New Updates on the Distribution of Scapania umbrosa (Schrad.) Dumort. (Scapaniaceae, Marchantiophyta) in Pacific Asia
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area and Specimen Collection
2.2. Molecular-Genetic Analysis
2.2.1. Taxon Sampling
2.2.2. DNA Isolation, Amplification, and Sequencing
2.2.3. Phylogenetic Analyses
3. Results
3.1. Molecular-Genetic Estimations
3.2. Herbarium Specimens and Morphology Implication
3.3. Taxonomy
4. Discussion
4.1. Molecular Divergence
4.2. Distribution
4.3. Ecology
4.4. Morphological Differentiation
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Heinrichs, J.; Hentschel, J.; Bombosch, A.; Fiebig, A.; Reise, J.; Edelmann, M.; Kreier, H.-P.; Schäfer-Verwimp, A.; Caspari, S.; Schmidt, A.; et al. One species or at least eight? Delimination and distribution of Frullania tamarisci (L.) Dumort. s.l. (Jungermanniopsida, Porellales) inferred from nuclear and chloroplast DNA markers. Mol. Phylogenet. Evol. 2010, 56, 1105–1114. [Google Scholar] [CrossRef] [PubMed]
- Aranda, S.C.; Gradstein, S.R.; Patiño, J.; Laenen, B.; Désamoré, A.; Patiño, J.; Vanderpoorten, A. Phylogeny, classification and species delimitation in the liverwort genus Odontoschisma (Cephaloziaceae). Taxon 2014, 63, 1008–1025. [Google Scholar] [CrossRef]
- Bakalin, V.A.; Vilnet, A.A.; Choi, S.S.; Nguyen, V.S. Blepharostoma trichophyllum s.l. (Marchantiophyta): The Complex of Sibling Species and Hybrids. Plants 2020, 9, 1423. [Google Scholar] [CrossRef] [PubMed]
- Bakalin, V.A.; Maltseva, Y.D.; Müller, F.; Klimova, K.G.; Nguyen, V.S.; Choi, S.S.; Troitsky, A.V. Calypogeia (Calypogeiaceae, Marchantiophyta) in Pacific Asia: Updates from Molecular Revision with Particular Attention to the Genus in North Indochina. Plants 2022, 11, 983. [Google Scholar] [CrossRef]
- Bakalin, V.A.; Vilnet, A.A.; Maltseva, Y.D.; Klimova, K.G.; Bakalin, D.A.; Choi, S.S. Hidden Diversity within Tetralophozia filiformis (Marchantiophyta, Anastrophyllaceae) in East Asia. Plants 2022, 11, 3121. [Google Scholar] [CrossRef] [PubMed]
- Konstantinova, N.A. Distribution patterns of the North Holarctic hepatics. Arctoa 2000, 9, 29–94. [Google Scholar] [CrossRef]
- Heinrichs, J.; Bombosch, A.; Feldberg, K.; Kreier, H.P.; Hentschel, J.; Eckstein, J.; Long, D.; Zhu, R.-L.; Schäfer-Verwimp, A.; Schmidt, A.R.; et al. A phylogeny of the northern temperate leafy liverwort genus Scapania (Scapaniaceae, Jungermanniales). Mol. Phylogenet. Evol. 2012, 62, 973–985. [Google Scholar] [CrossRef]
- Choi, S.S.; Sun, B.Y.; Bakalin, V.A. Scapania and Macrodiplophyllum in the Russian Far East. Bot. Pac. 2012, 1, 31–95. [Google Scholar] [CrossRef]
- Mochalova, O.A.; Yakubov, V.V. Flora of Commander Islands; Institute of Biology and Soil Sciences: Vladivostok, Russia, 2004; p. 120. [Google Scholar]
- Bakalin, V.A.; Cherdantseva, V.Y. Bryophyte flora of Mednyj Island and bryogeography of Aleutians (North Pacific). In Proceedings of the VIII International Scientific Conference “Conservation of Biodiversity of Kamchatka and Coastal Waters”, Petropavlovsk-Kamchatsky, Russia, 27–28 November 2007; pp. 36–56. [Google Scholar]
- Fedosov, V.E.; Ignatova, E.A.; Ignatov, M.S.; Maksimov, A.I.; Zolotov, V.I. Moss flora of Bering Island (Commander Islands North Pacific). Arctoa 2012, 21, 133–164. [Google Scholar] [CrossRef]
- Beck, H.E.; McVicar, T.R.; Vergopolan, N.; Berg, A.; Lutsko, N.J.; Dufour, A.; Zeng, Z.; Jiang, X.; van Dijk, A.I.J.M.; Miralles, D.G. High-resolution (1 km) Köppen-Geiger maps for 1901–2099 based on constrained CMIP6 projections. Sci. Data 2023, 10, 724. [Google Scholar] [CrossRef]
- Kursanova, I.A.; Savchenko, V.G. The climate of the Commander Islands. Voprosy Geografii Kamchatki 1966, 4, 11–22. [Google Scholar]
- Index Herbariorum. Available online: https://sweetgum.nybg.org/science/ih/ (accessed on 20 March 2024).
