.H.; Faith, S.A.; Young, B. Development and assessment of an optimized next-generation DNA sequencing approach for the mtgenome using the Illumina MiSeq. Forensic Sci. Int. Genet. 2014, 13, 20–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Diversity 13 00496 g001 550
Figure 1. Genetic differentiation based on SNP data in Thailand.
Figure 1. Genetic differentiation based on SNP data in Thailand.
Diversity 13 00496 g001
Diversity 13 00496 g002 550
Figure 2. Haplogroup diversity observed in the Thai population (n = 309) compared with Asian populations. Haplotype frequency of each Asian population was derived from Maruyama et al. [11], Li et al. [16], Yao et al. [21], Lee et al. [23], Summerer et al. [36], Tabbada et al. [39], Maruyama et al. [40], Zhang et al. [41], Shee et al. [42], Fornarino et al. [64], and Mona et al. [65].
Figure 2. Haplogroup diversity observed in the Thai population (n = 309) compared with Asian populations. Haplotype frequency of each Asian population was derived from Maruyama et al. [11], Li et al. [16], Yao et al. [21], Lee et al. [23], Summerer et al. [36], Tabbada et al. [39], Maruyama et al. [40], Zhang et al. [41], Shee et al. [42], Fornarino et al. [64], and Mona et al. [65].
Diversity 13 00496 g002
Diversity 13 00496 g003 550
Figure 3. Heatmap of haplogroup frequencies among Thai populations in the four regions. Darker color indicates higher frequencies.
Figure 3. Heatmap of haplogroup frequencies among Thai populations in the four regions. Darker color indicates higher frequencies.
Diversity 13 00496 g003
Diversity 13 00496 g004 550
Figure 4. Heatmap of haplogroup frequencies of some Asian populations based on SNP data.
Figure 4. Heatmap of haplogroup frequencies of some Asian populations based on SNP data.
Diversity 13 00496 g004
Diversity 13 00496 g005 550
Figure 5. Principal component analysis based on haplogroup frequencies.
Figure 5. Principal component analysis based on haplogroup frequencies.
Diversity 13 00496 g005
Table
Table 1. Summary statistics for the Thai population for two mtDNA regions historically targeted for forensic typing.
Table 1. Summary statistics for the Thai population for two mtDNA regions historically targeted for forensic typing.
Population StatisticsHVI and HVII Sequences
Thai populations (n = 309)
Haplotype264
Unique haplotype231
Diversity0.9985
Matching probability (%)0.4744
Power of discrimination0.9953
Table
Table 2. Pairwise FST among regional Thai populations.
Table 2. Pairwise FST among regional Thai populations.
RegionNorthNortheastCentralSouth
North-0.9991.0000.669
Northeast−0.0069569-1.0000.715
Central−0.0115752−0.0051491-1.000
South−0.0011671−0.0023083−0.0101708-
Lower left half pairwise FST. Bold text indicates FST p-value.
Table
Table 3. Haplogroup frequencies in Thailand (based on classification of HVI and HVII sequence data) (n = 309).
Table 3. Haplogroup frequencies in Thailand (based on classification of HVI and HVII sequence data) (n = 309).
Haplogroup
(Macrohaplogroup M)		nFrequency (%)Haplogroup
(Macrohaplogroup N)		nFrequency (%)
C4a30.9709A10.3236
C4c10.3236A451.6181
C720.6472A4d10.3236
C7a82.5890A5b10.3236
D441.2945B2g10.3236
D4a10.3236B410.3236
D4b20.6472B4a92.9126
D4j10.3236B4b30.9709
D4g10.3236B4c113.5599
D510.3236B4g41.2945
D5b20.6472B5a268.4142
D6c10.3236B5b20.6472
G1a30.9709B6a10.3236
G2a72.2654F1a4313.916
M72.2654F1b10.3236
M3a10.3236F1c10.3236
M3c10.3236F1d10.3236
M5c20.6472F1e10.3236
M7a10.3236F2d10.3236
M7B206.4725F3a51.6181
M7c92.9126F4b10.3236
M8a20.6472N7a10.3236
M9a41.2945N9a82.5890
M9b20.6472N10a51.6181
M1020.6472N10b10.3236
M10a113.5599N11a10.3236
M1110.3236N2110.3236
M12a30.9709N2220.6472
M12b41.2945R210.3236
M17c10.3236R5a10.3236
M2041.2945R9b185.8252
M21d41.2945R9c82.5890
M2620.6472R1110.3236
M34a10.3236R2241.2945
M3820.6472U7a10.3236
M5010.3236Y210.3236
M50a10.3236
M51a10.3236
M68a30.9709
M7110.3236
M71a30.9709
M71b10.3236
M7210.3236
M91a10.3236
Z10.3236
M2620.6472
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Areesirisuk, P.; Srikulnath, K.; Onsod, P.; Jaroensuk, J.; Rerkamnuaychoke, B. Haplogroup Distribution of 309 Thais from Admixed Populations across the Country by HVI and HVII Sanger-Type Sequencing. Diversity 2021, 13, 496. https://doi.org/10.3390/d13100496

AMA Style

Areesirisuk P, Srikulnath K, Onsod P, Jaroensuk J, Rerkamnuaychoke B. Haplogroup Distribution of 309 Thais from Admixed Populations across the Country by HVI and HVII Sanger-Type Sequencing. Diversity. 2021; 13(10):496. https://doi.org/10.3390/d13100496

Chicago/Turabian Style

Areesirisuk, Prapatsorn, Kornsorn Srikulnath, Preyaporn Onsod, Juthamas Jaroensuk, and Budsaba Rerkamnuaychoke. 2021. "Haplogroup Distribution of 309 Thais from Admixed Populations across the Country by HVI and HVII Sanger-Type Sequencing" Diversity 13, no. 10: 496. https://doi.org/10.3390/d13100496

APA Style

Areesirisuk, P., Srikulnath, K., Onsod, P., Jaroensuk, J., & Rerkamnuaychoke, B. (2021). Haplogroup Distribution of 309 Thais from Admixed Populations across the Country by HVI and HVII Sanger-Type Sequencing. Diversity, 13(10), 496. https://doi.org/10.3390/d13100496

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop