Next Article in Journal
Ice Cod Arctogadus glacialis (Peters, 1874) in Northeast Greenland—A First Sketch of Spatial Occurrence and Abundance
Previous Article in Journal
Exploring the Biodiversity of a European NATURA 2000 Mediterranean Lagoon through eDNA Metabarcoding
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 14
Issue 11
10.3390/d14110992
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Invasive Plant Diversity on Soil Microbial Communities

by
Xiaoyan Wang
†,
Xue Wang
†,
Wei Wang
,
Jiang Wang
* and
Feihai Yu
*
School of Life Science, Taizhou University, Taizhou 318000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Diversity 2022, 14(11), 992; https://doi.org/10.3390/d14110992
Submission received: 13 October 2022 / Revised: 13 November 2022 / Accepted: 14 November 2022 / Published: 17 November 2022
(This article belongs to the Topic Plant Invasion)
Browse Figures
Versions Notes

Abstract

:
Native plant communities can be invaded by different numbers of alien plant species or by the same number of alien plant species with different levels of evenness. However, little is known about how alien invasive plant species richness and evenness affect soil microbial communities. We constructed native herbaceous plant communities invaded by exotic plants with different richness (1, 2, 4 and 8 species) and evenness (high and low) and analyzed soil physico-chemical properties and the diversity and composition of soil fungal and bacterial communities by high-throughput Illumina sequencing. Overall, the species richness and evenness of invasive plants had no significant effect on bacterial and fungal alpha diversity (OTUs, Shannon, Simpson, Chao1 and ACE) or the soil physico-chemical properties. However, invasive species richness had a significant impact on the relative abundance of the most dominant fungi, Ascomycota and Bipolaris, and the dominant bacteria, Actinobacteriota, which increased with increasing invasive species richness. The relative abundance of the dominant microbial groups was significantly correlated with the relative abundance of some specific invasive plants in the community. This study sheds new light on the effects of plant co-invasion on soil microbial communities, which may help us understand the underlying mechanisms of multiple alien plant invasion processes from the perspective of soil microorganisms.

1. Introduction

Invasions by alien plants are a world-wide problem that has received great attention [1,2,3,4]. Alien plant invasions may not only displace native plant species and damage local flora and biodiversity but may also negatively influence many other ecosystem functions and services [5,6,7,8,9] in relation to the regional context [10]. Thus, there is a great need to develop measures to efficiently manage and control alien plant invasions [11,12]. To this end, we need to first assess the impacts of alien plant invasions on ecosystem functions such as soil microbial communities [13,14,15,16]. Soil microbial communities can alleviate the effects of invasive plants on local plant communities by degrading allelopathic substances [17], promoting further invasion via symbiosis with arbuscular mycorrhizal fungi or inhibiting further invasion via the accumulation of pathogens [18,19].
Previous studies have shown that alien plant invasions can have profound effects on soil microbial communities [14,20,21]. For instance, alien plant invasions can affect the soil properties [22,23,24,25], species richness and composition of soil microbial communities [26,27], thus destroying the long-term balance between native plants and soil microorganisms [15,16,27]. Some studies have shown that plant invasions can improve soil microbial diversity by providing more energy sources from secondary metabolites or a greater quantity and quality of litter [26,28,29,30]. Other studies have found that plant invasions reduce soil microbial diversity (e.g., AM fungi) [31,32,33] or have no significant effect [33,34].
One overlooked phenomenon in invasion ecology is that a native plant community can be invaded by different numbers of alien plant species [35]. Thus, while many studies have examined the impacts of alien plant invasions on soil microbial communities, the impacts of alien invasive species richness have never been considered. Recent studies found that increasing invasive plant species richness significantly increased the productivity of alien invasive plants and decreased that of native plant communities [35,36,37,38]. This suggests that increasing alien plant species can promote the invasion success of alien plants into native plant communities [35]. Since previous studies have shown that changes in both alien plant productivity and native plant productivity can impact soil microbial communities [39,40,41,42], we hypothesize that alien plant richness can influence soil microbial communities.
Another overlooked phenomenon is that a native plant community can be invaded by the same number of alien plant species with different levels of evenness [35]. As an important aspect of species diversity, evenness is often used to explain inconsistencies in species richness effects [43,44,45,46]. In several cases, evenness explained more biodiversity effects than species richness [47,48]. For instance, it has been shown that species richness had impacts on bacterial communities through the modulation of plant evenness in native grassland communities [46,49]. To our best knowledge, little is known about the effect of invasive plant evenness on soil microbial communities. We speculate that a high level of invasive plant evenness can result in high microbial diversity due to the different contributions of all invasive plants to soil micro-environment changes. By contrast, when the evenness of alien invasive plants is low, only one or two alien species are dominant, so alien plant diversity has similar effects to a monoculture of the dominant species [49,50].
We constructed native herbaceous plant communities invaded by alien plants with different richness (1, 2, 4 and 8 species) and evenness (high and low) to explore the impacts of invasive plant species diversity on soil fungal and bacterial communities. Specifically, we addressed the following questions: (1) Do alien invasive plant richness and evenness affect the diversity and composition of soil fungal communities? (2) Do alien invasive plant richness and evenness affect the diversity and composition of soil bacterial communities? (3) Do alien invasive plant richness and evenness affect the abundance of some specific microbial taxa?

2. Materials and Methods

2.1. Native and Invasive Species Preparation

The plant species pool used to construct experimental plant communities consisted of 18 native plant species and 10 alien invasive plant species that commonly grow in grasslands around Taizhou city (121.43° E, 28.68° N), Zhejiang Province, China [35]. Eight of the native species were perennials (Achyranthes bidentata Blume, Persicaria filiformis (Thunb.) Nakai, Aster trinervius subsp. ageratoides (Turczaninow) Grierson, Bellis perennis L., Carpesium abrotanoides L., Patrinia scabiosifolia Link, Penthorum chinense Pursh and Plantago asiatica L.), and ten were annual/biennial. The ten invasive species include four perennials (Alternanthera philoxeroides (Mart.) Griseb., Mirabilis jalapa L., Solidago canadensis L., and Talinum paniculatum (Jacq.) Gaertn.) and six annuals (Ageratum conyzoides L., Symphyotrichum subulatum (Michx.) G.L.Nesom, Bidens frondosa L., Bidens pilosa L., Celosia argentea L., and Sesbania cannabina (Retz.) Poir.). Detailed information on these species was described by Wang et al. (2022) [35].
Seeds (except Alternanthera philoxeroides) of all native and invasive species were collected from field sites around Taizhou city and stored at 4 °C till use. In April 2020, these seeds were sown into plastic containers (30 cm long × 30 cm wide × 30 cm high) filled with a mixture of river sand and peat. The plastic containers were placed in a greenhouse at Taizhou University, Zhejiang Province, China. For A. philoxeroides, ramets (asexual individuals) were propagated from stem cuttings. One month later, seedlings with similar sizes were used to construct plant communities. Height differences within the same species were limited to 2 cm.

2.2. Experimental Design

On 27 May 2020, 96 native plant communities were constructed in 96 containers (each 120 cm in diameter × 74 cm in height) with 18 native plant species. In each container, each native species was initially planted with three seedlings. The containers were filled with a mixture of soil (0.62 ± 0.17 g kg−1 total N, 0.13 ± 0.03 g kg−1 total P, mean ± SE, n = 5), peat and sand at a volume ratio of 2:1:1. Slow release fertilizer (N:P:K = 14:14:14, Osmocote exact standard 3–4 M) was added to the soil at a dose of 3 g L−1. After one week, individuals of invasive plants with four levels of species richness (1, 2, 4 and 8 species) and two levels of evenness (high and low) were introduced to 90 of the 96 native plant communities (Table A1). For the 1-species treatment, individuals of each of the 10 invasive species were planted in three containers, making 30 communities. For each of the 2-species, 4-species and 8-species treatments, 10 different species mixtures were constructed by randomly selecting them from the species pool in such a way that each species had an equal chance of being selected. Each of these mixtures was replicated twice: one was used for high evenness (2-species, 12:12; 4-species, 6:6:6:6; 8-species, 3:3:3:3:3:3:3:3) and the other for low evenness (2-species, 22:2; 4-species, 18:3:2:1; 8-species, 13:3:2:2:1:1:1:1). For communities with invasive plants, the number of individuals of invasive species in each community was equal (i.e., 24 individuals). In the remaining six native plant communities, invasive species were not introduced. For a more detailed description of the experiment, see Wang et al. (2022) [35].

2.3. Soil Sample Collection and Physico-Chemical Analysis

On 11 October 2020, we took five soil samples (0–10 cm deep) under each of the 90 communities invaded by alien plant species [51,52]. The five soil samples from each container were thoroughly homogenized to form a composite sample. Then, a sub-sample of 10 mL was preserved at −80 °C until DNA extraction for soil microbial analysis. Another sub-sample was air-dried for analysis of soil physico-chemical properties. Soil pH was measured in a 1:2.5 soil:water (w:w) mixture using a digital pH meter (Mettler Toledo FE20, Shanghai, China). Soil organic matter was determined by the Walkley-Black acid digestion method. Soil N-NH4+, N-NO3− (extracted from a 1:5 suspension of soil in 2 M KCl solution) and total N (digested with concentrated H2SO4 and HClO4) were measured using a continuous flow analyzer (Auto Analyzer 3, Bran and Luebbe, Norderstedt, Germany). Total P (digested with concentrated H2SO4 and HClO4) and available P (extracted with 0.5 M NaHCO3) were determined by an inductively coupled plasma emission spectrometer (Optima 2100DV, PerkinElemer, Waltham, MA, USA).

2.4. Microbial Sample Collection and Sequencing

Soil DNA was extracted using a PowerSoil™ DNA Isolation Kit (MoBio, Carlsbad, CA, USA) following the manufacturer’s instructions and then sent to Novogene Co., Ltd., Beijing, China for amplification, library preparation and sequencing. The V4 region of the bacterial 16S rDNA gene was amplified using primers 515F (GTGCCAGCMGCCGCGGTAA) and 806R (GGACTACNNGGGTATCTAAT) [53]. The fungal ITS region rDNA was amplified using primers ITS5-1737F (GGAAGTAAAAGTCGTAACAAGG) and ITS2-2043R (GCTGCGTTCTTCATCGATGC) [54]. The sequencing was done on an Illumina Novaseq 6000 platform, with 250 bp paired-end reads generated. The raw sequencing data have been deposited into the NCBI Sequence Read Archive (SRA) database (Accession Number: PRJNA870235 and PRJNA861831).

2.5. Bioinformatic Analysis

Barcode extraction, paired read assembly and quality filtering of the raw data were processed using the Software QIIME v.1.9.1 [55]. Chimeric sequences were identified and removed using UCHIME [56]. Operational taxonomic units (OTUs) were identified at the 97% similarity level with the UPARSE v.7.1b [57]. The taxonomy of each OTU of bacteria and fungi was assigned by the Uclust method using SILVA release 132 (https://www.arb-silva.de/documentation/release-132, accessed on 5 July 2021) and UNITE database (http://qiime.org/scripts/assign_taxonomy.html, accessed on 5 July 2021), respectively.

2.6. Statistical Analysis

Alpha diversity (Shannon, Simpson, Chao1 and ACE indices) and beta diversity were calculated using the QIIME software (Version 1.9.1) [55]. The effects of invasive plant species richness (log2 scale), evenness and their interaction on alpha diversity index, soil physico-chemical properties and the relative abundance of the most abundant phyla and genera of soil fungi and bacteria were tested by linear mixed models. In these models, invasive species richness was treated as a fixed continuous term, evenness as a fixed categorical term and species composition as a random term [35]. The treatment with a single invasive species was considered a low evenness treatment because monocultures were on the regression lines of uneven rather than even treatments [35,58]. We performed Principal Co-ordinates Analysis (PCoA) and Adonis to test whether species composition of soil microbial communities differed between different treatments based on Weighted Unifrac distance. Linear regressions were used to assess the relationships of invasive species richness with the alpha diversity index, and relative abundances of phyla and genera of fungi and bacteria. Residuals of all variables were checked for homoscedasticity and normality. All statistical analyses were conducted using R 4.1.2 (https://www.r-project.org/, accessed on 10 June 2022).

3. Results

3.1. Effects of Invasive Species Diversity on Alpha Diversity of Soil Microbial Communities

Alien invasive species richness, evenness or their interaction did not significantly affect alpha diversity (OTUs, Shannon, Simpson, Chao1 and ACE) of either soil fungal communities (Table 1A, Figure 1A–E) or soil bacterial communities (Table 1B, Figure 1F–J).

3.2. Effects of Invasive Species Diversity on Soil Physico-Chemical Properties

Alien invasive species richness, evenness or their interaction had no significant effect on any of the soil physico-chemical properties (soil pH, organic matter, total N, NH4_N, NO3_N, total P, available P and available K; Table 1C, Table 2).

3.3. Effects of Invasive Species Diversity on Soil Microbial Community Composition

Soil fungal communities in the 1-, 2- and 4-species treatments were separated from those in the 8-species treatment along the first axis of PCoA (Figure 2A). Results of the Adonis test also confirmed that species composition of soil fungal communities differed between the lower (1-, 2- and 4-species) and the higher (8-species) species richness treatments (Table 3A). For soil bacterial communities, the 1- and 8-species treatments were distinguished from the 2- and 4-species treatments along the first axis of PCoA (Figure 2B), and the results of the Adonis test also confirmed that the differences were significant (Table 3A). However, the Adonis test showed that neither the species compositions of soil fungal communities nor soil bacterial communities differ significantly between the high and the low evenness treatment within each level of species richness (Table 3B).

3.4. Effects of Invasive Species Diversity on Relative Abundances of Soil Microbial Taxa

Regarding soil fungal taxa, Ascomycota, Basidiomycota and Rozellomycota were the three most abundant phyla (Figure 3A). Among them, invasive plant species richness had a significant effect on Ascomycota and Rozellomycota (Table 4); with increasing invasive plant species richness, the relative abundance of Ascomycota increased significantly, while that of Rozellomycota decreased (Figure 3A and Figure 4A). Among the 20 most abundant fungal genera, invasive plant species richness had a significant effect on Bipolaris, unidentified_Rozellomycota_sp and Clitopilus (Table 4A); with increasing invasive plant species richness, the relative abundance of Bipolaris, the most abundant genus, increased significantly, while that of unidentified_Rozellomycota_sp and Clitopilus decreased (Figure 3C and Figure 4A).
Regarding soil bacterial taxa, Proteobacteria, unidentified_Bacteria and Actinobacteriota were the three most abundant phyla (Figure 3B). Invasive plant richness has a significant influence on Actinobacteriota, which increased significantly with the increase of invasive plant species richness (Table 4 and Figure 3B and Figure 4B). Invasive plant evenness had a significant effect on Armatimonadota, and invasive plant richness and evenness had a significant interactive effect on Bdellovibrionota (Table 4B, Figure 3B). Among the 20 most abundant genera of bacteria, invasive plant species richness and evenness had a significant effect on Streptomyces, which increased significantly with the increase of invasive species richness (Table 4B, Figure 3D and Figure 4B). In addition, the interaction of invasive plant richness and evenness had a significant effect on Sphingomonas and Buchnera (Table 4B, Figure 3D).

4. Discussion

A large body of studies has investigated the effects of alien plant invasions on soil microbial communities [14,15,16,20,21], but few have considered the effects of invasive species diversity (richness and evenness). While we found no significant effect of alien invasive plant species richness and evenness on the alpha diversity of soil fungal and bacterial communities, there was a significant effect of invasive species richness on the community composition of both soil fungi and bacteria and on the relative abundances of some specific microbial taxa.