- GBIF. Scapania umbrosa (Schrad.) Dumort. POLYGON((129.50900 40.48233,190.02186 40.48233,190.02186 64.67711,129.50900 64.67711,129.50900 40.48233)). Available online: https://www.gbif.org/ru/occurrence/map?has_coordinate=true&has_geospatial_issue=false&taxon_key=4277183&geometry=POLYGON((129.50900%2040.48233,190.02186%2040.48233,190.02186%2064.67711,129.50900%2064.67711,129.50900%2040.48233))&occurrence_status=present (accessed on 18 March 2024).
- Bakalin, V.; Vilnet, A.; Ma, W.Z.; Klimova, K. The differentiation and speciation of Scapania javanica and S. undulata complexes in the Eastern Sino-Himalayas and perimeters for Scapania Sect. Stephania (Scapaniaceae, Hepaticae). Phytotaxa 2019, 400, 123–144. [Google Scholar] [CrossRef]
- Bakalin, V.A.; Maltseva, Y.D.; Vilnet, A.A.; Choi, S.S. The transfer of Tritomaria koreana to Lophozia has led to recircumscription of the genus and shown convergence in Lophoziaceae (Hepaticae). Phytotaxa 2021, 512, 41–56. [Google Scholar] [CrossRef]
- Friedl, T. Evolution of the polyphyletic genus Pleurastrum (Chlorophyta): Inferences from nuclear-encoded ribosomal DNA sequences and motile cell ultrastructure. Phycologia 1996, 35, 456–469. [Google Scholar] [CrossRef]
- Milyutina, I.A.; Goryunov, D.V.; Ignatov, M.S.; Ignatova, E.A.; Troitsky, A.V. The phylogeny of Schistidium (Bryophyta, Grimmiaceae) based on the primary and secondary structure of nuclear rDNA internal transcribed spacers. Mol. Biol. 2010, 44, 883–897. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usa-bility. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef]
- Katoh, K.; Toh, H. Recent developments in the MAFFT multiple sequence alignment program. Brief. Bioinform. 2008, 9, 286–298. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar] [CrossRef]
- Felsenstein, J. Maximum Likelihood and Minimum-Steps Methods for Estimating Evolutionary Trees from Data on Discrete Characters. Syst. Biol. 1973, 22, 240–249. [Google Scholar] [CrossRef]
- Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Huelsenbeck, J.P.; Ronquist, F.; Nielsen, R.; Bollback, J.P. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 2001, 294, 2310–2314. [Google Scholar] [CrossRef] [PubMed]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Huson, D.H.; Bryant, D. Application of Phylogenetic Networks in Evolutionary Studies. Mol. Biol. Evol. 2006, 23, 254–267. [Google Scholar] [CrossRef] [PubMed]
- Clement, M.; Snell, Q.; Walke, P.; Posada, D.; Crandall, K. TCS: Estimating Gene Genealogies. In Proceedings of the 16th International Parallel and Distributed Processing Symposium, Washington, DC, USA, 15–19 April 2002; IEEE: Fort Lauderdale, FL, USA, 2002; p. 33. [Google Scholar]
- Leigh, J.W.; Bryant, D. Popart: Full-feature Software for Haplotype Network Construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
- Melechin, A.; Konstantinova, N.; Davydov, D.; Borovitchev, E.; Shalygin, S.L. IS Dataset. Cyanoprocaryota, Lichens, Bryophyte. Version 1.7. L. 2021. Occurrence Dataset. Available online: https://www.gbif.org/occurrence/3332757901 (accessed on 19 March 2024).
- Melechin, A.; Konstantinova, N.; Davydov, D.; Borovitchev, E.; Shalygin, S.L. IS Dataset. Cyanoprocaryota, Lichens, Bryophyte. Version 1.7. L. 2021. Occurrence Dataset. Available online: https://www.gbif.org/occurrence/3332757897 (accessed on 19 March 2024).
- Cris, C.O.; Melechin, A. CRIS Data Set. Version 1.5. L. 2019. Occurrence Dataset. Available online: https://www.gbif.org/occurrence/1914165152 (accessed on 19 March 2024).
- Melechin, A.; Konstantinova, N.; Davydov, D.; Borovitchev, E.; Shalygin, S.L. IS Dataset. Cyanoprocaryota, Lichens, Bryophyte. Version 1.7. L. 2021. Occurrence Dataset. Available online: https://www.gbif.org/occurrence/3332786681 (accessed on 19 March 2024).
- Kukk, T. Estonian University of Life Sciences Institute of Agricultural and Environmental Sciences Vascular Plant Herbarium. Estonian University of Life Sciences. Occurrence Dataset. Available online: https://www.gbif.org/occurrence/4030719086 (accessed on 19 March 2024).
- Kukk, T. Estonian University of Life Sciences Institute of Agricultural and Environmental Sciences Vascular Plant Herbarium. Estonian University of Life Sciences. Occurrence Dataset. Available online: https://www.gbif.org/occurrence/4030715296 (accessed on 19 March 2024).
- Schuster, R.M. The Hepaticae and Anthocerotae of North America East of the Hundredth Meridian. III; Columbia University Press: New York, NY, USA, 1974; 880p. [Google Scholar]
- Paton, J.A. The Liverwort Flora of the British Isles; Harley Books: Colchester, UK, 1999; p. 626. [Google Scholar]
- Damsholt, K. Illustrated Flora of Nordic Liverworts and Hornworts; Nordic Bryological Society: Lund, Sweden, 2002; 839p. [Google Scholar]
- Cris, C.O.; Melechin, A. CRIS Data Set. Version 1.5. L. 2019. Occurrence Dataset. Available online: https://www.gbif.org/occurrence/1914149108 (accessed on 19 March 2024).
- Cris, C.O.; Melechin, A. CRIS Data Set. Version 1.5. L. 2019. Occurrence Dataset. Available online: https://www.gbif.org/occurrence/1914149080 (accessed on 19 March 2024).
- Melechin, A.; Konstantinova, N.; Davydov, D.; Borovitchev, E.; Shalygin, S.L. IS Dataset. Cyanoprocaryota, Lichens, Bryophyte. Version 1.7. L. 2021. Occurrence Dataset. Available online: https://www.gbif.org/occurrence/3332817477 (accessed on 19 March 2024).
- Maltseva, Y.D.; Fedosov, V.E.; Bakalin, V.A.; Klimova, K.G.; Choi, S.S. One Species or Two: A Puzzling Case from Scapaniaceae (Marchantiophyta). Diversity 2023, 15, 205. [Google Scholar] [CrossRef]
- Davison, P.G. Floristic and Phytogeographic Studies of the Hepatic Flora of the Aleutian Islands, Alaska. Ph.D. Thesis, The University of Tennessee, Knoxville, TN, USA, 1993. [Google Scholar]
- Talbot, S.S.; Schofield, W.B.; Váňa, J.; Talbot, S.L. Liverworts from Attu Island, Near Islands, Aleutian Islands, Alaska (USA) with comparison to the Commander Islands (Russia). Bot. Pac. 2018, 7, 127–141. [Google Scholar] [CrossRef]
- Hodgetts, N.; Lockhart, N. Checklist and Country Status of European Bryophytes—Update 2020; Irish Wildlife Manuals, No. 123; National Parks and Wildlife Service, Department of Culture, Heritage and the Gaeltacht: Dublin, Ireland, 2020.