4.1. Effects of Invasive Species Diversity on Alpha Diversity of Soil Microbial Communities

Although, in the same experimental setup, increasing invasive species richness was found to significantly change the species compositions of the plant communities by increasing the productivity of alien invasive plant species and decreasing that of native plant species [35], it had no impact on alpha diversity of either soil fungal or bacterial communities. Previous studies testing the role of native plant richness showed that alpha diversity of soil fungal communities can have a positive [16,59,60], negative [61,62] or no relationship [63,64,65,66,67] with native plant species richness. The positive relationship could be because of more diverse microhabitats and/or resources created by the higher richness of plant species [16,63,68]. For example, soil fungal richness increased with native plant richness through the increase of soil total carbon [16]. The negative relationship results from the greater impact of context (e.g., plant biomass, soil pH and plant species identity) [61,62]. For example, soil resources and plant species had a stronger effect on soil biota than plant species richness [69].
The neutral effect of invasive plant species richness on soil microbial diversity in this study may be related to the antagonistic effects among different invasive plants on soil microorganisms [20]. This can be explained from two aspects: different invasive plants have opposite effects on the same microbial group, and the same invasive plant communities have opposite effects on different microbial groups. In this study, the first aspect can be confirmed by the opposite effects of the relative abundance of different invasive plants on specific microbial groups (Table A2). For example, the relative abundance of the invasive plants Alternanthera philoxeroides, Sesbania cannabina and Talinum paniculatum was significantly negatively correlated with the relative abundance of Bipolaris, the genus with the highest relative abundance of fungi, while the relative abundance of Bidens frondosa showed the opposite trend (Table A2).
For the second aspect, when multiple invasive plants co-exist, some species favor some particular microbial taxa and inhibit others, with the result that there is no significant change, as reported before [23]. In this study, this explanation can be evidenced by the opposite trend of the effect of invasive species diversity on the relative abundance of some fungal taxa (i.e., Ascomycota vs. Rozellomycota and Bipolaris vs. unidentified_Rozellomycota_sp and Clitopilus; Figure 4A). The same situation is present in soil bacterial communities, i.e., increasing invasive species richness increased the relative abundance of Actinobacteriota and decreased that of Streptomyces (Figure 4B).
Soil is an important environmental factor for microbial life. Many studies on the effects of plant richness on microbial life have found that this relationship is ultimately explained not only by plant species richness but also by soil physico-chemical properties, such as soil pH [70,71]. In this study, although soil microbial diversity was significantly negatively correlated with some soil physico-chemical properties (Table A3), invasive species richness and evenness had no significant effect on soil physico-chemical properties. Therefore, invasive species diversity may not change soil microbial diversity via altering soil physico-chemical properties.

4.2. Effects of Invasive Species Diversity on Soil Microbial Taxa and Community Composition

Specific taxa of microorganisms play an important role in maintaining microbial community structure and affecting ecosystem functions [72,73] (In this study, invasive species richness and evenness have significant effects on some specific taxa of fungi and bacteria (Table 4; Figure 4). Our results revealed that high invasive plant richness promoted the most abundant fungal phylum of Ascomycota and the most abundant fungal genus of Bipolaris and suppressed the fungal phylum of Rozellomycota and fungal genus of unidentified_Rozellomycota_sp and Clitopilus.
Ascomycota is one of the most common phyla among soil fungi and is the most abundant phyla in the soil of many invasive sites [16,29]. Similarly, Ascomycota possessed more than 50% relative abundance in each treatment of this study and increased significantly with increasing invasive species richness. As Ascomycota contained a wide diversity of fungal taxa, ranging from pathogens to mutualists, its ecological function depends on the comprehensive effect of each member. The increasing tendency of relative abundance of Ascomycota with invasive species richness in this study may be partly explained by its member Bipolaris, the most abundant genus of fungi, which also increased significantly with increasing invasive species richness. The genus of Bipolaris includes more than 20 species of pathogens that can infect a broad range of grasses [74,75,76], including invasive plants (e.g., Microstegium) [77]. Our results suggest that increasing invasive species richness may facilitate pathogen emergence and amplification, and these effects may inhibit native plant growth and promote further invasions. On the other hand, the accumulation of pathogens may also inhibit the invasion of alien plants [77].
For soil bacterial communities, Actinobacteriota, one of the largest taxonomic units of bacteria, increased significantly with increasing invasive species richness. As plant growth-promoting rhizobacteria, Actinobacteriota constitute important drivers of rhizosphere nutrient cycling and play a role as biocontrol agents against a range of pathogenic fungi and promote plant growth by phosphate solubilization, secondary metabolite production and antimicrobial synthesis [78,79,80]. Our results agreed with the findings of a previous study, which showed that increasing native crop diversity increased the relative abundance of Actinobacteriota [81]. In this study, the increased relative abundance of Actinobacteriota in more diverse invasive plant communities has the same trend with its member Streptomyces, which is the most abundant and arguably the most important actinomycetes, and is a good source of bioactive compounds, antibiotics, and extracellular enzymes [79,80,82]. Although studies have shown that plant invasion (e.g., Ageratina adenophora) increases the relative abundance of Streptomyces [83], the relative abundances of Actinobacteriota and Streptomyces were all negatively related to the relative abundance of the invasive plants Sesbania cannabina and Talinum paniculatum (Table A2). Therefore, invasive species richness may affect this microbe (Actinobacteriota and Streptomyces) through species-species interactions and species-environment interactions, and this effect may be beneficial to the growth and competitiveness of invasive plants themselves [83].

5. Conclusions

We conclude that alien invasive plant species diversity had no effect on the alpha diversity of both soil fungal and bacterial communities, likely because the dominant microbial groups showed opposite responses to alien invasive species diversity. One caveat is that the soil samples were collected only after one growing season of invasion, so the impact of invasive species diversity on the alpha diversity of soil microbial communities may not be big enough. Thus, future studies could test the longer-term effect of alien invasive plant species diversity on the alpha diversity of soil microbes. Given the important effects of soil microbial communities on plant growth, especially pathogens, it is possible that soil microorganisms may have important effects on native plants or invasive plants to alter community composition. Therefore, it is worth further researching if invasive plant diversity can affect the plant community composition through the influence of soil pathogens.

Author Contributions

Conceptualization, X.W. (Xiaoyan Wang), X.W. (Xue Wang), J.W. and F.Y.; methodology, X.W. (Xiaoyan Wang), X.W. (Xue Wang) and W.W.; formal analysis, X.W. (Xiaoyan Wang) and W.W.; writing—original draft preparation, X.W. (Xiaoyan Wang) and J.W.; writing—review and editing, X.W. (Xue Wang), J.W. and F.Y.; funding acquisition, X.W. (Xiaoyan Wang) and J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Basic Public Welfare Research Projects of Zhejiang Province (No. LGN19C150004); Natural Science Foundation of Zhejiang Province (Nos. LY22C030001, LTY22C030004); National Natural Science Foundation of China (No. 31870504); 2021 Taizhou College Students Science and Technology Innovation Project (No. 2).

Institutional Review Board Statement

There are no humans or vertebrates involved in the current study.

Informed Consent Statement

No human subjects were involved or recruited in the current study.

Data Availability Statement

Data will be available upon request.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table
Table A1. Species composition ratio in different richness levels and evenness levels.
Table A1. Species composition ratio in different richness levels and evenness levels.
1-species2-species
High evennessLow evenness
Invasive species123456789101234567891012345678910
Bidens pilosa24 12 12 22 2
Bidens frondosa 24 12 12 22 22
Ageratum conyzoides 24 12 12 2 22
Sesbania cannabina 24 1212 222
Talinum paniculatum 24 12 12 2 2
Celosia argentea 24 12 12 2 22
Solidago canadensis 24 12 12 22 2
Mirabilis jalapa 24 12 12 22 22
Alternanthera philoxeroides 24 12 12 22 2
Aster subulatus 24 12 12 2 22
4-species8-species
High evennessLow evennessHigh evennessLow evenness
12345678910123456789101234567891012345678910
6666 18321 33333333 132113112
6 666 3 3181 33 333333131 121123
6 66 6 18 12 3 33 333333 133 111221
666 6 232 18 33 333 33331 1113 311
66 6 621 2 183 333 33332 1132 2232
66 66 1318182 33333333 212213311
6 66 6 18 2233 3333333 3 1121111 13
6666 1323333 333 31311 1213 1
6 6 6 61 18 13333 33331211 31113
666 6 1813 1 333333 331213232 11
The numbers in the third row represent the number of experiment replicates. For 1-species, there are three replicates for each species, which was not shown in the table. Other numbers represent the seedling number of different species planted in each community.
Table
Table A2. Pearson correlation analysis between top 20 predominant phyla and genus and percentage of initial plant number for 10 invasive plants.
Table A2. Pearson correlation analysis between top 20 predominant phyla and genus and percentage of initial plant number for 10 invasive plants.
Bidens pilosaBidens frondosaAgeratum conyzoidesSesbania cannabinaTalinum paniculatumCelosia argenteaSolidago canadensisMirabilis jalapaAlternanthera philoxeroidesAster subulatus
Fungi
 Phylum
  Ascomycota−0.375 *0.265 −0.328−0.465 **−0.248 0.052 −0.241 0.337−0.474 **−0.340
  Basidiomycota0.195 0.124 0.080 0.531 **0.179 −0.114 0.202 −0.219 0.367 *−0.182
  Rozellomycota0.265 −0.225 0.541 **0.391 *0.066 0.065 0.099 0.186 0.481 **0.174
  Chytridiomycota−0.178 −0.281 0.314−0.166 −0.007 0.243 −0.106 −0.152 0.229 0.044
  Mortierellomycota−0.151 −0.037 0.293 0.352−0.102 −0.278 0.331−0.256 0.370 *0.598 **
  Glomeromycota0.126 0.206 0.145 −0.220 0.237 −0.3120.066 0.382 *−0.173 −0.045
  Mucoromycota−0.001 −0.078 −0.126 0.492 **0.174 0.069 0.102 −0.100 0.018 0.148
  Monoblepharomycota0.255 −0.122 0.052 −0.189 0.549 **0.063 −0.005 −0.077 −0.100 −0.079
 Genus
  Bipolaris−0.3090.419 *−0.352−0.389 *−0.426 *−0.350 −0.139 0.197 −0.429 *−0.282
  Alternaria0.026 −0.366 *−0.225 −0.090 0.094 0.380 *−0.043 0.161 −0.281 0.068
  Monographella−0.181 −0.242 0.514 **−0.155 0.174 0.297 −0.045 −0.083 −0.213 −0.155
  unidentified_Tremellodendropsidales_sp0.038 −0.007 −0.162 0.3230.101 −0.076 0.128 −0.3400.398 *−0.196
  Blumeria0.028 −0.182 −0.142 0.388 *0.270 0.153 −0.106 0.516 **0.417 *0.160
  unidentified−0.026 −0.058 −0.148 0.288 0.075 −0.089 0.156 −0.3040.366 *−0.191
  Cladosporium−0.020 −0.317−0.230 0.051 0.006 0.101 −0.116 0.280 −0.187 −0.078
  unidentified_Rozellomycota_sp0.279 −0.237 0.588 **0.445 *0.048 0.097 0.056 0.298 0.476 **0.124
  Clitopilus0.668 **0.195 0.293 0.570 **0.157 −0.035 0.187 0.113 0.256 0.137
  Albifimbria−0.124 −0.164 −0.114 −0.153 0.037 0.266 0.090 −0.096 −0.123 0.346
  Trichoderma−0.050 0.093 0.440 *0.112 0.329−0.164 −0.034 −0.178 0.137 0.121
  unidentified_Dothideomycetes_sp0.335−0.038 0.049 −0.051 0.289 −0.089 −0.181 0.104 −0.058 −0.167
Bacteria
 Phylum
  Proteobacteria−0.013 0.207 −0.139 0.197 0.267 −0.062 0.225 0.058 0.060 −0.498 **
  unidentified_Bacteria0.242 −0.147 0.221 0.229 −0.186 −0.024 0.027 0.062 0.488 **−0.113
  Actinobacteriota−0.431 *0.061 −0.180 −0.478 **−0.358 *−0.117 −0.271 0.152 −0.277 0.169
  Verrucomicrobiota−0.001 −0.100 0.212 −0.209 0.142 0.056 −0.115 −0.295 −0.357 *−0.055
  Firmicutes0.006 −0.019 −0.008 −0.185 −0.133 −0.055 −0.176 −0.064 −0.182 0.506 **
  Thermoplasmatota0.149 −0.269 0.394 *0.068 0.013 0.294 −0.203 −0.066 0.159 0.527 **
  Acidobacteriota0.132 −0.400 *−0.139 0.109 0.055 0.158 0.233 −0.186 −0.060 0.172
  Myxococcota−0.029 −0.169 −0.056 0.490 **0.244 0.421 *−0.021 −0.028 −0.165 −0.228
  Gemmatimonadota−0.005 −0.192 0.349−0.353−0.219 −0.022 0.055 −0.190 0.106 0.065
  Gemmatimonadetes−0.024 0.363 *−0.019 −0.438 *−0.241 −0.270 0.339−0.178 0.007 0.076
  Latescibacterota0.228 −0.286 −0.155 0.3320.406 *0.218 0.152 −0.081 −0.017 0.023
  Bdellovibrionota0.045 −0.092 0.249 0.221 0.188 0.191 0.020 −0.038 −0.047 −0.377 *
  Nitrospirota−0.106 −0.036 0.042 −0.123 −0.063 −0.065 0.381 *−0.287 0.005 −0.383 *
  RCP2-54−0.005 −0.025 0.121 0.333−0.034 0.107 0.118 0.172 0.374 *−0.164
  Desulfobacterota0.072 0.097 0.146 −0.221 −0.056 −0.025 −0.092 −0.039 −0.138 0.723 **
 Genus
  Acidibacter−0.086 −0.271 0.227 0.010 0.386 *0.113 0.037 −0.116 −0.328−0.067
  IS-440.341−0.424 *−0.105 0.376 *0.3540.116 −0.180 0.125 0.035 0.094
  Sphingomonas−0.284 0.313−0.165 −0.302−0.239 −0.3410.373 *−0.099 0.102 −0.296
  Opitutus0.089 0.071 0.320−0.3090.048 −0.014 −0.237 −0.189 −0.3250.171
  Lactobacillus−0.059 −0.068 −0.010 −0.033 −0.065 −0.097 −0.045 −0.130 −0.111 0.469 **
  Ohtaekwangia0.146 −0.278 −0.272 0.430 *0.084 0.142 −0.021 0.037 0.088 −0.062
  SWB020.184 −0.178 −0.121 0.3370.066 0.214 0.158 −0.025 −0.057 0.063
  Terrimonas0.192 −0.019 0.368 *0.007 0.190 −0.172 0.100 0.235 0.044 0.165
  Aeromicrobium−0.237 0.331−0.242 −0.237 −0.240 −0.144 −0.343−0.199 −0.283 −0.202
  Subgroup_10−0.053 −0.186 0.018 −0.188 −0.071 −0.131 0.252 −0.076 −0.010 0.445 *
  Lacunisphaera−0.109 −0.113 0.225 −0.065 0.194 0.078 −0.061 −0.307−0.241 −0.380 *
  Dongia−0.073 −0.065 −0.052 0.075 0.244 −0.118 0.229 −0.044 0.216 −0.342
  Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium−0.3240.401 *−0.002 0.080 −0.343−0.288 −0.062 0.154 0.239 −0.358 *
  Streptomyces−0.268 −0.017 −0.089 −0.524 **−0.363 *−0.199 −0.410 *−0.160 −0.372 *−0.070
  Azoarcus0.383 *0.007 −0.210 0.247 0.359 *0.344−0.224 0.077 0.288 −0.307
  YC-ZSS-LKJ1470.059 −0.290 0.315−0.314−0.232 −0.010 −0.034 −0.252 0.039 −0.112
Only significant or critical significant results are shown here. Values in the table are correlation coefficients, with bold font indicating a significant correlation and bold and italic font indicating critical significance. Asterisk indicates a significant correlation. “*” represents 0.01 ≤ p < 0.05; “**” represents p < 0.01.
Table
Table A3. Pearson correlation analysis between soil physico-chemical properties and fungal and bacterial diversity indices.
Table A3. Pearson correlation analysis between soil physico-chemical properties and fungal and bacterial diversity indices.
Fungi Bacteria
OTUsShannonSimpsonChao1ACEOTUsShannonSimpsonChao1ACE
pH0.069 0.092 0.101 0.070 0.065 −0.009 0.060 0.044 0.030 −0.005
Organic matter0.004 0.066 0.009 −0.013 −0.004 0.054 −0.154 −0.1910.044 0.063
Total N0.012 0.002 −0.012 −0.009 −0.010 −0.008 −0.063 −0.046 −0.011 0.028
NH4_N−0.080 −0.043 −0.066 −0.082 −0.079 0.006 0.073 0.052 −0.047 −0.052
NO3_N−0.275 **−0.106 −0.033 −0.239 *−0.241 *−0.067 0.042 0.065 −0.140 −0.124
Total P−0.252 *−0.191−0.123 −0.265 **−0.240 *0.039 0.074 0.073 0.029 0.051
Available P−0.225 *−0.207 *−0.182−0.188−0.178−0.225 *−0.068 0.017 −0.261 *−0.250 *
Available K−0.039 −0.097 −0.139 −0.025 −0.015 −0.158 −0.034 −0.020 −0.208 *−0.203 *
Values in the table are correlation coefficients, with bold font indicating a significant correlation and bold and italic font indicating critical significance. Asterisk indicates a significant correlation. “*” represents 0.01 ≤ p < 0.05; “**” represents p < 0.01.