- Hong, W.S. The genus Scapania in western North America. II. Taxonomic treatment. Bryologist 1980, 83, 40–59. [Google Scholar] [CrossRef]
- Bryophyte Flora of North America. XXX. SCAPANIA (Dumortier) Dumortier. Available online: http://www.mobot.org/plantscience/bfna/V3/Scapania_R2.pdf (accessed on 21 February 2024).
- Konstantinova, N.A.; Bakalin, V.A.; Andrejeva, E.N.; Bezgodov, A.G.; Borovichev, E.A.; Dulin, M.V.; Mamontov, Y.S. Checklist of liverworts (Marchantiophyta) of Russia. Arctoa 2009, 18, 1–64. [Google Scholar] [CrossRef]
- Potemkin, A.D.; Sofronova, E.V. Liverworts and Hornworts of Russia. Vol. 1; Boston-Spectr: Saint Petersburg, Russia, 2009; 368p. [Google Scholar]
- Philippov, D.A.; Dulin, M.V. New liverwort records from Vologda Province. 3. Arctoa 2012, 21, 279–280. [Google Scholar] [CrossRef]
- Borovichev, E.A. New liverwort records from Murmansk Province. 4. Arctoa 2013, 22, 239–240. [Google Scholar] [CrossRef]
- Potemkin, A.D.; Rozantseva, E.I.; Kotkova, V.M. New liverwort records from Saint Petersburg. 2. Arctoa 2015, 24, 226–227. [Google Scholar] [CrossRef]
- Zerov, D.K. Liverworts of Western Transcaucasia. In Proceedings of the III Transcaucasia Conference on Spore Plants; Institute of Botany AN GSSR: Tbilisi, Georgia, 1968; pp. 259–260. [Google Scholar]
- Konstantinova, N.A.; Potemkin, A.D.; Schljakov, R.N. Checklist of the Hepaticae and Anthocerotae of the former USSR. Arctoa 1992, 1, 87–127. [Google Scholar] [CrossRef]
- Konstantinova, N.A.; Akatova, T.V.; Savchenko, A.N. Hepatics of Caucasian State Nature Reserve (North-west Caucasus, Russia). Arctoa 2009, 18, 121–134. [Google Scholar] [CrossRef]
- Bakalin, V.A.; Molokova, N.I.; Otnyukova, T.N. On the liverworts flora of Todzha valley (Tuva republic, South Siberia). Arctoa 2001, 10, 19–26. [Google Scholar] [CrossRef]
- Bakalin, V.A. Hepatics of Stanovoye Nagor’e uplands (Eastern Siberia). Arctoa 2004, 13, 73–83. [Google Scholar] [CrossRef]
- Bakalin, V.A. New liverwort records from Sakhalin Province. 2. Southern Kuril Islands. Arctoa 2007, 16, 202–209. [Google Scholar] [CrossRef]
- Bakalin, V.A. Hepatics (Marchantiophyta, Anthocerotophyta) Flora and Phytogeography of Kamchatka and Adjacent Islands; KMK Scientific Press: Moscow, Russia, 2009; pp. 1–375. [Google Scholar]
- Bakalin, V.A. Distribution of Bryophytes in the Russian Far East. Part. I. Hepatics; Izd-vo DVFU: Vladivostok, Russia, 2010; pp. 1–175. [Google Scholar]
- Choi, S.S.; Bakalin, V.; Park, S.J. Integrating continental mainland and islands in temperate East Asia: Liverworts and hornworts of the Korean Peninsula. PhytoKeys 2021, 176, 131–226. [Google Scholar] [CrossRef]
- Kamimura, M. Contributio ad Floram Hepaticarum Shikokuensem; Seikando: Kochi, Japan, 1952; p. 185. [Google Scholar]
- Amakawa, T.; Hattori, S. A revision of the Japanese species of the Scapaniaceae, III. J. Hattori Bot. Lab. 1955, 14, 71–90. [Google Scholar]