References

  1. van Kleunen, M.; Dawson, W.; Essl, F.; Pergl, J.; Winter, M.; Weber, E.; Kreft, H.; Weigelt, P.; Kartesz, J.; Nishino, M.; et al. Global exchange and accumulation of non-native plants. Nature 2015, 525, 100–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Lambertini, M.; Leape, J.; Marton-Lefèvre, J.; Mittermeier, R.A.; Rose, M.; Robinson, J.G.; Stuart, S.N.; Waldman, B.; Genovesi, P. Invasives: A major conservation threat. Science 2011, 333, 404–405. [Google Scholar] [CrossRef] [PubMed]
  3. Atwater, D.Z.; Callaway, R.M. Extended consequences of selection by exotic invaders on natives. New Phytol. 2022, 233, 588–591. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, W.; Shi, J.; Xie, Q.; Jiang, Y.; Yu, N.; Wang, E. Nutrient exchange and regulation in arbuscular mycorrhizal symbiosis. Mol. Plant 2017, 10, 1147–1158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Pysek, P.; Hulme, P.E.; Simberloff, D.; Bacher, S.; Blackburn, T.M.; Carlton, J.T.; Dawson, W.; Essl, F.; Foxcroft, L.C.; Genovesi, P.; et al. Scientists’ warning on invasive alien species. Biol. Rev. 2020, 95, 1511–1534. [Google Scholar] [CrossRef]
  6. Simberloff, D.; Martin, J.L.; Genovesi, P.; Maris, V.; Wardle, D.A.; Aronson, J.; Courchamp, F.; Galil, B.; Garcia-Berthou, E.; Pascal, M.; et al. Impacts of biological invasions: What’s what and the way forward. Trends Ecol. Evol. 2013, 28, 58–66. [Google Scholar] [CrossRef] [Green Version]
  7. Vila, M.; Espinar, J.L.; Hejda, M.; Hulme, P.E.; Jarosik, V.; Maron, J.L.; Pergl, J.; Schaffner, U.; Sun, Y.; Pysek, P. Ecological impacts of invasive alien plants: A meta-analysis of their effects on species, communities and ecosystems. Ecol. Lett. 2011, 14, 702–708. [Google Scholar] [CrossRef]
  8. Xu, H.; Liu, Q.; Wang, S.; Yang, G.; Xue, S. A global meta-analysis of the impacts of exotic plant species invasion on plant diversity and soil properties. Sci. Total Environ. 2022, 810, 152286. [Google Scholar] [CrossRef]
  9. Pisani, D.; Pazienza, P.; Perrino, E.V.; Caporale, D.; De Lucia, C. The economic valuation of ecosystem services of biodiversity components in protected areas: A review for a framework of analysis for the Gargano National Park. Sustainability 2021, 13, 11726. [Google Scholar] [CrossRef]
  10. Stinca, A.; Musarella, C.M.; Rosati, L.; Laface, V.L.A.; Licht, W.; Fanfarillo, E.; Wagensommer, R.P.; Galasso, G.; Fascetti, S.; Esposito, A.; et al. Italian vascular flora: New findings, updates and exploration of floristic similarities between regions. Diversity 2021, 13, 600. [Google Scholar] [CrossRef]
  11. Byun, C.; Lee, E.J. Ecological application of biotic resistance to control the invasion of an invasive plant, Ageratina altissima. Ecol. Evol. 2017, 7, 2181–2192. [Google Scholar] [CrossRef] [PubMed]
  12. Hoffberg, S.L.; Mauricio, R.; Hall, R.J. Control or re-treat? Model-based guidelines for managing established plant invasions. Biol. Invasions 2018, 20, 1387–1402. [Google Scholar] [CrossRef]
  13. Zhang, Z.; Liu, Y.; Brunel, C.; van Kleunen, M. Soil-microorganism-mediated invasional meltdown in plants. Nat. Ecol. Evol. 2020, 4, 1612–1621. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, G.L.; Bai, J.H.; Tebbe, C.C.; Huang, L.B.; Jia, J.; Wang, W.; Wang, X.; Yu, L.; Zhao, Q.Q. Plant invasion reconstructs soil microbial assembly and functionality in coastal salt marshes. Mol. Ecol. 2022, 31, 4478–4494. [Google Scholar] [CrossRef] [PubMed]
  15. Torres, N.; Herrera, I.; Fajardo, L.; Bustamante, R.O. Meta-analysis of the impact of plant invasions on soil microbial communities. BMC Evol. Biol. 2021, 21, 172. [Google Scholar] [CrossRef] [PubMed]
  16. Shen, C.; Wang, J.; He, J.Z. Plant diversity enhances soil fungal diversity and microbial resistance to plant invasion. Appl. Environ. Microbiol. 2021, 87, e00251-00221. [Google Scholar] [CrossRef]
  17. Li, Y.-P.; Feng, Y.-L.; Chen, Y.-J.; Tian, Y.-H. Soil microbes alleviate allelopathy of invasive plants. Sci. Bull. 2015, 60, 1083–1091. [Google Scholar] [CrossRef] [Green Version]
  18. Zhang, F.-J.; Li, Q.; Chen, F.-X.; Xu, H.-Y.; Inderjit; Wan, F.-H. Arbuscular mycorrhizal fungi facilitate growth and competitive ability of an exotic species Flaveria bidentis. Soil Biol. Biochem. 2017, 115, 275–284. [Google Scholar] [CrossRef]
  19. van der Putten, W.H.; Klironomos, J.N.; Wardle, D.A. Microbial ecology of biological invasions. ISME J. 2007, 1, 28–37. [Google Scholar] [CrossRef] [Green Version]
  20. Stefanowicz, A.M.; Stanek, M.; Nobis, M.; Zubek, S. Species-specific effects of plant invasions on activity, biomass, and composition of soil microbial communities. Biol. Fertil. Soils 2016, 52, 841–852. [Google Scholar] [CrossRef]
  21. Jacobs, K.; Conradie, T.; Jacobs, S. Microbial communities in the Fynbos region of South Africa: What happens during woody alien plant invasions. Diversity 2020, 12, 254. [Google Scholar] [CrossRef]
  22. Kuebbing, S.E.; Classen, A.T.; Simberloff, D. Two co-occurring invasive woody shrubs alter soil properties and promote subdominant invasive species. J. Appl. Ecol. 2014, 51, 124–133. [Google Scholar] [CrossRef] [Green Version]
  23. Gibbons, S.M.; Lekberg, Y.; Mummey, D.L.; Sangwan, N.; Ramsey, P.W.; Gilbert, J.A. Invasive plants rapidly reshape soil properties in a grassland ecosystem. mSystems 2017, 2, e00178-00116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Qu, T.; Du, X.; Peng, Y.; Guo, W.; Zhao, C.; Losapio, G. Invasive species allelopathy decreases plant growth and soil microbial activity. PLoS ONE 2021, 16, e0246685. [Google Scholar] [CrossRef] [PubMed]
  25. Ehrenfeld, J.G. Effects of exotic plant invasions on soil nutrient cycling processes. Ecosystems 2003, 6, 503–523. [Google Scholar] [CrossRef]
  26. Gaggini, L.; Rusterholz, H.-P.; Baur, B. The invasive plant Impatiens glandulifera affects soil fungal diversity and the bacterial community in forests. Appl. Soil Ecol. 2018, 124, 335–343. [Google Scholar] [CrossRef]
  27. Bell, J.K.; Siciliano, S.D.; Lamb, E.G. A survey of invasive plants on grassland soil microbial communities and ecosystem services. Sci. Data 2020, 7, 86. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Zhang, P.; Li, B.; Wu, J.; Hu, S. Invasive plants differentially affect soil biota through litter and rhizosphere pathways: A meta-analysis. Ecol. Lett. 2019, 22, 200–210. [Google Scholar] [CrossRef] [Green Version]
  29. Wang, C.; Zhou, J.; Liu, J.; Jiang, K.; Xiao, H.; Du, D. Responses of the soil fungal communities to the co-invasion of two invasive species with different cover classes. Plant Biol. 2018, 20, 151–159. [Google Scholar] [CrossRef]
  30. Liao, C.; Peng, R.; Luo, Y.; Zhou, X.; Wu, X.; Fang, C.; Chen, J.; Li, B. Altered ecosystem carbon and nitrogen cycles by plant invasion: A meta-analysis. New Phytol. 2008, 177, 706–714. [Google Scholar] [CrossRef]
  31. Vogelsang, K.M.; Bever, J.D. Mycorrhizal densities decline in association with nonnative plants and contribute to plant invasion. Ecology 2009, 90, 399–407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Shah, M.A.; Beaulieu, M.-E.; Reshi, Z.A.; Qureshi, S.; Khasa, D.P. A cross-city molecular biogeographic investigation of arbuscular mycorrhizas in Conyza canadensis rhizosphere across native and non-native regions. Ecol. Process. 2015, 4, 7. [Google Scholar] [CrossRef] [Green Version]
  33. Řezáčová, V.; Řezáč, M.; Gryndler, M.; Hršelová, H.; Gryndlerová, H.; Michalová, T. Plant invasion alters community structure and decreases diversity of arbuscular mycorrhizal fungal communities. Appl. Soil Ecol. 2021, 167, 104039. [Google Scholar] [CrossRef]
  34. Custer, G.F.; van Diepen, L.T.A. Plant invasion has limited impact on soil microbial α-diversity: A meta-analysis. Diversity 2020, 12, 112. [Google Scholar] [CrossRef] [Green Version]
  35. Wang, X.; Wang, J.; Hu, B.; Zheng, W.-L.; Li, M.; Shen, Z.-X.; Yu, F.-H.; Schmid, B.; Li, M.-H. Richness, not evenness, of invasive plant species promotes invasion success into native plant communities via selection effects. Oikos 2022, 2022, e08966. [Google Scholar] [CrossRef]
  36. Wilsey, B.J.; Teaschner, T.B.; Daneshgar, P.P.; Isbell, F.I.; Polley, H.W. Biodiversity maintenance mechanisms differ between native and novel exotic-dominated communities. Ecol. Lett. 2009, 12, 432–442. [Google Scholar] [CrossRef] [Green Version]
  37. Kuebbing, S.E.; Souza, L.; Sanders, N.J. Effects of co-occurring non-native invasive plant species on old-field succession. For. Ecol. Manag. 2014, 324, 196–204. [Google Scholar] [CrossRef]
  38. Kuebbing, S.E.; Classen, A.T.; Sanders, N.J.; Simberloff, D. Above- and below-ground effects of plant diversity depend on species origin: An experimental test with multiple invaders. New Phytol. 2015, 208, 727–735. [Google Scholar] [CrossRef]
  39. Zak, D.R.; Tilman, D.; Parmenter, R.R.; Rice, C.W.; Fisher, F.M.; Vose, J.; Milchunas, D.; Martin, C.W. Plant production and soil microorganisms in late-successional ecosystems: A continental-scale study. Ecology 1994, 75, 2333–2347. [Google Scholar] [CrossRef]
  40. Waldrop, M.P.; Holloway, J.M.; Smith, D.B.; Goldhaber, M.B.; Drenovsky, R.E.; Scow, K.M.; Dick, R.; Howard, D.; Wylie, B.; Grace, J.B. The interacting roles of climate, soils, and plant production on soil microbial communities at a continental scale. Ecology 2017, 98, 1957–1967. [Google Scholar] [CrossRef]
  41. McTee, M.R.; Lekberg, Y.; Mummey, D.; Rummel, A.; Ramsey, P.W. Do invasive plants structure microbial communities to accelerate decomposition in intermountain grasslands? Ecol. Evol. 2017, 7, 11227–11235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Broughton, L.C.; Gross, K.L. Patterns of diversity in plant and soil microbial communities along a productivity gradient in a Michigan old-field. Oecologia 2000, 125, 420–427. [Google Scholar] [CrossRef] [PubMed]
  43. Wilsey, B.J.; Chalcraft, D.R.; Bowles, C.M.; Willig, M.R. Relationships among indices suggest that richness is an incomplete surrogate for grassland biodiversity. Ecology 2005, 86, 1178–1184. [Google Scholar] [CrossRef]
  44. Wang, X.-Y.; Ge, Y.; Gao, S.; Chen, T.; Wang, J.; Yu, F.-H. Evenness alters the positive effect of species richness on community drought resistance via changing complementarity. Ecol. Indic. 2021, 133, 108464. [Google Scholar] [CrossRef]
  45. Wang, J.; Yu, F.-H. Effects of functional diversity and functional dominance on complementary light use depend on evenness. J. Veg. Sci. 2018, 29, 726–736. [Google Scholar] [CrossRef]
  46. Sun, Y.-Q.; Wang, J.; Shen, C.; He, J.-Z.; Ge, Y. Plant evenness modulates the effect of plant richness on soil bacterial diversity. Sci. Total Environ. 2019, 662, 8–14. [Google Scholar] [CrossRef]
  47. Zhang, Y.; Chen, H.Y.H.; Reich, P.B. Forest productivity increases with evenness, species richness and trait variation: A global meta-analysis. J. Ecol. 2012, 100, 742–749. [Google Scholar] [CrossRef]
  48. Filstrup, C.T.; King, K.B.S.; McCullough, I.M. Evenness effects mask richness effects on ecosystem functioning at macro-scales in lakes. Ecol. Lett. 2019, 22, 2120–2129. [Google Scholar] [CrossRef]
  49. Lamb, E.G.; Kennedy, N.; Siciliano, S.D. Effects of plant species richness and evenness on soil microbial community diversity and function. Plant Soil 2011, 338, 483–495. [Google Scholar] [CrossRef]
  50. Kirwan, L.; LÜScher, A.; SebastiÀ, M.T.; Finn, J.A.; Collins, R.P.; Porqueddu, C.; Helgadottir, A.; Baadshaug, O.H.; Brophy, C.; Coran, C.; et al. Evenness drives consistent diversity effects in intensive grassland systems across 28 European sites. J. Ecol. 2007, 95, 530–539. [Google Scholar] [CrossRef]
  51. Sadiqi, S.; Hamza, M.; Ali, F.; Alam, S.; Shakeela, Q.; Ahmed, S.; Ayaz, A.; Ali, S.; Saqib, S.; Ullah, F.; et al. Molecular characterization of bacterial isolates from soil samples and evaluation of their antibacterial potential against MDRS. Molecules 2022, 27, 6281. [Google Scholar] [CrossRef]
  52. Porazinska, D.L.; Farrer, E.C.; Spasojevic, M.J.; Bueno de Mesquita, C.P.; Sartwell, S.A.; Smith, J.G.; White, C.T.; King, A.J.; Suding, K.N.; Schmidt, S.K. Plant diversity and density predict belowground diversity and function in an early successional alpine ecosystem. Ecology 2018, 99, 1942–1952. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Bergmann, G.T.; Bates, S.T.; Eilers, K.G.; Lauber, C.L.; Caporaso, J.G.; Walters, W.A.; Knight, R.; Fierer, N. The under-recognized dominance of Verrucomicrobia in soil bacterial communities. Soil Biol. Biochem. 2011, 43, 1450–1455. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Wei, W.; Yang, M.; Liu, Y.; Huang, H.; Ye, C.; Zheng, J.; Guo, C.; Hao, M.; He, X.; Zhu, S. Fertilizer N application rate impacts plant-soil feedback in a sanqi production system. Sci. Total Environ. 2018, 633, 796–807. [Google Scholar] [CrossRef]
  55. Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef] [Green Version]
  57. Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef]
  58. Schmitz, M.; Flynn, D.F.B.; Mwangi, P.N.; Schmid, R.; Scherer-Lorenzen, M.; Weisser, W.W.; Schmid, B. Consistent effects of biodiversity on ecosystem functioning under varying density and evenness. Folia Geobot. 2013, 48, 335–353. [Google Scholar] [CrossRef] [Green Version]
  59. Peay, K.G.; Baraloto, C.; Fine, P.V.A. Strong coupling of plant and fungal community structure across western Amazonian rainforests. ISME J. 2013, 7, 1852–1861. [Google Scholar] [CrossRef]
  60. Dassen, S.; Cortois, R.; Martens, H.; de Hollander, M.; Kowalchuk, G.A.; van der Putten, W.H.; de Deyn, G.B. Differential responses of soil bacteria, fungi, archaea and protists to plant species richness and plant functional group identity. Mol. Ecol. 2017, 26, 4085–4098. [Google Scholar] [CrossRef]
  61. Yang, N.; Zhang, Y.; Li, J.; Li, X.; Ruan, H.; Bhople, P.; Keiblinger, K.; Mao, L.; Liu, D. Interaction among soil nutrients, plant diversity and hypogeal fungal trophic guild modifies root-associated fungal diversity in coniferous forests of Chinese Southern Himalayas. Plant Soil 2022. [Google Scholar] [CrossRef]