- Potemkin, A.D. Phylogenetic system and classification of the family Scapaniaceae Mig. emend. Potemkin (Hepaticae). Ann. Bot. Fenn. 2002, 39, 309–334. [Google Scholar]
- Chien, G.; Yu-Huan, W. (Eds.) Flora Bryophytorum Sinicorum, Vol. 10. Jungermanniales (Lophoziaceae–Neotrichocoleaceae); Science Press: Beijing, China, 2008; 264p. [Google Scholar]
- Bakalin, V.A.; Klimova, K.G. Gyrothyraceae (Marchantiophyta)—A new family for the Russian liverwort flora. Novosti Sist. Nizsh. Rast. 2023, 57, B1–B20. [Google Scholar] [CrossRef]
- Cherdantseva, V.Y. Moss species new and rare to Russia from Medny Island (Commander Islands). Bot. Zhurn. 2010, 95, 85–92. [Google Scholar]
GenBank Name | Accepted Name | Specimen Voucher | GenBank Accession Number | |
---|---|---|---|---|
ITS1–ITS2 nrDNA | trnL–trnF cpDNA | |||
Scapania apiculata Spruce | Scapania apiculata Spruce | Russia, Rep. Buryatiya, N.A. Konstantinova, 2 August 2022, HRE 49 (KPABG) | EU791741 | EU791633 |
Scapania umbrosa (Schrad.) Dumort. | Scapania umbrosa (Schrad.) Dumort. | Germany, Eckstein 6509 (GOET) | JN631481 | JN631615 |
Scapania umbrosa (Schrad.) Dumort. | Scapania umbrosa (Schrad.) Dumort. | Germany, Schroeder 3-9-1996 (JE) | JN631483 | JN631617 |
Scapania umbrosa (Schrad.) Dumort. | Scapania umbrosa (Schrad.) Dumort. | Russia, Komi Rep., M. Dulin, MD 139-1-99 (KPABG) | EU791740 | EU791632 |
Scapania umbrosa (Schrad.) Dumort. | Scapania umbrosa (Schrad.) Dumort. | Germany, Saxony, M. Reimann, 6 August 1997, GLM-B-20091 | - | OR449400 |
Scapania umbrosa (Schrad.) Dumort. | Scapania umbrosa (Schrad.) Dumort. | Siberia, Tuva Republic, V.A. Bakalin, 8 June 1999, VB-99-6-1…33 | OR437974 | OR449401 |
Scapania umbrosa (Schrad.) Dumort. | Scapania umbrosa (Schrad.) Dumort. | USA, Alaska State, N.A. Konstantinova, 29 June 1992, NK28-1-92 | OR437975 | OR449402 |
Scapania umbrosa (Schrad.) Dumort. | Scapania umbrosa (Schrad.) Dumort. | Russia, Kamchatka Territory, Aleutsky District, Commander Islands, K.G. Klimova, 30 August 2022, Com-67-1-22 (VBGI) | OR437976 | OR449403 |
Scapania undulata (L.) Dumort. | Scapania undulata (L.) Dumort. | Russia, Murmanskaya Province, N.A. Konstantinova, 208-2-02 (KPABG) | EU791751 | EU791642 |
Scapania undulata (L.) Dumort. | Scapania undulata (L.) Dumort. | USA, Shevock et al. 29009 (GOET) | JN631489 | JN631623 |
Scapania undulata (L.) Dumort. | Scapania undulata (L.) Dumort. | Russia, Sakhalin Province, Kuril Isl., Kunashir I., V.A. Bakalin, and K.G. Klimova, K-42-6-18, 57856 (VBGI), 122474 (KPABG) | MZ272024 | MZ274278 |
Scapania subalpina (Nees ex Lindenb.) Dumort. | Scapania subalpina (Nees ex Lindenb.) Dumort. | Russia, Rep. Buryatiya, N.A. Konstantinova, 136-4-01 (KPABG) | EU791749 | EU791640 |
Scapania subalpina (Nees ex Lindenb.) Dumort. | Scapania subalpina (Nees ex Lindenb.) Dumort. | Russia, Huneck 28-6-1990 (JE) | JN631473 | JN631607 |
Scapania subalpina (Nees ex Lindenb.) Dumort. | Scapania subalpina (Nees ex Lindenb.) Dumort. | Russia, N.A. Konstantinova, Hep. Ross. Exs. 50 (GOET) | JN631474 | JN631608 |
Scapania subalpina (Nees ex Lindenb.) Dumort. | Scapania subalpina (Nees ex Lindenb.) Dumort. | Russia, Murmansk Province, N.A. Konstantinova, 28 September 2019 (KPABG) | OP584680 | OP573519 |
Scapania obscura (Arnell et C.E.O. Jensen) Schiffn. | Scapania obscura (Arnell et C.E.O. Jensen) Schiffn. | Russia, Magadan Province, V.A. Bakalin, Mag-22-6-10 (KPABG) | JX629927 | JX630058 |
Scapania uliginosa (Lindenb.) Dumort. | Scapania uliginosa (Lindenb.) Dumort. | Russia, Murmanskaya Province, V.A. Bakalin, 25-7-01 (KPABG) | EU791739 | EU791631 |
Scapania uliginosa (Lindenb.) Dumort. | Scapania uliginosa (Lindenb.) Dumort. | Austria, Schäfer-Verwimp and Verwimp 18181 (GOET) | JN631479 | JN631613 |
Scapania uliginosa (Lindenb.) Dumort. | Scapania uliginosa (Lindenb.) Dumort. | Russia, Murmansk Province, N.A. Konstantinova, K26-3-88 (KPABG) | OP584677 | OP573516 |
Scapania paludosa (Müll. Frib.) Müll. Frib. | Scapania paludosa (Müll. Frib.) Müll. Frib. | Russia, Kemerovskaya Province, N.A. Konstantinova, 4-3-00 (KPABG) | EU791747 | EU791638 |
Scapania paludosa (Müll. Frib.) Müll. Frib. | Scapania paludosa (Müll. Frib.) Müll. Frib. | Russia, Permskiy Kray, N.A. Konstantinova, K316-2-04 (KPABG) | EU791748 | EU791639 |
Scapania rufidula Warnst. | Scapania rufidula Warnst. | Russia, Rep. Yakutiya, V.A. Bakalin, 35-3-00 (KPABG) | EU791746 | EU791637 |
Scapania spitsbergensis (Lindb.) Müll. Frib. | Scapania spitsbergensis (Lindb.) Müll. Frib. | Svalbard, Spitsbergen, N.A. Konstantinova, K 90-2-06 (KPABG) | EU791761 | EU791652 |
Scapania glaucocephala (Taylor) Austin | Scapania glaucocephala (Taylor) Austin | Russia, Siberia, Buryatiya Rep., N.A. Konstantinova, 64-05-02 (KPABG) | EU791753 | EU791644 |
Scapania hyperborea Jørg. | Scapania hyperborea Jørg. | Russia, Murmansk, N.A. Konstantinova, 509-3a-04 (KPABG) | EU791744 | EU791635 |
Scapania hyperborea Jørg. | Scapania hyperborea Jørg. | Russia, Yakutia, V.A. Bakalin, 1-10-00 (KPABG) | EU791745 | EU791636 |
Scapania tundrae (Arnell) H. Buch | Scapania tundrae (Arnell) H. Buch | Norway, Svalbard, N.A. Konstantinova, A.N. Savchenko, K42-1a-06 (KPABG) | MT334461 | MT338486 |
Scapania tundrae (Arnell) H. Buch | Scapania tundrae (Arnell) H. Buch | Norway, Spitsbergen, N.A. Konstantinova, 140-1-04 (KPABG) | EU791725 and EU791742 | EU791634 |
Scapania paludicola Loeske et Müll. Frib. | Scapania paludicola Loeske et Müll. Frib. | Russia, Karelia, V.A. Bakalin, 11 August 1997 (KPABG) | EU791743 | AF519196 |
Scapania paludicola Loeske et Müll. Frib. | Scapania paludicola Loeske et Müll. Frib. | United Kingdom, Wales, Glamorgan, D.G. Long et al. 40,399 (E) | JN631459 | JN631595 |
Scapania paludicola Loeske et Müll. Frib. | Scapania tundrae (Arnell) H. Buch | Norway, Svalbard, N.A. Konstantinova, K42-1a-06 (KPABG) | OP584679 | OP573518 |
Macrodiplophyllum microdontum (Mitt.) Müll. Frib. | Scapania microdonta (Mitt.) Müll. Frib. | Russia, Primorye Territory, V.A. Bakalin, P-74-11-05 (GOET) | JN631445 | JN631580 |
Macrodiplophyllum microdontum (Mitt.) Müll. Frib. | Scapania microdonta (Mitt.) Müll. Frib. | Russia, Siberia, Buryatiya Rep., N.A. Konstantinova, 146-12-01 (KPABG) | EU791769 | AF519199 |
Locus | Sequence (5′-3′) | Direction | Annealing Temperature (°C) | Reference |
---|---|---|---|---|
trnL–trnF cpDNA | CGAAATTGGTAGACGCTGCG | forward | 62 | [17] |
trnL–trnF cpDNA | TGCCAGAAACCAGATTTGAAC | reverse | 58 | [17] |
ITS1–ITS2 nrDNA | ACCTGCGGAAGGATCATTG | forward | 58 | [18] |
ITS1–ITS2 nrDNA | GATATGCTTAAACTCAGCGG | reverse | 58 | [19] |
Initial Denaturation | 3 min—94 °C | |
Denaturation | 30 s—95 °C | 30 cycles |
Annealing | 20 s (trnL–trnF cpDNA), 30 s (ITS1–ITS2 nrDNA) at 58 °C (trnL–trnF cpDNA), 60 °C (ITS1–ITS2 nrDNA) | |
Elongation | 30 s—72 °C | |
Final elongation | 3 min—72 °C |
No. | Taxa | Infraspecific p-Distances, ITS1–ITS2/trnL–trnF, % | Interspecific p-Distances, ITS1–TS2/trnL–trnF, % | |||||||
---|---|---|---|---|---|---|---|---|---|---|
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | |||
1 | S. apiculata | n/c/n/c | 3.41 | 3.50 | 4.66 | 4.68 | 3.36 | 2.93 | 2.85 | |
2 | S. hyperborea | 0/0 | 10.11 | 0 | 2.07 | 2.1 | 2.44 | 2.2 | 2.16 | |
3 | S. paludicola | 0.13/0 | 10.1 | 1.99 | 1.78 | 1.8 | 2.3 | 2.12 | 2.09 | |
4 | S. tundrae 1 | 3.11/0.44 | 10.78 | 3.81 | 4.38 | 0.29 | 3.5 | 3.29 | 3.25 | |
5 | S. tundrae 2 | 0/0.43 | 10.14 | 3.02 | 3.44 | 1.56 | 3.6 | 3.38 | 3.34 | |
6 | S. umbrosa 1 | n/c/n/c | 8.48 | 8.23 | 8.66 | 8.84 | 8.5 | 0.24 | 0.29 | |
7 | S. umbrosa 2 | 0.73/0.14 | 7.31 | 7.62 | 8.16 | 8.31 | 7.71 | 1.45 | 0.1 | |
8 | S. umbrosa 3 | 0/0.09 | 7.02 | 7.47 | 8.03 | 8.18 | 7.52 | 1.81 | 0.36 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Klimova, K.G.; Maltseva, Y.D.; Bakalin, V.A.; Choi, S.S. New Updates on the Distribution of Scapania umbrosa (Schrad.) Dumort. (Scapaniaceae, Marchantiophyta) in Pacific Asia. Diversity 2024, 16, 297. https://doi.org/10.3390/d16050297
Klimova KG, Maltseva YD, Bakalin VA, Choi SS. New Updates on the Distribution of Scapania umbrosa (Schrad.) Dumort. (Scapaniaceae, Marchantiophyta) in Pacific Asia. Diversity. 2024; 16(5):297. https://doi.org/10.3390/d16050297
Chicago/Turabian StyleKlimova, Ksenia G., Yulia D. Maltseva, Vadim A. Bakalin, and Seung Se Choi. 2024. "New Updates on the Distribution of Scapania umbrosa (Schrad.) Dumort. (Scapaniaceae, Marchantiophyta) in Pacific Asia" Diversity 16, no. 5: 297. https://doi.org/10.3390/d16050297
APA StyleKlimova, K. G., Maltseva, Y. D., Bakalin, V. A., & Choi, S. S. (2024). New Updates on the Distribution of Scapania umbrosa (Schrad.) Dumort. (Scapaniaceae, Marchantiophyta) in Pacific Asia. Diversity, 16(5), 297. https://doi.org/10.3390/d16050297