  62. Tedersoo, L.; Bahram, M.; Cajthaml, T.; Põlme, S.; Hiiesalu, I.; Anslan, S.; Harend, H.; Buegger, F.; Pritsch, K.; Koricheva, J.; et al. Tree diversity and species identity effects on soil fungi, protists and animals are context dependent. ISME J. 2016, 10, 346–362. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Waldrop, M.P.; Zak, D.R.; Blackwood, C.B.; Curtis, C.D.; Tilman, D. Resource availability controls fungal diversity across a plant diversity gradient. Ecol. Lett. 2006, 9, 1127–1135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Prober, S.M.; Leff, J.W.; Bates, S.T.; Borer, E.T.; Firn, J.; Harpole, W.S.; Lind, E.M.; Seabloom, E.W.; Adler, P.B.; Bakker, J.D.; et al. Plant diversity predicts beta but not alpha diversity of soil microbes across grasslands worldwide. Ecol. Lett. 2015, 18, 85–95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Nguyen, N.H.; Williams, L.J.; Vincent, J.B.; Stefanski, A.; Cavender-Bares, J.; Messier, C.; Paquette, A.; Gravel, D.; Reich, P.B.; Kennedy, P.G. Ectomycorrhizal fungal diversity and saprotrophic fungal diversity are linked to different tree community attributes in a field-based tree experiment. Mol. Ecol. 2016, 25, 4032–4046. [Google Scholar] [CrossRef]
  66. Fierer, N.; McCain, C.M.; Meir, P.; Zimmermann, M.; Rapp, J.M.; Silman, M.R.; Knight, R. Microbes do not follow the elevational diversity patterns of plants and animals. Ecology 2011, 92, 797–804. [Google Scholar] [CrossRef] [Green Version]
  67. Chen, Y.; Xu, T.; Fu, W.; Hu, Y.; Hu, H.; You, L.; Chen, B. Soil organic carbon and total nitrogen predict large-scale distribution of soil fungal communities in temperate and alpine shrub ecosystems. Eur. J. Soil Biol. 2021, 102, 103270. [Google Scholar] [CrossRef]
  68. Hooper, D.U.; Bignell, D.E.; Brown, V.K.; Brussard, L.; Dangerfield, J.M.; Wall, D.H.; Wardle, D.A.; Coleman, D.C.; Giller, K.E.; Lavelle, P.; et al. Interactions between aboveground and belowground biodiversity in terrestrial ecosystems: Patterns, mechanisms, and feedbacks. BioScience 2000, 50, 1049–1061. [Google Scholar] [CrossRef]
  69. Tedersoo, L.; Bahram, M.; Põlme, S.; Kõljalg, U.; Yorou, N.S.; Wijesundera, R.; Villarreal Ruiz, L.; Vasco-Palacios, A.M.; Thu, P.Q.; Suija, A.; et al. Fungal biogeography. Global diversity and geography of soil fungi. Science 2014, 346, 1256688. [Google Scholar] [CrossRef] [Green Version]
  70. Fierer, N. Embracing the unknown: Disentangling the complexities of the soil microbiome. Nat. Rev. Microbiol. 2017, 15, 579–590. [Google Scholar] [CrossRef]
  71. de Vries, F.T.; Manning, P.; Tallowin, J.R.B.; Mortimer, S.R.; Pilgrim, E.S.; Harrison, K.A.; Hobbs, P.J.; Quirk, H.; Shipley, B.; Cornelissen, J.H.C.; et al. Abiotic drivers and plant traits explain landscape-scale patterns in soil microbial communities. Ecol. Lett. 2012, 15, 1230–1239. [Google Scholar] [CrossRef]
  72. Liu, S.; Yu, H.; Yu, Y.; Huang, J.; Zhou, Z.; Zeng, J.; Chen, P.; Xiao, F.; He, Z.; Yan, Q. Ecological stability of microbial communities in Lake Donghu regulated by keystone taxa. Ecol. Indic. 2022, 136, 108695. [Google Scholar] [CrossRef]
  73. Banerjee, S.; Schlaeppi, K.; van der Heijden, M.G.A. Keystone taxa as drivers of microbiome structure and functioning. Nat. Rev. Microbiol. 2018, 16, 567–576. [Google Scholar] [CrossRef] [PubMed]
  74. Pratt, R.G. Johnsongrass, yellow foxtail, and broadleaf signalgrass as new hosts for six species of Bipolaris, Curvularia, and Exserohilum pathogenic to bermudagrass. Plant Dis. 2006, 90, 528. [Google Scholar] [CrossRef] [PubMed]
  75. Kumar, J.; Schäfer, P.; Hückelhoven, R.; Langen, G.; Baltruschat, H.; Stein, E.; Nagarajan, S.; Kogel, K.-H. Bipolaris sorokiniana, a cereal pathogen of global concern: Cytological and molecular approaches towards better control. Mol. Plant Pathol. 2002, 3, 185–195. [Google Scholar] [CrossRef] [PubMed]
  76. Flory, S.L.; Kleczewski, N.; Clay, K. Ecological consequences of pathogen accumulation on an invasive grass. Ecosphere 2011, 2, 120. [Google Scholar] [CrossRef]
  77. Stricker, K.B.; Harmon, P.F.; Goss, E.M.; Clay, K.; Luke Flory, S. Emergence and accumulation of novel pathogens suppress an invasive species. Ecol. Lett. 2016, 19, 469–477. [Google Scholar] [CrossRef] [PubMed]
  78. Merzaeva, O.V.; Shirokikh, I.G. Colonization of plant rhizosphere by actinomycetes of different genera. Microbiology 2006, 75, 226–230. [Google Scholar] [CrossRef]
  79. Kaushik, R.; Pandit, M.K.; Meyerson, L.A.; Chaudhari, D.S.; Sharma, M.; Dhotre, D.; Shouche, Y.S. Contrasting composition, diversity and predictive metabolic potential of the rhizobacterial microbiomes associated with native and invasive Prosopis congeners. Curr. Microbiol. 2021, 78, 2051–2060. [Google Scholar] [CrossRef]
  80. Franco-Correa, M.; Quintana, A.; Duque, C.; Suarez, C.; Rodríguez, M.X.; Barea, J.-M. Evaluation of actinomycete strains for key traits related with plant growth promotion and mycorrhiza helping activities. Appl. Soil Ecol. 2010, 45, 209–217. [Google Scholar] [CrossRef]
  81. Stefan, L.; Hartmann, M.; Engbersen, N.; Six, J.; Schöb, C. Positive effects of crop diversity on productivity driven by changes in soil microbial composition. Front. Microbiol. 2021, 12, 660749. [Google Scholar] [CrossRef] [PubMed]
  82. Olanrewaju, O.S.; Babalola, O.O. Streptomyces: Implications and interactions in plant growth promotion. Appl. Microbiol. Biotechnology 2019, 103, 1179–1188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. Li, Q.; Wan, F.; Zhao, M. Distinct soil microbial communities under Ageratina adenophora invasions. Plant Biol. 2022, 24, 430–439. [Google Scholar] [CrossRef] [PubMed]
Diversity 14 00992 g001 550
Figure 1. Effects of invasive species richness and evenness on the OTUs, Shannon, Simpson, Chao1 and ACE of soil fungal communities (A–E) and soil bacterial communities (F–J). Raw data points are shown. See Table 1A,B for the results of the linear mixed models.
Figure 1. Effects of invasive species richness and evenness on the OTUs, Shannon, Simpson, Chao1 and ACE of soil fungal communities (A–E) and soil bacterial communities (F–J). Raw data points are shown. See Table 1A,B for the results of the linear mixed models.
Diversity 14 00992 g001
Diversity 14 00992 g002 550
Figure 2. Results of PCoA for soil fungal (A) and bacterial (B) communities. See Table 3A for the results of Adonis test. The bold boxes indicate the central location of the sample points under different richness treatments.
Figure 2. Results of PCoA for soil fungal (A) and bacterial (B) communities. See Table 3A for the results of Adonis test. The bold boxes indicate the central location of the sample points under different richness treatments.
Diversity 14 00992 g002
Diversity 14 00992 g003 550
Figure 3. Relative abundance of the 10 most abundant phyla of soil fungi (A), the 20 most abundant phyla of soil bacteria (B) and the 20 most abundant genera of soil fungi (C) and bacteria (D) under the communities with different invasive plant species richness and evenness.
Figure 3. Relative abundance of the 10 most abundant phyla of soil fungi (A), the 20 most abundant phyla of soil bacteria (B) and the 20 most abundant genera of soil fungi (C) and bacteria (D) under the communities with different invasive plant species richness and evenness.
Diversity 14 00992 g003
Diversity 14 00992 g004 550
Figure 4. Relationships of the relative abundance of the fungal phylum of Ascomycota and Rozellomycota, the fungal genus of Bipolaris, unidentified_Rozellomycota_sp and Clitopilus (A), the bacterial phylum of Actinobacteriota and the bacterial genus of Streptomyces (B) with invasive plant richness. Raw data points are shown. See Table 4 for the results of the linear mixed models.
Figure 4. Relationships of the relative abundance of the fungal phylum of Ascomycota and Rozellomycota, the fungal genus of Bipolaris, unidentified_Rozellomycota_sp and Clitopilus (A), the bacterial phylum of Actinobacteriota and the bacterial genus of Streptomyces (B) with invasive plant richness. Raw data points are shown. See Table 4 for the results of the linear mixed models.
Diversity 14 00992 g004
Table
Table 1. Summary of linear mixed models testing the effects of invasive species richness, evenness and their interaction on alpha diversity of soil fungal communities (A), soil bacterial communities (B) and soil physico-chemical properties (C). Species composition was included as a random term. Degrees of freedom are (1, 38), (1, 48) and (1, 48) for the effects of richness, evenness and their interaction, respectively.
Table 1. Summary of linear mixed models testing the effects of invasive species richness, evenness and their interaction on alpha diversity of soil fungal communities (A), soil bacterial communities (B) and soil physico-chemical properties (C). Species composition was included as a random term. Degrees of freedom are (1, 38), (1, 48) and (1, 48) for the effects of richness, evenness and their interaction, respectively.
Richness (R)Evenness (E)R’ E
VariableFPFPFP
(A) Soil fungal communities
OTUs0.5150.4770.3370.5640.2980.588
Shannon0.5550.4610.0070.9330.2920.592
Simpson0.2860.5960.0330.8570.7810.381
Chao10.2840.5970.1700.6820.3570.553
ACE0.3410.5630.1280.7220.3160.577
(B) Soil bacterial communities
OTUs0.5850.4491.3440.2520.0080.931
Shannon0.5680.4561.8560.1800.7680.385
Simpson2.1550.1502.2040.1441.4330.237
Chao11.6680.2042.6880.1080.5870.447
ACE1.2320.2742.5290.1180.1500.701
(C) Soil physico-chemical properties
pH0.0120.9130.0040.9510.4480.506
Organic matter0.0190.8910.7240.3991.3170.257
Total N1.5080.2271.2570.2682.3030.136
NH4_N0.0210.8861.8350.1820.8430.363
NO3_N0.0050.9442.4270.1262.7550.104
Total P0.4750.4950.2770.6020.0370.849
Available P0.0580.8112.9770.0910.8010.375
Available K0.0230.8820.8840.3523.2720.077
Table
Table 2. Soil physico-chemical properties under communities with different levels of invasive plant species richness and evenness (mean ± SE). See Table 1C for the results of the linear mixed models.
Table 2. Soil physico-chemical properties under communities with different levels of invasive plant species richness and evenness (mean ± SE). See Table 1C for the results of the linear mixed models.
RichnessEvennesspH Organic matter
(g/kg)		Total N
(mg/g)		NH4_N
(mg/kg)		NO3_N
(mg/kg)		Total P
(mg/g)		Available P
(mg/kg)		Available K
(mg/kg)
1Low7.27 ± 0.04285.05 ± 17.480.77 ± 0.0710.45 ± 1.2033.76 ± 3.243.45 ± 0.06122.05 ± 7.49163.27 ± 8.90
2Low7.35 ± 0.05303.00 ± 37.820.78 ± 0.0811.90 ± 2.2937.29 ± 6.683.43 ± 0.14125.64 ± 17.72182.28 ± 31.35
High7.34 ± 0.06328.04 ± 27.280.58 ± 0.068.74 ± 1.3335.72 ± 7.623.48 ± 0.11122.13 ± 15.25189.38 ± 24.27
4Low7.34 ± 0.05275.48 ± 37.520.67 ± 0.099.96 ± 1.6936.20 ± 6.913.32 ± 0.10132.27 ± 12.46180.98 ± 27.74
High7.26 ± 0.09303.12 ± 18.880.65 ± 0.068.21 ± 0.6131.32 ± 3.713.47 ± 0.12105.33 ± 11.21161.78 ± 13.50
8Low7.27 ± 0.04296.57 ± 27.730.66 ± 0.0511.12 ± 2.2243.31 ± 6.003.39 ± 0.20139.36 ± 13.88191.89 ± 18.65
High7.29 ± 0.05278.40 ± 11.350.70 ± 0.0511.11 ± 1.4826.67 ± 4.403.37 ± 0.20115.02 ± 16.12150.62 ± 16.54
Table
Table 3. Adonis test for differences in community composition of fungi and bacteria between different richness and evenness treatments of invasive species based on Bray-Curtis distance.
Table 3. Adonis test for differences in community composition of fungi and bacteria between different richness and evenness treatments of invasive species based on Bray-Curtis distance.
dfFR2P
(A) Comparison among different richness of alien invasive plant species
Fungi
1 vs. 2 species1 (48)0.7040.0140.872
1 vs. 4 species1 (48)1.1350.0230.291
1 vs. 8 species1 (48)3.0480.0600.001
2 vs. 4 species1 (38)0.7470.0190.807
2 vs. 8 species1 (38)1.8030.0450.030
4 vs. 8 species1 (38)1.9670.0490.016
Bacteria
1 vs. 2 species1 (48)1.3330.0270.113
1 vs. 4 species1 (48)1.7670.0360.017
1 vs. 8 species1 (48)1.1490.0230.242
2 vs. 4 species1 (38)0.7630.0200.812
2 vs. 8 species1 (38)1.5950.0400.026
4 vs. 8 species1 (38)1.7910.0450.021
(B) Comparison among different evenness of alien invasive plant species
Fungi
Low vs. high evenness of the 2 species1 (18)0.9100.0480.517
Low vs. high evenness of the 4 species1 (18)0.6370.0340.929
Low vs. high evenness of the 8 species1 (18)0.7370.0390.844
Bacteria
Low vs. high evenness of the 2 species1 (18)0.6940.0370.930
Low vs. high evenness of the 4 species1 (18)0.8140.0430.593
Low vs. high evenness of the 8 species1 (18)0.9580.0510.501
Table
Table 4. Summary of linear mixed models testing the effects of invasive species richness, evenness and their interaction on the relative abundance of (A) soil fungal and (B) soil bacterial taxa. Values are in bold when p < 0.05. Species composition was included as a random term. Degrees of freedom are (1, 38), (1, 48) and (1, 48) for the effects of richness, evenness and their interaction, respectively.
Table 4. Summary of linear mixed models testing the effects of invasive species richness, evenness and their interaction on the relative abundance of (A) soil fungal and (B) soil bacterial taxa. Values are in bold when p < 0.05. Species composition was included as a random term. Degrees of freedom are (1, 38), (1, 48) and (1, 48) for the effects of richness, evenness and their interaction, respectively.
VariableRichness (R)Evenness (E)R × E
FPFPFP
(A) Fungi
Phylum
Ascomycota4.8960.0330.1190.7320.8940.349
Rozellomycota7.3650.0100.0930.7620.1800.673
Genus
Bipolaris5.2030.0280.0220.8830.2750.602
unidentified_Rozellomycota_sp7.8350.0080.0430.8360.0110.918
Clitopilus6.0760.0180.6060.4400.2220.639
(B) Bacteria
Phylum
Actinobacteriota4.9200.0331.8380.1820.8440.363
Bdellovibrionota0.2520.6190.2100.6497.7820.008
Armatimonadota1.0650.3094.3580.0420.0180.894
Genus
Sphingomonas1.4650.2340.0670.7964.5760.038
Buchnera0.3140.5790.9180.3437.5600.008
Streptomyces8.8220.0056.0240.0180.1260.724
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, X.; Wang, X.; Wang, W.; Wang, J.; Yu, F. Effects of Invasive Plant Diversity on Soil Microbial Communities. Diversity 2022, 14, 992. https://doi.org/10.3390/d14110992

AMA Style

Wang X, Wang X, Wang W, Wang J, Yu F. Effects of Invasive Plant Diversity on Soil Microbial Communities. Diversity. 2022; 14(11):992. https://doi.org/10.3390/d14110992

Chicago/Turabian Style

Wang, Xiaoyan, Xue Wang, Wei Wang, Jiang Wang, and Feihai Yu. 2022. "Effects of Invasive Plant Diversity on Soil Microbial Communities" Diversity 14, no. 11: 992. https://doi.org/10.3390/d14110992

APA Style

Wang, X., Wang, X., Wang, W., Wang, J., & Yu, F. (2022). Effects of Invasive Plant Diversity on Soil Microbial Communities. Diversity, 14(11), 992. https://doi.org/10.3390/d14110992

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop